ID: 1092256726

View in Genome Browser
Species Human (GRCh38)
Location 12:6929987-6930009
Sequence TCCCAGGCCCATCCCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 383}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092256720_1092256726 2 Left 1092256720 12:6929962-6929984 CCTGACCTTGTAGAAATGGCTGG 0: 1
1: 0
2: 0
3: 29
4: 112
Right 1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG 0: 1
1: 0
2: 4
3: 51
4: 383
1092256714_1092256726 28 Left 1092256714 12:6929936-6929958 CCCTCAACTAACCTTTGGCCTTC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG 0: 1
1: 0
2: 4
3: 51
4: 383
1092256716_1092256726 17 Left 1092256716 12:6929947-6929969 CCTTTGGCCTTCTTCCCTGACCT 0: 1
1: 0
2: 3
3: 39
4: 462
Right 1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG 0: 1
1: 0
2: 4
3: 51
4: 383
1092256719_1092256726 3 Left 1092256719 12:6929961-6929983 CCCTGACCTTGTAGAAATGGCTG 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG 0: 1
1: 0
2: 4
3: 51
4: 383
1092256715_1092256726 27 Left 1092256715 12:6929937-6929959 CCTCAACTAACCTTTGGCCTTCT 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG 0: 1
1: 0
2: 4
3: 51
4: 383
1092256717_1092256726 10 Left 1092256717 12:6929954-6929976 CCTTCTTCCCTGACCTTGTAGAA 0: 1
1: 0
2: 0
3: 30
4: 311
Right 1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG 0: 1
1: 0
2: 4
3: 51
4: 383
1092256723_1092256726 -3 Left 1092256723 12:6929967-6929989 CCTTGTAGAAATGGCTGGGCTCC 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG 0: 1
1: 0
2: 4
3: 51
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092256726 Original CRISPR TCCCAGGCCCATCCCAGGTG AGG Intronic
900078634 1:837944-837966 TGGGAGCCCCATCCCAGGTGTGG + Intergenic
900097903 1:947774-947796 TCCCCAGGCCATCCCGGGTGTGG - Intronic
900139889 1:1135183-1135205 TCCCAGGCCCCTCCCTGGGGAGG - Intergenic
900344243 1:2203558-2203580 CCCCAGCTCCACCCCAGGTGAGG - Intronic
900397968 1:2461020-2461042 ACCCAGGCCCTCCCCATGTGGGG - Intronic
900478886 1:2888836-2888858 TTCCAGGCTCATCCCAGCAGCGG + Intergenic
900659766 1:3776612-3776634 GACCAGGCCCATCCCTGGGGAGG - Intergenic
900804788 1:4760543-4760565 ACCCTGGGCCATCCCAGGGGCGG - Intronic
901854771 1:12037699-12037721 TCCCACACCCCTCCCAGGCGAGG + Intergenic
902170249 1:14604414-14604436 TGCCAGGCCCATCTCAGTTGTGG + Intronic
902277360 1:15349557-15349579 TCCCTTGGCCATGCCAGGTGTGG - Intronic
902811054 1:18888269-18888291 TCACAGGCCAATCTCAGGTGTGG - Intronic
903165572 1:21518087-21518109 ACCAGGGCCCACCCCAGGTGTGG + Intronic
903165752 1:21519268-21519290 ACCAGGGCCCACCCCAGGTGTGG - Intronic
903548859 1:24143671-24143693 TCCCAAGCCCACCCCAAGCGTGG - Intergenic
903554273 1:24181703-24181725 ACCCAGGCCCAGCCCAGGCCTGG + Intronic
904048182 1:27621897-27621919 TCCCCAGCCCAACCCAGCTGGGG - Intronic
904357279 1:29948464-29948486 GCCCAGGCACATAGCAGGTGAGG - Intergenic
904417305 1:30371229-30371251 TCCCAGGGCCAGCCCAGGTCTGG + Intergenic
906072122 1:43024740-43024762 TCCAAGGCCCATTCGAAGTGAGG + Intergenic
906746406 1:48225001-48225023 CCCCTGGCCCCTCCTAGGTGTGG + Intronic
907247628 1:53118037-53118059 TGCCAGGGCCACCGCAGGTGAGG + Intronic
907271039 1:53291310-53291332 TCCCAAGCTCATTCCAGGGGAGG - Intronic
908822490 1:68102770-68102792 TCCCAGACCCCACCCAGGTCTGG + Intronic
912886404 1:113479190-113479212 TCCCTTGCGCTTCCCAGGTGAGG + Intronic
913036370 1:114969910-114969932 TCCCTTGCACTTCCCAGGTGAGG + Intronic
913200363 1:116491105-116491127 TTCCAGCCCCATCCAGGGTGTGG + Intergenic
913430182 1:118781546-118781568 CCCCTTGCCCTTCCCAGGTGAGG + Intergenic
914456903 1:147844850-147844872 GTCCAGGGCCAACCCAGGTGTGG + Intergenic
915167119 1:153954170-153954192 TCCCAGCCCCAACCCAGAAGGGG + Intronic
915561628 1:156691440-156691462 ACCCAGGCCCCTCGCTGGTGAGG + Intergenic
916679992 1:167094991-167095013 TCCCCAGCCCCTCCCAGCTGGGG - Intronic
917157872 1:172024677-172024699 CCCCATGCGCTTCCCAGGTGAGG - Intronic
917271081 1:173275238-173275260 TCCATGTCCCATCCCAGATGAGG + Intergenic
919025316 1:192161657-192161679 TCCCAGACCCTTCCAAGATGAGG + Intronic
