ID: 1092259614

View in Genome Browser
Species Human (GRCh38)
Location 12:6946051-6946073
Sequence CTGGAAAGGCAGAGGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 422}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092259614_1092259626 9 Left 1092259614 12:6946051-6946073 CCTGATTCCCTCTGCCTTTCCAG 0: 1
1: 0
2: 5
3: 37
4: 422
Right 1092259626 12:6946083-6946105 CCCTGAACAGCTCCTCCCTATGG 0: 1
1: 0
2: 3
3: 12
4: 171
1092259614_1092259629 19 Left 1092259614 12:6946051-6946073 CCTGATTCCCTCTGCCTTTCCAG 0: 1
1: 0
2: 5
3: 37
4: 422
Right 1092259629 12:6946093-6946115 CTCCTCCCTATGGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 214
1092259614_1092259628 15 Left 1092259614 12:6946051-6946073 CCTGATTCCCTCTGCCTTTCCAG 0: 1
1: 0
2: 5
3: 37
4: 422
Right 1092259628 12:6946089-6946111 ACAGCTCCTCCCTATGGTCCTGG 0: 1
1: 0
2: 1
3: 9
4: 134
1092259614_1092259630 20 Left 1092259614 12:6946051-6946073 CCTGATTCCCTCTGCCTTTCCAG 0: 1
1: 0
2: 5
3: 37
4: 422
Right 1092259630 12:6946094-6946116 TCCTCCCTATGGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092259614 Original CRISPR CTGGAAAGGCAGAGGGAATC AGG (reversed) Intergenic
900393871 1:2445170-2445192 CTGGAAAGGATGAGGGAGGCAGG + Intronic
900600424 1:3500408-3500430 CAGGAAAGGCAGAGGAAGCCAGG + Intronic
900657668 1:3767740-3767762 CTGGAAAGGAGGAGGGCACCTGG + Intronic
900786538 1:4653868-4653890 CTGGAAAGTTCCAGGGAATCTGG - Intergenic
901495315 1:9617860-9617882 CTACAAAGGCAGAGGGAAGTGGG + Intergenic
902077708 1:13801005-13801027 CTGGAGAGGCAGAGAGCATGAGG - Intronic
902359141 1:15932562-15932584 CAGGCAGGGGAGAGGGAATCTGG + Exonic
902402488 1:16165855-16165877 ATGGACAGACAGAGGGAAACAGG - Intergenic
903578593 1:24354351-24354373 CTGGAATGGAAGAGGGGATGTGG - Intronic
904584260 1:31570804-31570826 CAGGAAAGGAAGAGGCAATGTGG - Intergenic
906058654 1:42934533-42934555 CAGGAAAGGCAGGGGGATGCTGG + Intronic
906144467 1:43551630-43551652 CTGGCAAGTCAGAGGGATGCAGG - Intronic
906200527 1:43957328-43957350 CTGGGAAGGCTGAGGGAATCAGG - Intronic
906517909 1:46450454-46450476 CTGGAAGGGCTGAGGGAACAGGG - Intergenic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
909344818 1:74572695-74572717 CAGGAGAGGCAGAGGCAAGCCGG - Exonic
909448499 1:75773482-75773504 CTGGCAAGGCACAGTGACTCAGG + Intronic
909609268 1:77535771-77535793 CTGGAAAGGCCCAGGGCCTCTGG - Intronic
912938348 1:114023393-114023415 CTGGAAAGGAAAAGGGAAGATGG - Intergenic
914831539 1:151174299-151174321 CTGGAAGGTGAGAGGGAAACTGG + Intronic
916086649 1:161275094-161275116 CTGGCAGGGCAGAGGGAAAGTGG + Intronic
916307137 1:163349811-163349833 GAGGAAAGGAAGAGGGAAACTGG + Intronic
916803190 1:168233308-168233330 CTGGAGAGGAGGAGGTAATCAGG - Intronic
916877673 1:168987328-168987350 CTGGGAAGGCAGAGGAGACCTGG - Intergenic
917511769 1:175674742-175674764 CTGAGAAGGCAGAGGGAACCTGG - Intronic
917877025 1:179295174-179295196 CTGGAAAGCCAGAAGGAAAGTGG - Intronic
917903299 1:179564973-179564995 CTGGAAAGGTAGTGGGGACCAGG + Intronic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
