ID: 1092256342

View in Genome Browser
Species Human (GRCh38)
Location 12:6928338-6928360
Sequence CTGGCTCCGAGCGGGATTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092256342_1092256358 30 Left 1092256342 12:6928338-6928360 CCCGGAATCCCGCTCGGAGCCAG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1092256358 12:6928391-6928413 TCTGCGGCCGCCTGGGCCCCGGG 0: 1
1: 0
2: 2
3: 32
4: 324
1092256342_1092256350 7 Left 1092256342 12:6928338-6928360 CCCGGAATCCCGCTCGGAGCCAG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1092256350 12:6928368-6928390 TCCCGAGCTACCAGCAGGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 61
1092256342_1092256348 2 Left 1092256342 12:6928338-6928360 CCCGGAATCCCGCTCGGAGCCAG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1092256348 12:6928363-6928385 AGCCGTCCCGAGCTACCAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 48
1092256342_1092256356 23 Left 1092256342 12:6928338-6928360 CCCGGAATCCCGCTCGGAGCCAG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1092256356 12:6928384-6928406 GGTAAGGTCTGCGGCCGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 66
1092256342_1092256353 14 Left 1092256342 12:6928338-6928360 CCCGGAATCCCGCTCGGAGCCAG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1092256353 12:6928375-6928397 CTACCAGCAGGTAAGGTCTGCGG 0: 1
1: 0
2: 2
3: 11
4: 143
1092256342_1092256357 29 Left 1092256342 12:6928338-6928360 CCCGGAATCCCGCTCGGAGCCAG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1092256357 12:6928390-6928412 GTCTGCGGCCGCCTGGGCCCCGG 0: 1
1: 0
2: 2
3: 26
4: 277
1092256342_1092256355 22 Left 1092256342 12:6928338-6928360 CCCGGAATCCCGCTCGGAGCCAG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1092256355 12:6928383-6928405 AGGTAAGGTCTGCGGCCGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092256342 Original CRISPR CTGGCTCCGAGCGGGATTCC GGG (reversed) Intronic
901244893 1:7722087-7722109 CTGGCTAGGAGCTGGTTTCCTGG + Intronic
901519904 1:9775538-9775560 CTGGCTCAGGGAGGGATTCATGG - Intronic
903171815 1:21559000-21559022 CTGGCTCTGGGCGAGATGCCAGG - Intronic
904236946 1:29122477-29122499 CTTGATCCGAGCGGTCTTCCCGG - Exonic
906129672 1:43448524-43448546 CTGGCTGCCAGTGGAATTCCTGG - Intronic
912469420 1:109896224-109896246 CTGGCTGTGAGAGGGTTTCCAGG - Intergenic
918042225 1:180920329-180920351 CTGGCTTCGAGTGGCACTCCCGG - Intronic
1066367484 10:34791429-34791451 TTGGCTTCGAGCCGGCTTCCTGG - Intronic
1066422961 10:35278834-35278856 CTGGCCCCGAGAGGGGATCCTGG + Intronic
1070824039 10:79380635-79380657 CTGGCTCCCTGCGGAATCCCTGG + Intergenic
1075689818 10:124387344-124387366 GTTGTTCCCAGCGGGATTCCTGG + Intergenic
1076139067 10:128065111-128065133 CTGGCTCCGGGCGGGGCTGCGGG - Intronic
1076863826 10:133157811-133157833 CTTGCTCCGAGGGGGTTACCGGG - Intergenic
1081578135 11:44332447-44332469 CTGGCTCTGTGCTGGGTTCCGGG - Intergenic
1083401027 11:62423658-62423680 CTGGCTCCCAGCCAGACTCCAGG + Intergenic
1084528204 11:69710745-69710767 CTGGCTCCGTGCAGGACACCAGG - Intergenic
1085350677 11:75796276-75796298 CTGGCTGGGAGAGGGATACCGGG - Intronic