920781055 1:208991629-208991651 TCCCTTGCGCTTCCCAGGTGAGG - Intergenic
921188931 1:212693011-212693033 TCCCAGGCCAATCTAGGGTGGGG - Intronic
922575291 1:226657091-226657113 TCCCATGCCCATCGCAGCTCCGG + Intronic
922576729 1:226665829-226665851 GCCACGGCCCAGCCCAGGTGAGG + Intronic
922675738 1:227547841-227547863 TCACAGCCCCAGCCCACGTGGGG - Intergenic
923470950 1:234290623-234290645 TCCAGGGCCCATCCAGGGTGGGG - Intronic
1062932169 10:1360623-1360645 TCCCAGCCCCCGCCCAGCTGTGG + Intronic
1063067496 10:2624091-2624113 CCCCAGGCCCAGACCGGGTGGGG + Intergenic
1063145316 10:3290506-3290528 CCCCCTGCCCACCCCAGGTGAGG - Intergenic
1063458792 10:6202821-6202843 TCCCAGCCCCCTTCCACGTGGGG - Intronic
1063982227 10:11463350-11463372 TCCCAGGTCCTGCCGAGGTGCGG - Exonic
1067994437 10:51255687-51255709 TCCCAGGTGCTTCCCAGCTGAGG + Intronic
1069782444 10:70965318-70965340 TCCCAGCACCAAGCCAGGTGAGG + Intergenic
1069793109 10:71035917-71035939 TGCCAGGCACATCTCAGGAGGGG - Intergenic
1069857205 10:71447867-71447889 TGCCAGCCCCACCCCAGGTCTGG - Intronic
1070646302 10:78204491-78204513 TCCCAGAACCACCCCTGGTGGGG - Intergenic
1070818348 10:79339488-79339510 AGCCAGGCCCTTCCCTGGTGGGG - Intergenic
1070920570 10:80183043-80183065 TCCCCAGCCCATGCCAGGAGGGG - Intronic
1070957527 10:80474160-80474182 TCACAGGCCCATCCCAAGGAAGG - Intronic
1071001006 10:80830352-80830374 TCCCTTGCACTTCCCAGGTGAGG - Intergenic
1071244444 10:83747138-83747160 CCCCTTGCCCTTCCCAGGTGAGG + Intergenic
1071603508 10:86970310-86970332 TCCCCGCCCCATCCCGGCTGGGG + Intronic
1072572711 10:96672737-96672759 TCCCAGTCCTCTCCCAGCTGGGG + Intronic
1072714269 10:97738842-97738864 TCTCAGGCCCAGCCCAGGAGAGG + Intronic
1074771695 10:116739136-116739158 TGCCAGGCACATGCCAGGAGAGG + Intronic
1075175394 10:120155885-120155907 TCCCTTGCACTTCCCAGGTGGGG - Intergenic
1075614121 10:123878890-123878912 TCCAAGGTCCATTCAAGGTGAGG + Intronic
1076302651 10:129439861-129439883 TGCCCAGCCCAGCCCAGGTGTGG - Intergenic
1076472621 10:130729339-130729361 TCCCAGGGTCCTCCCACGTGTGG + Intergenic
1076531378 10:131147562-131147584 ACCGAGGCCCGTTCCAGGTGTGG + Intronic
1076585874 10:131547394-131547416 TGCCAGGCCCATGCCAGGACAGG + Intergenic
1076689145 10:132212013-132212035 TCCCAGGCCCCTCCTCGCTGTGG - Intronic
1076766188 10:132634847-132634869 TCCCAGGCTCATGGCTGGTGTGG + Intronic
1077047924 11:554474-554496 CCCCAGGCCAAACCCAGTTGGGG - Exonic
1077093812 11:791017-791039 TCCCTGGCCAATCCCAGGCCAGG + Exonic
1077582366 11:3424580-3424602 ACCCAGACCCATCCCAGGTTAGG - Intergenic
1077609580 11:3636101-3636123 TTCCAGGCCAATCCCAGGGCAGG + Intergenic
1078089328 11:8254619-8254641 TCCCAGGGCCAGCCTCGGTGGGG - Intronic
1078338769 11:10484348-10484370 TCCCGAGCCCAGGCCAGGTGAGG - Intronic
1078501590 11:11884834-11884856 ACCCACCCCCATCCCTGGTGTGG - Intronic
1078545676 11:12245495-12245517 TACCAGCCCCATCCCATCTGAGG + Intronic
1078793553 11:14569416-14569438 TCCCTTGCACTTCCCAGGTGAGG - Intronic
1079681582 11:23303980-23304002 CCCCTTGCCCTTCCCAGGTGAGG + Intergenic
1081575134 11:44314384-44314406 TCCCACACCCTTCCCAAGTGTGG - Intergenic
1083160388 11:60850685-60850707 TCCTAGGTCCATCCCAGGCCTGG + Exonic
1083761023 11:64817869-64817891 TTCCAGGCCCATCGCAGGAGGGG + Intergenic
1083808607 11:65089577-65089599 CCCCGTGCCCTTCCCAGGTGTGG + Intronic
1084384187 11:68832156-68832178 ACCCAGGCCCAGGCCAGGTGCGG + Intronic
1084399184 11:68933789-68933811 TGCCAGGGACCTCCCAGGTGTGG + Exonic
1084490645 11:69476493-69476515 TCACAGGCCCATCCAAGTGGGGG + Intergenic
1084593831 11:70105527-70105549 TCTCAGGCCTCGCCCAGGTGCGG + Intronic
1084606741 11:70176875-70176897 TCCCAGCCCCACCCCAGGAGAGG + Intronic
1084716900 11:70879902-70879924 TCCCAGGCCTCTCCCAGGAATGG + Intronic
1084833156 11:71785447-71785469 ACCCAGACCCATCCCTGGTTAGG + Intergenic
1085051442 11:73382203-73382225 CCCCAGGGCCATCCCAGGTCAGG - Intronic
1085123858 11:73983926-73983948 ATCCAGGCCCATCCCAGCTCTGG - Intergenic
1085389860 11:76176829-76176851 TCCCTGCCCCAACCCAGGAGGGG + Intergenic
1088806893 11:113360710-113360732 TCCCAGACCCACCCTAGATGTGG - Intronic