919862313 1:201748407-201748429 TTAGAAAGGGAGATGGAATCTGG + Intronic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920226603 1:204443597-204443619 CCTGCAAGGCAGAGGGAGTCAGG + Exonic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
923191075 1:231621375-231621397 CTGGAAAGCCAGAAGGACCCTGG - Intronic
923498464 1:234544908-234544930 CTGGGAAGGCAGGAGGAATGGGG - Intergenic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1067489260 10:46682575-46682597 TTGGAAAGCCAGAAGGAAACTGG + Intergenic
1067605411 10:47657810-47657832 TTGGAAAGCCAGAAGGAAACTGG - Intergenic
1068001056 10:51334829-51334851 GAGCAGAGGCAGAGGGAATCAGG + Intronic
1068793326 10:61050561-61050583 CTGGAAAACAAGAGGGTATCTGG + Intergenic
1069455879 10:68553400-68553422 TTGGAAAGGCAGAGGGGGTGGGG + Intergenic
1069671847 10:70212689-70212711 CTGGAGAGGAGGAGGGAATAGGG + Intronic
1069768852 10:70884843-70884865 AAGGAAAGGCTGTGGGAATCAGG - Intronic
1070360749 10:75686248-75686270 GTGGAAAGGCAGAGGAGAGCTGG + Intronic
1070408123 10:76114528-76114550 CTGGAAGGACAGAGGTAATTTGG + Intronic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1071620970 10:87119205-87119227 TTGGAAAGCCAGAAGGAAACTGG - Intronic
1072656824 10:97335159-97335181 GGGGAAAGGCGGAGGGAATTGGG + Intergenic
1073095172 10:100975093-100975115 CTGGGGAGGCAGATGGAACCAGG + Intronic
1073275021 10:102302252-102302274 GTGGAAAGGGAGAGGGAAAGGGG + Intronic
1073468412 10:103708017-103708039 CTGGAAAGGGAGAGAGACTGTGG - Intronic
1074127244 10:110538693-110538715 CTGGGAAGGCAAAGGGAACTGGG + Intergenic
1074969166 10:118521445-118521467 CTCAAAAGGCATAGGGAAGCAGG + Intergenic
1075164099 10:120051523-120051545 GAGGAAAGGCAGAGGGAAGGAGG + Intergenic
1076056916 10:127383555-127383577 CTGGAAAGGCAGAGCCATACAGG + Intronic
1076910188 10:133384008-133384030 CTGAGAAGGCAGAAGCAATCAGG + Exonic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1079082719 11:17425091-17425113 CTGGAGAGGCAGTCGGAATAAGG + Intronic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1080602317 11:33831639-33831661 CTGGAAGAGCAGAGGAAATCAGG + Intergenic
1080686764 11:34522446-34522468 CAGGAAGGGCAGAGGCAACCAGG + Intergenic
1080802944 11:35625487-35625509 CTGGAAAGGCAAAGTGACTGGGG + Intergenic
1080908989 11:36576020-36576042 CTGTACTGGCAGAGGGATTCTGG - Exonic
1081600038 11:44486673-44486695 CGGGAAAGGGAGAGGGACTGGGG - Intergenic
1082645865 11:55724204-55724226 TTTGAAAGGGAGAAGGAATCAGG - Intergenic
1083319792 11:61838652-61838674 CAGGAAAGCCAGAGGCAATGGGG - Intronic
1083676439 11:64328149-64328171 CAGGAAAGGGACAGGGAACCAGG - Intergenic
1085695720 11:78702851-78702873 AGGGAAAGGCAGATGGAGTCTGG + Intronic
1086429923 11:86726748-86726770 GTGGATAGTCAGATGGAATCAGG + Intergenic
1086498201 11:87425495-87425517 CTGTCAGGGCAGAGGGAATGAGG + Intergenic
1086968002 11:93050166-93050188 CAGGACCGACAGAGGGAATCTGG + Intergenic
1087565722 11:99854741-99854763 CAGGAAAGGCAGATGGGAACTGG + Intronic