1085854994 11:80166100-80166122 CTGGGTCTGAGAGTGATTCCTGG + Intergenic
1089125044 11:116170914-116170936 CTGGCACCGAGGGGGATCCCAGG + Intergenic
1090349933 11:126101450-126101472 CTGGCCCCCAGCTGCATTCCTGG + Intergenic
1092256342 12:6928338-6928360 CTGGCTCCGAGCGGGATTCCGGG - Intronic
1094646917 12:32334282-32334304 CTGGCTCGCAGCGGGCTTCTAGG + Intronic
1101090533 12:101280384-101280406 CAGGCTCTGAGCGAGACTCCAGG + Intronic
1113945795 13:114043457-114043479 CTGGCTGTGAGCGGGGGTCCCGG - Intronic
1115446290 14:33494163-33494185 CTGGCACCGAGCTGGGCTCCAGG - Intronic
1116973609 14:51093849-51093871 CTGCCTGCGAGCGGGACTCAGGG - Intronic
1118442411 14:65823570-65823592 CTGTCTCTGAGTGGGACTCCGGG + Intergenic
1118466880 14:66039177-66039199 CTGGGTCCCAGCTGGATTCTTGG + Intergenic
1119029404 14:71179870-71179892 CTGTCTCCTACCTGGATTCCTGG - Intergenic
1124376622 15:29132876-29132898 CTGGCTCTGAGCCTGCTTCCCGG - Intronic
1126134544 15:45378032-45378054 CTTGCTCCGAGCGGGAAGCTTGG + Intronic
1128875978 15:71201730-71201752 TTGGCTCTGAGAGGGATTCTTGG + Intronic
1135201318 16:20439976-20439998 CTGGCTCTGAGTGGGAGCCCAGG - Intronic
1135217790 16:20587888-20587910 CTGGCTCTGAGTGGGAGCCCAGG + Intergenic
1135796005 16:25443145-25443167 GTGTCTCCTAGCGGGATACCTGG + Intergenic
1139364655 16:66426400-66426422 CTGGCTCAGGCCGGGGTTCCAGG - Intergenic
1139651631 16:68365198-68365220 CTGGCTCCTGGCTGGATTCTGGG + Intronic
1142017207 16:87756087-87756109 CTTCCTCCCAGCGGGTTTCCAGG - Intronic
1147320410 17:39642535-39642557 CAGGCTCAGAGTGGGTTTCCAGG - Intronic
1147359963 17:39924283-39924305 CTGCCTCCCAGCGGGATCCGAGG - Intronic
1147563519 17:41522843-41522865 CTTGCTCCAAGCGGGATGCCTGG + Intergenic
1157842028 18:50967923-50967945 CTGGCTCTGGGCGCGCTTCCGGG - Intergenic
1159188994 18:65017346-65017368 CTGGCTCAGGGCGGGGCTCCTGG + Intergenic
1160844015 19:1158791-1158813 GTGGCTCTGTGCGGGGTTCCCGG - Intronic
1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG + Intronic
1160937206 19:1602355-1602377 CTGCCTCCGAGCCAGGTTCCAGG - Intronic
1161683086 19:5690271-5690293 CTGGCGCCGCGCGGAACTCCGGG - Exonic
1162203354 19:9037301-9037323 CTGGCCCTGAGCTGGCTTCCAGG - Intergenic
1162460474 19:10811358-10811380 CTGGGCCCCAGAGGGATTCCTGG + Intronic
1166548978 19:43652444-43652466 CTGGCTCGGAGTGGAAGTCCTGG - Intronic
1167746833 19:51356594-51356616 CTGGCTCTGAGCTGGATCCTGGG + Exonic
1168420026 19:56195610-56195632 CTGCCCCGGAGCGGGATTGCCGG - Intronic
1168421093 19:56204227-56204249 CTGCCCCAGAGCGGGATTGCCGG + Intronic
1168424350 19:56226693-56226715 CTGCCCCGGAGCGGGATTGCCGG - Intronic
1168426322 19:56242050-56242072 CTGCCCCGGAGCGGGATTGCCGG + Intronic
926707364 2:15846219-15846241 CTGGCTCAGAGCTGGCCTCCAGG + Intergenic
933264666 2:80169121-80169143 ATAGCTCCGAGCTGGCTTCCAGG + Intronic
937283863 2:120737561-120737583 CGCGCACCGAGCGGGATGCCCGG - Intronic
1169195979 20:3682162-3682184 CAGGCTCCGAGCGGGGTTGGCGG - Exonic
1171385758 20:24768427-24768449 ATAGCTCCCAGCAGGATTCCAGG + Intergenic
1178522603 21:33299097-33299119 GTGGGTCCGAGTGGGTTTCCGGG - Intergenic
1181403918 22:22668444-22668466 CTGCCTCTGGGGGGGATTCCTGG + Intergenic