1089119769 11:116125233-116125255 TCCCAGGACCCTCACAAGTGAGG - Intergenic
1089567715 11:119380809-119380831 TCTCATGCCCATTCCAGGGGAGG + Intronic
1089570191 11:119402665-119402687 GGCCAGGCCCATGCCAGCTGGGG - Intergenic
1089606288 11:119643524-119643546 TGGCAGGCCCATGCCAAGTGAGG - Intronic
1090688797 11:129155950-129155972 CCCCTTGCCCTTCCCAGGTGAGG - Intronic
1091911214 12:4232073-4232095 TGCCAGGGCCATCCTGGGTGAGG - Intergenic
1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG + Intronic
1092409959 12:8245024-8245046 ACCCAGACCCATCCCTGGTTAGG - Intergenic
1092909915 12:13137709-13137731 TCCCAAGGCCCTCCCAGCTGTGG + Intronic
1094828446 12:34289030-34289052 TCCCTGGCTCACCCCAGGGGGGG + Intergenic
1096396236 12:51269108-51269130 TCCCAGGCCCTTCCTGTGTGAGG + Intronic
1096571236 12:52524487-52524509 TCCCAGACCCATCCAAGGACTGG - Intergenic
1096618717 12:52849030-52849052 TCCAAGGCCCAGCCCAGGTACGG - Intronic
1096850534 12:54432855-54432877 ACCCAGACCCATCCCCAGTGGGG - Intergenic
1096863872 12:54549767-54549789 TCCCAGGCCCTTCCCACCTGCGG - Exonic
1096902597 12:54900605-54900627 TCCCTTGCACTTCCCAGGTGAGG - Intergenic
1097250944 12:57632121-57632143 GCCCAGCCACATCCTAGGTGGGG + Exonic
1099534339 12:83826625-83826647 CCCCAGGACCAGCCCAAGTGTGG - Intergenic
1101133282 12:101711374-101711396 TCCCAGGCTCATCCATGTTGTGG - Intronic
1102532787 12:113558941-113558963 TCCCAGCCCCATCCTGGGTGAGG - Intergenic
1102532944 12:113560154-113560176 TCCCAGCCCCATCCTGGGTGAGG + Intergenic
1102592371 12:113966410-113966432 GCCCAGGCCCACCCCTTGTGGGG - Intergenic
1102900347 12:116631754-116631776 GCCCTTGCCCCTCCCAGGTGGGG + Intergenic
1103347296 12:120259786-120259808 CTCAGGGCCCATCCCAGGTGAGG + Intronic
1103565292 12:121812212-121812234 ACCCCGTCCCATCCTAGGTGGGG + Intronic
1105592820 13:21810389-21810411 TCCCAGGATCATTCCAGGGGTGG + Intergenic
1106015811 13:25868004-25868026 CTCGAAGCCCATCCCAGGTGGGG + Intronic
1112142197 13:96657064-96657086 TTTGAGGCACATCCCAGGTGTGG - Intronic
1113458250 13:110464225-110464247 TGCCAGTCCCAGCCCAGCTGGGG + Intronic
1113927339 13:113949044-113949066 TCTCTGGCCCCTCCCAGGAGTGG - Intergenic
1114193553 14:20458516-20458538 TGCCTGGCCCCTCCCTGGTGGGG - Exonic
1117409884 14:55440741-55440763 GCCCAGGCCCTTCCCAGCTGCGG - Intronic
1119640612 14:76311644-76311666 TCCCAGGCCAAAGCCAGGTGTGG + Intronic
1121428304 14:93869164-93869186 ACCTAAGCCCATGCCAGGTGAGG + Intergenic
1121526959 14:94625770-94625792 TCACTTGCCCATCCCAGGGGAGG - Intergenic
1121685734 14:95833704-95833726 TGCTATGCCCATCCCAGGAGAGG + Intergenic
1121846109 14:97173579-97173601 TCCCAGGTCCATCCAAGCTGTGG - Intergenic
1122197945 14:100103613-100103635 CCCCATGCCCACCCCAGGTGAGG + Intronic
1122951200 14:105046054-105046076 TGCCAGGCTCATCTTAGGTGTGG + Intergenic
1123035250 14:105469321-105469343 CCCCAGGCCCATCCTGGGTGTGG + Intronic
1123105941 14:105841078-105841100 TCCCAGCCACCTCCCAGGTCAGG + Intergenic
1123439516 15:20280624-20280646 TCCCAGCCCCGTCCCAGGAGGGG - Intergenic
1123475960 15:20592765-20592787 GCCCAGGTCCATCCCAGATCCGG + Intergenic
1123642051 15:22407598-22407620 GCCCAGGTCCATCCCAGATCCGG - Intergenic
1125672963 15:41486654-41486676 CCCCAGGCACACCCGAGGTGTGG + Intergenic
1125722088 15:41850077-41850099 TGCCAGGCCCTTCCCACGTGGGG + Intronic
1125733002 15:41904591-41904613 TCCCAGCCCCGTCTCTGGTGGGG + Intronic
1125886719 15:43234977-43234999 ACCCAGGTCCAACCCAGGTACGG - Intronic
1126152645 15:45536907-45536929 CCCCAGGCCCACATCAGGTGAGG + Intergenic
1126547714 15:49890851-49890873 TGCCAGGCCACTCCCATGTGGGG + Intronic
1127256292 15:57296613-57296635 GCCCAGGCCCAAGCCAGGGGTGG - Intronic
1128110628 15:65074003-65074025 TCCCATCCCCATCCCAAGTCAGG + Intronic
1128543165 15:68550969-68550991 TCCCACGCCCATCCTGGGGGTGG - Intergenic
1129154580 15:73709873-73709895 ACCCAGTTCCCTCCCAGGTGTGG + Intronic
1129606583 15:77028111-77028133 TCCCGGGCCCTTCCCTTGTGGGG + Intronic
1130082691 15:80748080-80748102 TCCATGGCACAGCCCAGGTGTGG + Intronic
1130890402 15:88128594-88128616 TCCCTGGCCCATGGCAGCTGAGG - Intronic