1087610785 11:100432010-100432032 CTGGAATAGCAGAGGGCATGTGG - Intergenic
1087968595 11:104451310-104451332 TTGGCAAGGCACTGGGAATCGGG + Intergenic
1089497863 11:118916751-118916773 CAGGCACGGCACAGGGAATCCGG + Intronic
1089670738 11:120055209-120055231 GTGTCAATGCAGAGGGAATCAGG - Intergenic
1090147378 11:124339978-124340000 CTGGAAAGACAAAGGGATACGGG + Intergenic
1090183034 11:124717711-124717733 CTGGAAAGGAAGGGTGAGTCGGG + Intergenic
1090193348 11:124792939-124792961 TTAGAAAGCCAGAGGGAAACAGG - Intronic
1090387194 11:126364118-126364140 CTGCCAAGGCAGAGGGAATGGGG + Intronic
1091129861 11:133136623-133136645 CTGGAAAGACTGAGAGAATAGGG + Intronic
1091204528 11:133810627-133810649 CTGAGAAGGCAGAGGGATTTAGG - Intergenic
1092197367 12:6557362-6557384 CTGGAAAAGCCGAAGGGATCAGG - Exonic
1092209861 12:6639180-6639202 GGGGAAAGGCAGAGGGAAAGCGG - Intronic
1092228210 12:6762665-6762687 CTGCAAAGTCAGGAGGAATCAGG + Intronic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092746621 12:11678478-11678500 CTGCAAAGGGAAAGGAAATCAGG - Intronic
1092757975 12:11782596-11782618 GTGGAAAGACAGAGGGATTGGGG + Intronic
1096056881 12:48660498-48660520 CTGGAAATGCAGTGGGCAGCAGG + Exonic
1096365370 12:51024865-51024887 CCGGAATGGCAGTGGGACTCGGG - Intronic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1097918251 12:65042639-65042661 CTGGAGGGGCAGAGGGGAGCAGG - Intergenic
1099254914 12:80303693-80303715 CTGGAAAGACAGAAAGAATGAGG + Intronic
1099887801 12:88553292-88553314 CTGGAAACTCTGAGGGAATAGGG + Intronic
1100069289 12:90691784-90691806 TTTTAAAGGCAAAGGGAATCGGG + Intergenic
1100129975 12:91480102-91480124 TTGGACACGCAGAGGGAAACAGG - Intergenic
1100183004 12:92106009-92106031 GTGGATTGGCAGAGGGAGTCTGG + Intronic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1100570930 12:95842367-95842389 CGGGAAAGGGAGAGGGAGACGGG + Intergenic
1102130865 12:110527858-110527880 CTGGAAAGGATGAGGGCATGGGG + Intronic
1102198083 12:111038537-111038559 TTGGAGAGGCAGAGGGAATGGGG - Intronic
1102605462 12:114064416-114064438 CTGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1103246658 12:119463916-119463938 CTGGAAAGGTAGGGAGAACCAGG - Intronic
1103834456 12:123807855-123807877 CTGGAGAGGGAGAGAGAAACAGG + Intronic
1104342629 12:127965937-127965959 CTGGAAAGACACTGGGCATCAGG + Intergenic
1105705147 13:22963708-22963730 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1105858060 13:24388724-24388746 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106373840 13:29164249-29164271 CTGGAAAGGCAGAGCGAGAAGGG - Intronic
1106679972 13:31999475-31999497 CTGGAGAGGGAGAGGGAGACGGG - Intergenic
1106749332 13:32743609-32743631 ATGGAAAGGCAGAAGGCAGCTGG - Intronic
1107015096 13:35701960-35701982 CAGAAAAGGCAGAGGGGAACAGG - Intergenic
1107113609 13:36723708-36723730 GTGGAAAGGTAGGGGGACTCAGG - Intergenic
1109530214 13:63632970-63632992 CTTGTAAGGCAAAGTGAATCTGG - Intergenic
1109914209 13:68959193-68959215 TTGGAAACACAGAGGGAATTAGG + Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1112105328 13:96233721-96233743 CTTGATAGGAAGAGGGAATGTGG + Intronic