1183224486 22:36540136-36540158 CTGGCTCAGAGGGGGAGGCCTGG + Intergenic
1185015917 22:48342532-48342554 CTGGTTCTGAGAGAGATTCCTGG - Intergenic
1185278535 22:49960296-49960318 CCGGCCCCGAGCAGGGTTCCTGG - Intergenic
954539718 3:51385382-51385404 CTGGCTCTGAGCGTGCTGCCGGG + Exonic
967968845 3:194984779-194984801 CTGGCCCCATGCGGGACTCCAGG + Intergenic
968085504 3:195872224-195872246 CTGGCCCCGCTCGGGACTCCAGG - Intronic
981093506 4:140756436-140756458 CTGGCGCTGAGCCGGATCCCGGG - Intergenic
985784398 5:1886495-1886517 CTGGCTCCGAGGGGGCCTCGGGG - Intronic
987052231 5:14157261-14157283 CTGCCTCAGTGCGGGATTTCTGG + Intronic
987055309 5:14185458-14185480 CTGGCTCTGAGCAGGCTCCCAGG + Intronic
987415328 5:17655802-17655824 CTGCCTGCGAGGGAGATTCCTGG - Intergenic
990180574 5:53156077-53156099 CTGGCTCCCAGTGGGCTTACTGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
997232255 5:132253614-132253636 CTGGCCCTGAGCCAGATTCCAGG - Intronic
999682004 5:154069320-154069342 CTAGCTCTGAAGGGGATTCCAGG + Intronic
999734982 5:154506284-154506306 CTGGCTCCAAGCAGGACTCTGGG - Intergenic
1001963295 5:175893650-175893672 CTGACTCTGAGCTGGATGCCAGG + Intergenic
1006119511 6:31795569-31795591 CTGGCTGTGAGGTGGATTCCCGG - Exonic
1011094069 6:83638177-83638199 GTGGCTCCGAGCAGGTTTCCCGG + Intronic
1019233080 6:170584780-170584802 CTGCCTCCGAGCCGCTTTCCTGG + Intergenic
1025186287 7:56862152-56862174 CTGGCTCTGAGCTGCAGTCCTGG - Intergenic
1025685634 7:63714746-63714768 CTGGCTCTGAGCTGCAGTCCTGG + Intergenic
1025907877 7:65802497-65802519 CTGGCTCTGAGCTGCAGTCCTGG + Intergenic
1026042663 7:66881322-66881344 CTGGCTCTGAGCTGCAGTCCTGG + Intergenic
1027206104 7:76100767-76100789 CTGGCTCTGAGCTGCAGTCCTGG - Intergenic
1030659556 7:112205591-112205613 CTGGCTCGGATCGACATTCCCGG - Intronic
1033163823 7:139020906-139020928 CTGCCTCCGAGGTGGAGTCCTGG - Intergenic
1038017957 8:23530438-23530460 CTGGCTCCAAGCGAGCTCCCCGG - Intronic
1049349743 8:142158107-142158129 CTGGCTCTGAGCTGGGTGCCGGG - Intergenic
1056297930 9:85211544-85211566 CTGGCTCTGAGCAGGAGTTCAGG - Intergenic
1058687656 9:107491838-107491860 CTGGATCTTAGAGGGATTCCTGG - Intergenic
1058840424 9:108902245-108902267 CTGCCTCCGAGAGGCCTTCCTGG + Intronic
1060192122 9:121599816-121599838 CGGGATCCGAGCGGCATCCCGGG + Intronic
1060937573 9:127524591-127524613 CTGGATTCGAGCGGCATTCCTGG - Intronic
1061091297 9:128428064-128428086 CTGGCTCCCAGCGGGTGCCCTGG + Intronic
1061333930 9:129916861-129916883 CTGGCTGCGAGAGGCATTCTGGG - Intronic
1061755440 9:132809143-132809165 CTGGGTGCCAGCGGCATTCCTGG - Intronic
1061970930 9:134045110-134045132 CAGGCTCTGAGCTGGGTTCCAGG - Intronic
1062219664 9:135408378-135408400 CTGGGTCTGGGTGGGATTCCTGG - Intergenic
1203745448 Un_GL000218v1:38548-38570 CTGGCTCTGAGCGGGACACACGG + Intergenic
1203564662 Un_KI270744v1:80936-80958 CTGGCTCTGAGCGGGACACACGG - Intergenic
1188222942 X:27562405-27562427 CTGGCTACGAGGAGGACTCCTGG - Intergenic
1189262554 X:39688952-39688974 CTGGCTCCGAGCGCGCCGCCGGG - Intergenic
1189723237 X:43941890-43941912 CTGACTCTGAGGGGGATTGCTGG + Intergenic
1200163894 X:154022994-154023016 CTGGCTTGGAGTGGGACTCCTGG + Intronic