1132304702 15:100802671-100802693 GCCCAGGCCCATGCCAGCAGTGG + Intergenic
1132618657 16:854332-854354 TCCCAGGCCCTGCCCACCTGGGG - Exonic
1133350945 16:5099805-5099827 ACCCAGACCCATCCCTGGTTAGG - Intergenic
1133755620 16:8760487-8760509 CCCCTGGCCCCTCCCAGGCGGGG - Intronic
1134113441 16:11530733-11530755 TCCCAGGCCCATTCCAGACCAGG + Intergenic
1134249560 16:12565017-12565039 TGCCAGGCTCATCCCAGGACTGG - Intronic
1136019723 16:27432399-27432421 CCCCAGGGCCATCCCATGTCTGG - Intronic
1136420681 16:30130657-30130679 TCCTAGGCTCATGCCAGGCGCGG - Intergenic
1136845651 16:33573774-33573796 TCCCAGCCCCGTCCCAGGAGCGG + Intergenic
1137435418 16:48450919-48450941 TCACAGGCCCAGTCCAGGCGTGG - Intergenic
1137600388 16:49752304-49752326 CCCCAGGCCCAAGCCATGTGGGG - Intronic
1138593308 16:58015216-58015238 GCCCAGCTCCATCCCAGTTGTGG + Intronic
1139271748 16:65690190-65690212 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
1139360145 16:66392575-66392597 GCCCAGGACCATGCTAGGTGGGG - Intronic
1139551320 16:67674665-67674687 GACCAGGCCCTTCCCAGGTGGGG - Exonic
1140683140 16:77405136-77405158 TCCCAGTCCCAGCCCAGGGGTGG - Intronic
1141003600 16:80331285-80331307 CCCCAGGCCCCTGCCATGTGTGG - Intergenic
1203107359 16_KI270728v1_random:1422427-1422449 TCCCAGCCCCGTCCCAGGAGCGG + Intergenic
1142551852 17:745614-745636 TCCCAGGCCCACCCAGGGTACGG - Exonic
1142817331 17:2436732-2436754 TCACAGTTCCCTCCCAGGTGTGG - Intronic
1143034563 17:3987038-3987060 CCCCAGGACCATCCAAGGTAGGG + Intergenic
1143630972 17:8140237-8140259 TCCCAGGGCAAACCCAGCTGAGG + Intergenic
1144572194 17:16407272-16407294 TCCCAGGCCTGTCCCAGGAGGGG + Intergenic
1144710581 17:17399126-17399148 TGCCAGGCCCCACCCAGGTCTGG + Intergenic
1144756607 17:17683379-17683401 GGTCAGGCCCACCCCAGGTGGGG + Intronic
1145195153 17:20886565-20886587 TCCCAAGACCATCCTAGGTTTGG - Intronic
1147167582 17:38601750-38601772 ACCCAGGCCCATCCCTTCTGAGG + Intronic
1147563148 17:41521175-41521197 TCTCAGGCCCAGGCCAGGGGCGG + Exonic
1148397711 17:47323726-47323748 TCACAGGCCCTTACGAGGTGGGG + Intronic
1148699205 17:49577837-49577859 TCCCATGGCCATCCTGGGTGTGG + Intronic
1149693698 17:58599783-58599805 TCCCACCCCCTTCCCAGTTGTGG + Intronic
1152231842 17:79117754-79117776 TGCCAGGCCCATGCCAGGGCAGG + Intronic
1152267025 17:79301132-79301154 TCCCAGGCCCATCCCAGCAGGGG - Intronic
1152329697 17:79665365-79665387 CTCCAGGCCCCTCCCAGGTAAGG - Intergenic
1152385916 17:79974714-79974736 TCCCAGGCTCTTCTCAGGCGTGG + Intronic
1152570848 17:81120666-81120688 CCCAAGGCCCAGCCAAGGTGCGG - Exonic
1152876454 17:82789336-82789358 GCCCTGGCCCATCCCTGCTGAGG + Intronic
1152941843 17:83176964-83176986 GAGCAGGCCCCTCCCAGGTGAGG + Intergenic
1152946945 17:83203098-83203120 TCCCTGTCCGATCCAAGGTGAGG + Intergenic
1153835967 18:8964247-8964269 TCCCAGGCTCATCCCAACTCAGG - Intergenic
1154101622 18:11479697-11479719 TCCCTTGCACTTCCCAGGTGAGG + Intergenic
1154197258 18:12275702-12275724 ACCCTGGCCCACCTCAGGTGAGG - Intronic
1154417880 18:14194300-14194322 TCCCAAGACCACCCCAGGTTTGG + Intergenic
1156471201 18:37378220-37378242 CCCCACGCCCACCCCAGGAGCGG + Intronic
1156491946 18:37501543-37501565 TCCCAGGCCCATCCCCAGGCAGG - Intronic
1156492264 18:37503188-37503210 CCCCAGAACCATCCCAGGGGAGG - Intronic
1157071669 18:44416095-44416117 ACCCTTGCCCTTCCCAGGTGAGG - Intergenic
1157689418 18:49668865-49668887 CACCAGGCACATTCCAGGTGAGG + Intergenic
1157805890 18:50657280-50657302 TCCCAAACCCATCCCTGTTGAGG - Intronic
1158680541 18:59562667-59562689 TCCCTGGCCCATCCTAGTTCTGG + Intronic
1160681024 19:411658-411680 ACCCCTGCCCAGCCCAGGTGGGG + Intergenic
1160932067 19:1575563-1575585 TCCCCGCCCCATGCCAGGTCTGG + Intronic
1161984772 19:7647231-7647253 TCCCAGGCCGCTGTCAGGTGAGG + Exonic
1162060039 19:8089494-8089516 TCCCAGGCCCCTCCCAGGACAGG - Intronic
1162791145 19:13063751-13063773 TCCCAGGCGCATCCCTTGAGTGG + Intronic
1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG + Intronic
1163491272 19:17618386-17618408 ACCCCTCCCCATCCCAGGTGGGG - Intronic
1163527549 19:17830781-17830803 TCCCAGGCACCTCCCAGGGCTGG - Intronic