1113058828 13:106299193-106299215 CTGGATGGGCAAAGGGACTCAGG - Intergenic
1113782501 13:112984792-112984814 CTGGAAGGGGAGAGGGCGTCAGG + Intronic
1115080370 14:29443709-29443731 CAGGCAAAGCAGAGGGAATCGGG - Intergenic
1115722386 14:36177289-36177311 CTGGAAAGGCAGTGGGCAGATGG - Intergenic
1116787289 14:49301609-49301631 CTGAAAACACAGAGGGACTCAGG + Intergenic
1117636838 14:57753389-57753411 CTGTAAAGGCTCAGGGAAGCTGG - Intronic
1118443042 14:65829112-65829134 GTGGAAAGGCAGATGGAATGAGG + Intergenic
1119535188 14:75397110-75397132 CTGGAAAGGCACTGGGAACCAGG - Intergenic
1119563461 14:75608981-75609003 CTGGAAAGACATAGGGAAGCTGG - Intronic
1120334801 14:83141161-83141183 TTGAAAAGGCAAAGGGAATAGGG - Intergenic
1120433977 14:84456689-84456711 ATGGAAAGTCAGAGGGAGTGAGG + Intergenic
1120711810 14:87800232-87800254 CTGGATAGCCACAGTGAATCTGG - Intergenic
1121747403 14:96308828-96308850 CTTGAAAGCCAAAGGGAAGCAGG - Intronic
1122064380 14:99161694-99161716 CTGGAAAGGGAGTGTAAATCTGG - Intergenic
1122310476 14:100791302-100791324 AGGGAAAGGCAGAGAGAAACAGG + Intergenic
1122862113 14:104587387-104587409 CTGCAATGGCAGAGGGGCTCTGG - Intronic
1124145653 15:27123034-27123056 ATGGAAAGGGAGAGGGAAAAAGG - Intronic
1124630148 15:31331553-31331575 CTGGCAGAGCAGAGGGCATCTGG + Intronic
1125573416 15:40738438-40738460 CTGGAAAGGAGTGGGGAATCTGG + Intronic
1125687576 15:41572617-41572639 CTGGAAAGGCATAGAGACCCTGG + Intronic
1126223576 15:46243302-46243324 GTGGAAAAGCAGAGAAAATCTGG - Intergenic
1128238124 15:66081194-66081216 CTGGGAATGAAGAGAGAATCAGG + Intronic
1128397508 15:67243240-67243262 CAGGAAAGGGAGAGAGAATATGG + Intronic
1129686226 15:77687540-77687562 CTGCTAGGGCAGAGGGAATCTGG - Intronic
1130678341 15:85974103-85974125 ATGGATAGGCGGTGGGAATCAGG - Intergenic
1130722967 15:86408014-86408036 CAGCAAAGGCAGAGGGCAACTGG + Intronic
1131258803 15:90877960-90877982 TTTGAAAGGCAGAGGCAAACAGG + Intronic
1132805328 16:1772647-1772669 CTGCAAAGCCAGAAGGAAGCGGG + Intronic
1134230342 16:12424021-12424043 CTGGTTGGCCAGAGGGAATCAGG + Intronic
1134430402 16:14199212-14199234 CTAAAAAGGCGGAGGGAACCAGG - Intronic
1135412305 16:22244518-22244540 CTGGAGAGGCAGACAGTATCAGG - Intronic
1135459178 16:22626861-22626883 CTTGACAGGGAGAGGTAATCTGG + Intergenic
1135515551 16:23130112-23130134 CCGGAAAGGCAGAGGAACACAGG - Intronic
1135822467 16:25696222-25696244 TTGGAAAGGGAGAGGGAAGAGGG - Intronic
1136082340 16:27860397-27860419 CTGGAAAGGCTGGGGGCTTCCGG - Intronic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1138704570 16:58901662-58901684 TTGGAATGGCTGAGGGAATTAGG + Intergenic
1139573107 16:67825590-67825612 CAGGAAGGGCAGAGGGCTTCAGG + Intronic
1139917572 16:70438137-70438159 CTCTACAGGCAGAGGGAACCCGG + Intronic
1140258315 16:73355975-73355997 CTGGAGAGGCAGCGTGAATGTGG - Intergenic
1140987871 16:80176362-80176384 ATGGAAATGAAAAGGGAATCTGG + Intergenic
1141186757 16:81793151-81793173 CTGGAAAGCAATAGGGAACCTGG - Intronic
1141873314 16:86804541-86804563 CTGGCAAGGCAGAGGCAAGGTGG + Intergenic
1142551948 17:746284-746306 CAGGGAAGGCAGTGAGAATCTGG + Exonic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1142732994 17:1875000-1875022 CTGGGAAAGAACAGGGAATCAGG - Intronic
1143177418 17:4964179-4964201 CTCCAGAGGCAGAGGGGATCTGG - Intronic
1143410588 17:6706148-6706170 CTGGAAATGGAGAGAGAAGCTGG + Intronic
1143450996 17:7036617-7036639 CTCGGAAGGGAGAGGGAATGCGG + Intronic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1144485067 17:15657536-15657558 CTGGAGGGGGAGAGGGAATGAGG - Intronic
1144532964 17:16057955-16057977 CTTCACAGGCAGAGGGAATGGGG - Exonic
1145733443 17:27211294-27211316 CGGGAGAGGCAGAGGGAGACGGG - Intergenic
1146430034 17:32784342-32784364 TTGGAGAAGGAGAGGGAATCTGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147448184 17:40487730-40487752 CTGGGAAGGCAGACGGAATGTGG - Intronic
1147598974 17:41734248-41734270 CTGGAAAGGCAGCGGGCATCTGG - Exonic
1148843128 17:50511863-50511885 CCGGAGAGGCAGAGGCAAGCTGG - Intronic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1149412188 17:56419966-56419988 CTGGAAAGGTATGGGGAACCAGG - Intronic
1149642262 17:58210830-58210852 CTGGAAACGCAGAGGGTTCCTGG - Intronic
1150135914 17:62695048-62695070 GGGGAAAGGCAGTGGGAGTCAGG + Intergenic
1150197680 17:63317837-63317859 CTAGAAAGACAGAGGGCATTTGG + Intronic
1150280581 17:63927785-63927807 CTGGAATTCCAGAGGGAATCTGG + Intergenic
1150446652 17:65231787-65231809 CTGGGAAGGCTGAAGGAAGCCGG + Intergenic
1151102024 17:71566894-71566916 CTGGAAAGGGAGAGGAAAGCAGG + Intergenic
1151985311 17:77539479-77539501 CTTAAAAGGCAGAGATAATCTGG - Intergenic
1152176542 17:78791689-78791711 CTGAAGAGGCAGGGGGGATCTGG + Intronic
1152231040 17:79114350-79114372 CTGGAAAGGCTGATGGTCTCGGG + Intronic
1152354287 17:79799218-79799240 CGGGACAGGCAGAGGGACCCGGG - Intronic
1152390687 17:80002061-80002083 CAGGAAACGCAGAAGGGATCCGG + Intronic
1153198364 18:2625196-2625218 ATGGAAAGGCTGAGGGAAGTGGG + Intergenic
1155344722 18:24847074-24847096 CTGGCCAGGCAGAGGGCAGCTGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158416693 18:57255066-57255088 CTGGAAACTCAGAGTGATTCAGG - Intergenic
1158710645 18:59834699-59834721 TTGGAAAGGCAGTGGGTGTCTGG + Intergenic
1160229436 18:77035150-77035172 CTGGAGAAGCAGAGGAAACCTGG - Intronic
1161384537 19:3983955-3983977 ATGGAGAGGCACAGGGATTCGGG - Intronic
1162050172 19:8028223-8028245 AAGGAAAGGCAGTGGGGATCTGG - Intronic
1162192972 19:8961589-8961611 CTGGTAAGGTAGAAGAAATCAGG + Exonic
1162472894 19:10883027-10883049 CAGGAAAGGCAGAGAGTAGCAGG - Intronic
1165124501 19:33584074-33584096 CTAGAAAGGTAGGGGGGATCAGG - Intergenic
1165313230 19:35040773-35040795 ATGGAAAGGCAGAGGAAGCCAGG + Intronic
1166183523 19:41124696-41124718 CTGGAGAGGAAGCGGGAAGCGGG - Intronic
1166830802 19:45638679-45638701 CTGGAAGAGGAGAGGGAATAGGG - Intronic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925863131 2:8199725-8199747 GTGGTAAGGCAGAGGGAATGAGG + Intergenic