1163600572 19:18246980-18247002 TCCCAGGCCCATCACCTGAGTGG - Intronic
1163881186 19:19923851-19923873 TCCCTTGCACTTCCCAGGTGAGG + Intronic
1164507950 19:28874833-28874855 TCCAAGGCCCCTCCCAGCTAGGG + Intergenic
1164831818 19:31328389-31328411 TCCAGAGCCCATCCCTGGTGTGG - Intronic
1165320696 19:35083592-35083614 TCCCAGGCCCTCCCCAGGACAGG - Intergenic
1166850147 19:45756062-45756084 ACCCAGCCCCATCCCAGGTAAGG + Exonic
1167006083 19:46777463-46777485 CTCCAGGTCCAGCCCAGGTGAGG + Intronic
1167528375 19:49999699-49999721 CCCCAGGCCCAGCCCTGGAGAGG - Intronic
1167973097 19:53201214-53201236 TCCCAGGACCATGCCCAGTGGGG - Intergenic
1167988964 19:53341519-53341541 TCCCAGGACCATGCCCAGTGCGG - Intronic
925304685 2:2839867-2839889 TCCCAGTCCTCTCCCAGCTGTGG + Intergenic
927465302 2:23332055-23332077 CACCAGGCACATCACAGGTGGGG + Intergenic
928131837 2:28657455-28657477 TCCCAGAGCCTTCCCAGATGGGG + Intergenic
928750573 2:34466392-34466414 TCCCTTGCCCTTCCCAGGTGAGG - Intergenic
929286873 2:40145227-40145249 TTCCAGGCCCATCCATGTTGTGG + Intronic
930035489 2:47082878-47082900 TCCCATGCCCAGCCCAGGAGGGG + Intronic
930803021 2:55462336-55462358 TCCCTGGCACTTCCCGGGTGAGG - Intergenic
931212618 2:60212310-60212332 TCCCAGGCCCTTCCCATCTCTGG - Intergenic
933436903 2:82260388-82260410 GCCCAGTGCCAGCCCAGGTGAGG + Intergenic
934499367 2:94842993-94843015 TCCCAAGACCACCCCAGGTTTGG - Intergenic
934735814 2:96689324-96689346 TGCCAGTGCCATCCCAGGGGTGG - Intergenic
936463763 2:112729410-112729432 TCCCAGGCCAAGGCCAGGCGCGG - Intronic
936684789 2:114815105-114815127 TGCCAACACCATCCCAGGTGGGG - Intronic
938262717 2:129906885-129906907 TCCCAGGGCCATCCCCAGGGTGG + Intergenic
939615335 2:144356031-144356053 TTGGAGGCCCATCCCAGGTCAGG + Intergenic
939893627 2:147766713-147766735 TCCCTTGCGCTTCCCAGGTGAGG - Intergenic
940602053 2:155875159-155875181 TCCCTTGCACTTCCCAGGTGAGG - Intergenic
940729036 2:157368727-157368749 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
941477971 2:165971673-165971695 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
945466103 2:210171635-210171657 TCCCAGTGCCATCCCTGGCGAGG + Intergenic
946291222 2:218747013-218747035 TCCCAGGCTCATTCCAGATTGGG + Exonic
948330154 2:237158192-237158214 TCCAAGGCCCAGGGCAGGTGTGG + Intergenic
948460201 2:238125408-238125430 TCCCAGGCCCATGCCCTGGGTGG - Intronic
948905689 2:240978559-240978581 TCCCAGGCTCATCCCTGCTCAGG + Intronic
948906032 2:240979954-240979976 TCCCAGGCTCATCCCTGCTCAGG + Intronic
948906165 2:240980494-240980516 TCCCAGGCTCATCCCTGCTCAGG + Intronic
949041075 2:241850219-241850241 ACTCAGGCCCCTCCCAGCTGTGG - Exonic
1168948732 20:1782162-1782184 GCCCAGGGCCCGCCCAGGTGTGG + Intergenic
1169076214 20:2761106-2761128 GCCCAGGGCCCTCCCAGCTGAGG + Intergenic
1169263233 20:4152574-4152596 TGCCAGCCCCATCCCAGATCTGG - Intronic
1169301510 20:4445670-4445692 CTCCAGGGCCAACCCAGGTGAGG + Intergenic
1172705169 20:36877684-36877706 TCCCTGGCCCCTGCCAGCTGAGG - Intronic
1173555097 20:43960399-43960421 TCCGATGGCCATCCCATGTGGGG + Intronic
1173771834 20:45666365-45666387 CCCCTTGCCCTTCCCAGGTGAGG + Intronic
1173864960 20:46307781-46307803 TCCCCGGCCCCTCCCAGAGGCGG - Intronic
1175169544 20:57070425-57070447 TCTCAGCCTCTTCCCAGGTGGGG + Intergenic
1176816694 21:13609993-13610015 CCCCAGGCCCACCCCAGGAAAGG - Intronic
1176855418 21:13964970-13964992 TCCCAAGACCACCCCAGGTTTGG - Intergenic
1177142814 21:17376230-17376252 CCCCTGGCGCTTCCCAGGTGAGG - Intergenic
1177694502 21:24554765-24554787 TCCCTTGCACATCCCGGGTGAGG - Intergenic
1178770518 21:35499578-35499600 CCCCTGGCGCTTCCCAGGTGAGG + Intronic
1179172137 21:38981042-38981064 TCCCAAGCCCTTCACAGGAGAGG + Intergenic
1179913258 21:44461139-44461161 CCACAGGACCATCCCTGGTGGGG + Exonic
1180611382 22:17100423-17100445 GCCCAAGCCCATCCCTGATGGGG + Exonic
1182455101 22:30445251-30445273 ACCCCGCCCCATCCCAGCTGAGG - Intergenic
1183172882 22:36201165-36201187 TTTCAGGCCCATCCCAGTTAGGG + Intronic
1183180392 22:36255814-36255836 TTTCAGGCCCATCCCAGTTAGGG - Intronic