925998583 2:9311908-9311930 ATGGAAAGGCAGAGGCAAGCAGG + Intronic
926366032 2:12133828-12133850 CTGGGAAGTCAGAGGGGCTCAGG + Intergenic
927317859 2:21706547-21706569 CAGGAAAGGCACAGGGAACTAGG - Intergenic
927419637 2:22916716-22916738 CTGGCAAGGCAGAGGGTAGCAGG + Intergenic
928387834 2:30884804-30884826 CTGGAAAGACAATGGGAATTGGG + Intergenic
928943748 2:36753651-36753673 CTGGTCAGGCAGAGGGAATCAGG + Intronic
929183924 2:39073671-39073693 CTGAAAAGGCAAAGGGATTTAGG + Intronic
929589034 2:43133396-43133418 CTTGCAAGGCACAGGGGATCTGG + Intergenic
930115253 2:47712587-47712609 ATGGATACACAGAGGGAATCAGG + Intronic
930288529 2:49465362-49465384 GTGGAAGGGCAGAGGGAAAGGGG - Intergenic
931142839 2:59482580-59482602 CTGAAAAAGCAGAGGCCATCTGG - Intergenic
931245816 2:60491950-60491972 TTGGAAATTGAGAGGGAATCTGG + Intronic
931799324 2:65743083-65743105 TTGGAAAGGCATAAGGAATCTGG - Intergenic
932299535 2:70656427-70656449 CTGGAATGGAAGAGGGTGTCAGG - Intronic
933219486 2:79671374-79671396 CTTGAGAGGCAGAGGGTATTGGG - Intronic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933702953 2:85268849-85268871 CTGGAAAGTCAGCGGGCAGCAGG + Intronic
933843960 2:86310052-86310074 ATGAAAAGCCACAGGGAATCAGG + Intronic
935109152 2:100075970-100075992 CTGGAATGGCAGAGAGACACTGG - Intronic
935571135 2:104661128-104661150 CTGGGAGGGTGGAGGGAATCAGG - Intergenic
935783540 2:106529254-106529276 CTCCAAAGGGAAAGGGAATCTGG + Intergenic
936530265 2:113271421-113271443 TTGGAAAGGCAGAGGGAGGGAGG - Intronic
937421083 2:121755862-121755884 ATGGAAAGGCAAAGGGAATGGGG - Intronic
938949953 2:136246238-136246260 AGGGAGAGGCAGAGGGAAGCCGG + Intergenic
939107955 2:137971556-137971578 CTGGAAAGGTAGATGGACACAGG + Intronic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
941550272 2:166907498-166907520 CTGCAAAGTCAGCGGGAATCTGG + Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
942426866 2:175869321-175869343 CTGGGAAGCCAGAGGGCAACAGG - Intergenic
945032989 2:205682469-205682491 CTGAAAAGGCAGTGGGGAGCCGG + Intronic
945350239 2:208769042-208769064 CTGGAAAGGCAGAATGATTTTGG - Intronic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
947636066 2:231681250-231681272 CCGGGAAGGCAGAGGGGAGCGGG - Intergenic
948318148 2:237046010-237046032 CTCGAAAGGCTGTGGGACTCAGG - Intergenic
948573169 2:238930169-238930191 CTGGAAGGAGAGAGGCAATCAGG - Intergenic
1168834585 20:869633-869655 CTTGATAGTCAGAGGCAATCTGG + Intergenic
1168959009 20:1855525-1855547 TTGGAAAGAAAGAGGCAATCTGG + Intergenic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1170077585 20:12436620-12436642 TTGGTAAAGCAGAAGGAATCTGG + Intergenic
1170435963 20:16329088-16329110 CTGGAAGGTCAGAGGTCATCAGG - Intronic
1170579748 20:17689194-17689216 CAGGAATGGCAGAGGGGATGTGG + Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171075785 20:22121490-22121512 GTGGTATGGCAGTGGGAATCAGG - Intergenic
1172943923 20:38673833-38673855 TTTCCAAGGCAGAGGGAATCAGG + Intergenic
1173654694 20:44691504-44691526 CTGGAAAGACAGAGGGCATGGGG + Intergenic