1183187017 22:36298023-36298045 TTCCGGGCTCCTCCCAGGTGAGG + Intronic
1183524142 22:38313943-38313965 CCCCAGGGCCATCCCAGATGGGG - Intronic
1183684390 22:39353150-39353172 TCCCAGGTCCAGGCCGGGTGCGG - Intronic
1184250177 22:43255723-43255745 TCCCAGGAACCTCCAAGGTGGGG + Intronic
1184489121 22:44799147-44799169 TTCCAGGCCCAGCACAGGGGCGG - Intronic
1184512010 22:44939483-44939505 TCCCACGAGCTTCCCAGGTGGGG + Intronic
1184696014 22:46139539-46139561 TCCCAGCCCCGTCCCAGGAGGGG - Intergenic
1184715128 22:46277673-46277695 GCCCAGGCCCAGCCCAGGATGGG - Intronic
1184844415 22:47072457-47072479 TCCCAGTCCCATCCGTGGAGTGG + Intronic
1184999756 22:48238195-48238217 TGCCTGGCCCAACCAAGGTGTGG - Intergenic
1185080965 22:48709138-48709160 GCCCAGGGCCTCCCCAGGTGTGG + Intronic
1185089705 22:48758980-48759002 TCCCAGGGGAATCTCAGGTGTGG + Intronic
1185275579 22:49949033-49949055 GCCGAGGCCCTTCCTAGGTGCGG - Intergenic
1185348157 22:50319609-50319631 CCCCGTGACCATCCCAGGTGAGG - Intronic
950128343 3:10524952-10524974 TCCCATGCCCAGCACAGGGGTGG - Intronic
950252875 3:11481626-11481648 TCCAAGGCCCAACCCAGGAAAGG - Intronic
950443534 3:13023326-13023348 TCCCAGGCCCAGCCCAGGCCAGG + Intronic
952970957 3:38649761-38649783 CCCCAGGCCGAACCCAGGCGGGG - Intergenic
953975756 3:47380745-47380767 TCCCGGGCCAAGCCCAGCTGCGG - Intergenic
954237503 3:49268022-49268044 GGCCTGGCCCCTCCCAGGTGGGG - Intergenic
954335355 3:49913230-49913252 TCCCTGGGCCATTCCTGGTGTGG + Exonic
954402438 3:50326052-50326074 TCCCAGGCTCAATCAAGGTGTGG - Exonic
954611989 3:51949390-51949412 GCCCAGGCCCAGCACAGTTGTGG - Intergenic
956061958 3:65356908-65356930 TCGAAGTCCCATTCCAGGTGTGG + Exonic
957055198 3:75437148-75437170 ACCCAGACCCATCCCTGGTTAGG - Intergenic
958724948 3:97893556-97893578 TCCCAGGCCCATCACAGATTTGG - Intronic
959308300 3:104696916-104696938 CCCCTGGCGCTTCCCAGGTGAGG + Intergenic
959650877 3:108749585-108749607 TCCCTTGCGCTTCCCAGGTGAGG - Intronic
960169677 3:114444415-114444437 TCCCTGCCACATCCGAGGTGAGG + Intronic
961299631 3:125914525-125914547 ACCCAGACCCATCCCCGGTTAGG + Intergenic
961501595 3:127340218-127340240 TCCCAGACCCAGCCCCGGTGTGG + Intergenic
961888873 3:130113538-130113560 ACCCAGACCCATCCCTGGTTAGG - Intergenic
961992017 3:131202296-131202318 CCCCATGCACTTCCCAGGTGTGG - Intronic
963255319 3:143139198-143139220 TCCCAGGCCCACCACATCTGAGG + Intergenic
963930921 3:151003656-151003678 CCCCAAGACCATCCCAGGTTTGG - Intergenic
966115339 3:176454104-176454126 TCCCTTGCACTTCCCAGGTGAGG + Intergenic
967531502 3:190553584-190553606 TCCCCGTCCCATCCCGGCTGGGG - Intronic
968079608 3:195836914-195836936 TCCCAGGCCTCTCTGAGGTGGGG + Intergenic
968480673 4:831791-831813 ACCCAGGCCCATCACAGGTGAGG + Intergenic
968480695 4:831862-831884 ACCCAGGCCCATCACAGGTGAGG + Intergenic
968480710 4:831933-831955 ACCCAGGCCCGTCACAGGTGAGG + Intergenic
968480729 4:832004-832026 ACCCAGGCCCGTCACAGGTGAGG + Intergenic
968480749 4:832075-832097 ACCCAGGCCCGTCACAGGTGAGG + Intergenic
968480769 4:832146-832168 ACCCAGGCCCGTCACAGGTGAGG + Intergenic
968502727 4:958523-958545 TCCCTGGTCCATCTCTGGTGAGG - Exonic
968998021 4:3957458-3957480 ACCCAGACCCATCCCTGGTTAGG - Intergenic
969500870 4:7552199-7552221 TCCAGGGCCCATGCGAGGTGGGG + Intronic
969615167 4:8247809-8247831 ACCATGGCCCATCCCGGGTGGGG - Intergenic
969755987 4:9151200-9151222 ACCCAGACCCATCCCTGGTTAGG + Intergenic
970095769 4:12461490-12461512 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
971196778 4:24477605-24477627 TCCCGGGCACATCCCACCTGTGG + Intergenic
971437214 4:26640607-26640629 CCCCTTGCCCTTCCCAGGTGAGG - Intronic
972648122 4:40989541-40989563 TCCCAAATCCATCCCAGATGTGG + Intronic
972730267 4:41788047-41788069 TCTCAGGGCCATCCCGGGTGAGG - Intergenic
976813852 4:89124423-89124445 GCCCAGGCCCCTGCCAGGGGAGG - Intergenic
980700467 4:136422107-136422129 TCCCAGACCTACCCCATGTGGGG + Intergenic
981713606 4:147732223-147732245 TCCGAGGCCGCTGCCAGGTGCGG - Exonic
984698062 4:182799266-182799288 TCCCACTCCCACCCCACGTGGGG - Intronic
985527188 5:412002-412024 TCCCGGGGCCATCACCGGTGAGG - Intronic