1174227915 20:49019140-49019162 CTGGAAAGGTACAGAGAAACAGG - Intronic
1175112418 20:56657951-56657973 CTGGAGTGGCAGAGGGGAGCCGG + Intergenic
1175444910 20:59013310-59013332 CTGGAAAGCCAGTGGCAACCGGG - Intergenic
1175593699 20:60213622-60213644 CTGGAAGGGAAGAGGCACTCGGG - Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1178021753 21:28416379-28416401 CTGGGAAGGCACAGGCAATAAGG - Intergenic
1178204399 21:30446522-30446544 ATGGCAAAACAGAGGGAATCTGG - Intergenic
1179773193 21:43640392-43640414 GGGGCAAGGCAGAGGGAATGGGG + Intronic
1180660589 22:17463606-17463628 CTGGGGAGTTAGAGGGAATCAGG + Intronic
1181315860 22:21970574-21970596 CTGGAAAGGCAGGGGGATAGAGG - Intronic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1183850961 22:40587597-40587619 CTGGTAAGGCAGAGGCAGCCAGG + Intronic
950144086 3:10635516-10635538 CTGGAGAGGGAGAGGGGAACAGG - Intronic
950152583 3:10699040-10699062 CTGGAAGGCCGGAGGGAACCAGG - Intronic
951168248 3:19507548-19507570 CTGCAATGGCAGAGGGATTGTGG + Intronic
953664267 3:44914869-44914891 CTGGAAAGGCAGAGGATGACAGG - Exonic
953750550 3:45605270-45605292 CTGGAAAGGCAGAGGCCAAGCGG + Intronic
954583780 3:51717844-51717866 CTGGACAGGGAGAGGGGAACAGG - Intronic
954865185 3:53722940-53722962 CTGGAGAGGTAGAGGGAAACGGG - Intronic
955060511 3:55488479-55488501 CTGGAAAGAGAGAGGGAAGGGGG + Intronic
955436093 3:58900153-58900175 CTGTGAAGGCAGAAGGACTCTGG + Intronic
955539556 3:59960042-59960064 CTGGAAAGGCAGAGAGGAGGTGG + Intronic
955872425 3:63453230-63453252 CTGAAAAGGCAAAGAAAATCTGG - Intronic
956355801 3:68390598-68390620 CAGGAGAGGCAGCGGGCATCTGG + Intronic
957819433 3:85351631-85351653 CTGCACAGGCTGAGGGAATGTGG + Intronic
959408401 3:105989980-105990002 CGGTAGAGGCAGAGGGATTCTGG + Intergenic
959800979 3:110495181-110495203 CTGGAAAGGGAGATGAAGTCAGG + Intergenic
960165896 3:114400852-114400874 ATTGAAAGGCAGAGGGTATCAGG + Intronic
961719300 3:128882010-128882032 CTGAAAAAGCAAAAGGAATCTGG - Intronic
961805500 3:129486598-129486620 CTGGAAAGGAAGAGTGGAGCAGG + Intronic
962262980 3:133926825-133926847 ATGGAAATGCAGGGGGAAGCCGG - Intergenic
962286093 3:134086625-134086647 CAGGGAAGGCAGACTGAATCAGG - Intronic
963294937 3:143536168-143536190 CTGGAAAGTGAGAGGTAAGCTGG + Intronic
964319401 3:155479369-155479391 CTGGACAGGCACTGGGAGTCTGG - Intronic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
964562481 3:158012914-158012936 CTGGAAAGCCAGAAGAAATGGGG + Intergenic
965157475 3:165082660-165082682 CTGGAAATGCAGAGAGAGCCAGG + Intergenic
965288281 3:166844466-166844488 CTGGAAATCCTTAGGGAATCTGG - Intergenic
966301547 3:178484887-178484909 CTGGATAGCCAGAGGGCAACAGG + Intronic
967189809 3:186975552-186975574 GTGGACAGGCAGAGGGAGACTGG - Intronic
967762782 3:193243426-193243448 CTGGAAAGGTGCAGGGATTCTGG + Intronic
968731768 4:2272435-2272457 CTGGTTAGGCACAGGGAGTCTGG - Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969158821 4:5237264-5237286 CAGGAAAAGCAGTAGGAATCTGG - Intronic
969406320 4:6994948-6994970 CTGGAAAGTTAGAGGCCATCAGG + Intronic