985657385 5:1139310-1139332 ACCCAAGCCCAGCCCTGGTGGGG + Intergenic
985867207 5:2523382-2523404 TCTCAGGCCCAGCACAGGTGGGG + Intergenic
987810975 5:22835824-22835846 TCCCAGGGCCATGCCAAGTATGG - Intronic
989418204 5:41205427-41205449 CCCCTTGCACATCCCAGGTGAGG - Intronic
990038213 5:51348858-51348880 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
990071784 5:51791084-51791106 CCCCTTGCCCTTCCCAGGTGAGG + Intergenic
990229695 5:53699351-53699373 TCCCAGGCTCATCCATGTTGTGG - Intergenic
993358302 5:86941760-86941782 TCCCTTGCGCTTCCCAGGTGAGG + Intergenic
995990528 5:118233354-118233376 ACCTATGCCAATCCCAGGTGTGG + Intergenic
996921024 5:128767935-128767957 TCCCAGGGCCATCCTAACTGTGG + Intronic
997137715 5:131344207-131344229 TCCCCTGCGCTTCCCAGGTGAGG - Intronic
997378875 5:133421111-133421133 ACCCAGGCCCCTGCCAGGGGTGG - Intronic
997734457 5:136203094-136203116 TCCCTGTCCCCTCCCAGGTGGGG - Intergenic
997808888 5:136947364-136947386 TCCCTTGCACTTCCCAGGTGAGG + Intergenic
999239677 5:150120275-150120297 TCCCATGTCCATCCCAGGGCTGG + Intronic
999453946 5:151699270-151699292 TCCCAGCCCCATCCCAAGTTAGG + Intergenic
1000989347 5:167896132-167896154 TCCCAGCTCTAGCCCAGGTGGGG - Intronic
1002277825 5:178114655-178114677 TCCCAGGGCCCTCCCAGGCAGGG + Intronic
1002871374 6:1169922-1169944 CCCCAGGCCCCTCCCAGGCCAGG - Intergenic
1003328412 6:5109950-5109972 TCCGTGGCCCATCCCGGGTGGGG + Intronic
1004395822 6:15245734-15245756 TCCCACGCCGAGCCCAGGCGTGG - Intergenic
1006286122 6:33095928-33095950 TCCCAGGCCCTGCACAGGAGAGG + Intergenic
1006514355 6:34537874-34537896 TCCCTGCACCATGCCAGGTGTGG + Exonic
1007577157 6:42932594-42932616 TCCCACGCCCTCCCCAGGAGTGG - Intronic
1010993165 6:82502370-82502392 TCCCTTGCTCTTCCCAGGTGAGG + Intergenic
1011388505 6:86823719-86823741 TCAAATGTCCATCCCAGGTGTGG + Intergenic
1011484498 6:87828213-87828235 TCTCAGGCGCACCCCAGCTGGGG + Intergenic
1015750181 6:136550772-136550794 TCCGAGGAGCAGCCCAGGTGGGG + Intronic
1017724823 6:157269614-157269636 TCCCAGGCCCCTCCCTGCCGTGG + Intergenic
1018015014 6:159704332-159704354 TCCCTTGCGCTTCCCAGGTGAGG - Intronic
1018680209 6:166258277-166258299 TCCCGGGCCCATCCATGGAGAGG - Intergenic
1018715900 6:166532587-166532609 TCACAGCCCCTCCCCAGGTGGGG + Intronic
1019041582 6:169110213-169110235 TCCCATTCCTAGCCCAGGTGAGG - Intergenic
1019162305 6:170076735-170076757 TGCCAGGGCCAGCCCAGGTGAGG + Intergenic
1019274882 7:171052-171074 TCCCAGCCTCAGCCCAGGGGAGG - Intergenic
1019531130 7:1504071-1504093 TCCCAGGCCCAAGCCCCGTGCGG - Intronic
1019913593 7:4116443-4116465 TCCCAGGCCCTTCCACGCTGTGG - Intronic
1020262176 7:6536655-6536677 CCGCTGGCCCATCCCTGGTGGGG + Intronic
1020696723 7:11422096-11422118 TCAGAAGCCCATCACAGGTGTGG + Intronic
1022140716 7:27491305-27491327 TCCTAGGTCCATCCCAGGCCTGG - Intergenic
1022441816 7:30439434-30439456 TCCCTTGCGCTTCCCAGGTGAGG - Intronic
1022806838 7:33830945-33830967 TCCGAGGGCCAGTCCAGGTGGGG - Intergenic
1022933868 7:35152009-35152031 CCCCATGCGCTTCCCAGGTGAGG - Intergenic
1022942142 7:35251103-35251125 TCCCAGGCCCTTATCAGCTGTGG - Intronic
1023503592 7:40876700-40876722 TCTCAGGCCCATGGGAGGTGGGG + Intergenic
1023982469 7:45078038-45078060 TCCAGGGTCCATCCCAGGTGTGG + Intergenic
1026582950 7:71633242-71633264 TCCCAGGCACAGCCCGGCTGTGG + Intronic
1026801520 7:73403182-73403204 TTCCAGGCTCAGGCCAGGTGCGG + Intergenic
1029550724 7:101235881-101235903 TCCCAGGACCACCCCAGCCGTGG + Intronic
1031013630 7:116549199-116549221 GCCCAGGCCCAGCCCTGCTGGGG - Intronic
1031031760 7:116743110-116743132 TCCCTTGCCCTTCCCAGGTGAGG - Intronic
1034155779 7:148955088-148955110 TGCCAGGCCCTTCCCAGCTGTGG + Intergenic
1035527010 8:321801-321823 TGGGAGCCCCATCCCAGGTGTGG - Intergenic
1035655540 8:1302279-1302301 TCCGAGTCCGGTCCCAGGTGTGG - Intergenic
1035655549 8:1302329-1302351 TCCGAGTCCGGTCCCAGGTGTGG - Intergenic
1035655566 8:1302429-1302451 TCCGAGTCCGGTCCCAGGTGTGG - Intergenic
1035754398 8:2021032-2021054 TCCCAGGCCCTTTCCTTGTGAGG + Intergenic
1036379227 8:8226501-8226523 ACCCAGACCCATCCCTGGTTAGG + Intergenic
1036850326 8:12196111-12196133 ACCCAGACCCATCCCTGGTTAGG - Intergenic
1036871690 8:12438384-12438406 ACCCAGACCCATCCCTGGTTAGG - Intergenic
1036989385 8:13575458-13575480 TCCAAGCCCCAGCCCAGATGTGG - Intergenic
1038249156 8:25886824-25886846 TCCCCGGCACATCCCAGGCGTGG - Exonic
1038262468 8:26008374-26008396 TACCAGGTCCTTCCCAGCTGAGG - Intronic
1040338775 8:46429461-46429483 CACCAGGGCCCTCCCAGGTGGGG + Intergenic
1040354936 8:46608324-46608346 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
1040564780 8:48555722-48555744 TCCCAGGCGCAGCCCCGGAGCGG - Intergenic
1042738078 8:72011237-72011259 TCCCAGGCCTGTGCCATGTGTGG - Intronic
1045046439 8:98283625-98283647 TTGCAGGCCCAGCCCAGGTTTGG + Intronic
1049162173 8:141104679-141104701 CCCCAGGACCAGCCCAGGGGAGG - Intergenic
1049510808 8:143025797-143025819 TCCCCGCCCCATCCCAGGCCAGG - Intergenic
1049579647 8:143405503-143405525 TCCGAGGCCCAGCCCAGCCGAGG - Intergenic
1050033852 9:1414424-1414446 TCACAGACCCATTCTAGGTGTGG - Intergenic
1051458789 9:17290822-17290844 TCCCTCGCGCTTCCCAGGTGAGG + Intronic
1052149833 9:25102187-25102209 TCCCTTGCACTTCCCAGGTGAGG - Intergenic
1053067637 9:35079597-35079619 GCCCAGGCCCCTCCCCGCTGGGG - Exonic
1053657789 9:40237544-40237566 TCCCAAGACCACCCCAGGTTTGG + Intronic
1053908156 9:42866823-42866845 TCCCAAGACCACCCCAGGTTTGG + Intergenic
1054358259 9:64086107-64086129 TCCCAAGACCACCCCAGGTTTGG + Intergenic
1054369912 9:64383816-64383838 TCCCAAGACCACCCCAGGTTTGG + Intronic
1054526807 9:66138681-66138703 TCCCAAGACCACCCCAGGTTTGG - Intronic
1054677541 9:67873570-67873592 TCCCAAGACCACCCCAGGTTTGG + Intronic
1054711618 9:68516568-68516590 TCTCAGGCCCACCCATGGTGAGG - Intronic
1056715018 9:89021632-89021654 GCCTTGGGCCATCCCAGGTGAGG + Intronic
1056834604 9:89944448-89944470 TCCCAGGCCCATGCCAGGAGTGG + Intergenic
1056936576 9:90919416-90919438 TGGCAGGCCCAGGCCAGGTGAGG - Intergenic
1057769119 9:97951322-97951344 TCCCTTGCACTTCCCAGGTGAGG + Intergenic
1058305857 9:103439462-103439484 ACCCATGCGCTTCCCAGGTGAGG + Intergenic
1060592921 9:124830620-124830642 TGCCAGGCCCATCCTGAGTGTGG + Intergenic
1061221231 9:129253391-129253413 TCCCAGGCCGAGCCCAGGGCGGG - Intergenic
1062102028 9:134733426-134733448 CTCCAGGCCCAACCCAGGGGTGG + Intronic
1062211070 9:135364398-135364420 TCCAAGGCACATGGCAGGTGGGG + Intergenic
1062249634 9:135587729-135587751 ACCCAGGCCCCTCCCACATGAGG + Intergenic
1062332046 9:136049181-136049203 TTCCTGGCCCATCCCTGGCGCGG + Intronic
1062340408 9:136091510-136091532 TCCCAGGCTGATCCCCTGTGTGG + Intronic
1062349609 9:136132570-136132592 TCCCAGCTCCATCCCAGGACTGG - Intergenic
1062529638 9:136994238-136994260 TCCCAGGCCGCACCCAGGTAGGG + Intergenic
1203530667 Un_GL000213v1:139501-139523 CCCCAGGCCCACCCCAGGAAAGG + Intergenic
1185467177 X:361949-361971 CCCCAGGTCCCTGCCAGGTGTGG - Intronic
1186510567 X:10126948-10126970 TCCAAGGCCCATGCCAGGGTTGG + Intronic
1187128019 X:16472109-16472131 TCCCAGGCCCTTTACAGGTGGGG - Intergenic
1190916364 X:54814116-54814138 CTCCAGGCCCATACCAGCTGTGG - Intronic
1191138828 X:57094513-57094535 CCCCTGGCTCTTCCCAGGTGAGG - Intergenic
1191222275 X:58002587-58002609 CCCCTTGCACATCCCAGGTGAGG - Intergenic
1192248041 X:69389280-69389302 GCTCAGGCCCATCCCAGATGTGG + Intergenic
1192585346 X:72314511-72314533 TCCCAATCCCATCTCAGCTGAGG + Intergenic
1192966623 X:76183536-76183558 TCCCTTTCCCTTCCCAGGTGAGG + Intergenic
1193019974 X:76781052-76781074 CCCCTTGCACATCCCAGGTGGGG + Intergenic
1193334571 X:80273601-80273623 TCCCTTGCGCTTCCCAGGTGAGG - Intergenic
1195033488 X:100948963-100948985 TGCCAGACCCCTTCCAGGTGGGG - Intergenic
1195471558 X:105235962-105235984 TCCCAGGCCCATTGCCGGAGAGG - Intronic
1195486281 X:105410562-105410584 TACCAAGCCTATCCCAGGAGGGG - Intronic
1195805809 X:108763754-108763776 TCCTTGGCCCACCCCAGCTGTGG - Intergenic
1196890516 X:120286707-120286729 TTCCAGACCCATCCTATGTGTGG + Intronic
1198264903 X:134999998-135000020 TCCCAAGCCCTCCCCAGGTAAGG + Intergenic
1199173688 X:144759410-144759432 TCCCAGCACCATCCTAGTTGTGG + Intergenic