969444739 4:7238270-7238292 CTGGGGAGGTAGAGGGAGTCTGG + Intronic
969566334 4:7980771-7980793 CTAGAAAGGGAAAGGGATTCTGG - Intronic
969862838 4:10051152-10051174 CTGGAAATGCCAAGGGATTCAGG + Intronic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971357548 4:25908671-25908693 CTGGAAAACCAGGGAGAATCAGG - Intronic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
972293342 4:37713004-37713026 CTGGAAAGGGAAGGGGATTCTGG - Intergenic
974012804 4:56623072-56623094 CTAGAAAGGCAGCAGGAAGCTGG - Intergenic
976716805 4:88131624-88131646 GTGAAAAGGCAGGGAGAATCTGG - Intronic
976874428 4:89836742-89836764 GTGGAGAAGCAGAGGGACTCAGG - Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
977750413 4:100603195-100603217 CTGGAAAAGGAGAGGAAGTCAGG - Intronic
977979678 4:103307217-103307239 CTGCAATGGCAGAGGGACTTTGG + Intergenic
978066056 4:104404304-104404326 ATTGAAAGGCAGAAAGAATCAGG - Intergenic
978388902 4:108203792-108203814 CTGGAAAGGCACATTGAAGCAGG + Intergenic
978552068 4:109938579-109938601 TTGGAAAAGAAGAGGCAATCTGG + Intronic
978979083 4:114919428-114919450 CATGAAAGGCAGAAGAAATCAGG + Intronic
980820519 4:138010169-138010191 CTGGACAGGCATATGGGATCTGG - Intergenic
981258968 4:142696632-142696654 ATGGCAAGGCAGAGGGACGCAGG - Intronic
981872288 4:149501139-149501161 TTGGAAATGCAGAAGCAATCAGG - Intergenic
982592909 4:157337915-157337937 CAGGGAAGTCACAGGGAATCTGG - Intronic
984483443 4:180335713-180335735 CTGCAAACTCAGAGGCAATCTGG - Intergenic
985425096 4:189822305-189822327 ATAGAAAGGCAAAGGGAAACTGG + Intergenic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986791177 5:11162364-11162386 ATGGAAAGGCAGATGCAGTCTGG + Intronic
991659450 5:68935373-68935395 CTGGAAAGGCAGTGAGATTGAGG + Intergenic
993744859 5:91584827-91584849 TTGGAAATACAGAGGGATTCTGG - Intergenic
995247195 5:109947833-109947855 CAGGAATGGCTGAGGGAATAGGG + Intergenic
997483371 5:134206960-134206982 AAGGAAAGGGAGAGGGAAACTGG + Intronic
997632563 5:135379857-135379879 CTTGAAAAGCAGAGGAAGTCAGG - Intronic
997841490 5:137244799-137244821 CTGGCATGGCAGAGAGCATCGGG - Intronic
997997363 5:138597435-138597457 CTGAAAAGGTAAAGGGAATCTGG - Intergenic
998400113 5:141844282-141844304 CTGATAAGGCAGAGGGAATGAGG + Intergenic
998586017 5:143428482-143428504 TTGGAAAGGCAGAAGGAGTCAGG - Intronic
998729799 5:145061889-145061911 CTGGCATGGCAGAGGTGATCAGG + Intergenic
999420793 5:151440691-151440713 CTGGAAAAGCAGATGAGATCAGG - Intronic
1001810825 5:174626937-174626959 CTGGAAGAGCAGAGGGTATTTGG + Intergenic
1002426778 5:179181313-179181335 CTGGAGAGGCAGAGGGCAGGGGG - Intronic
1002499513 5:179638715-179638737 CTGGTCAGGCAGAGGGAAGCAGG - Intergenic
1003224122 6:4189389-4189411 CTGGAAGGACAGAGAGAAACGGG + Intergenic
1003252965 6:4448134-4448156 CAGGAAAGGGAGACGGCATCTGG - Intergenic
1003423950 6:5984011-5984033 ATGCAAAGGCAGAGGGGAGCAGG + Intergenic
1003432411 6:6052243-6052265 CTGGAAAGGCTGATGAAATGAGG + Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003604411 6:7545989-7546011 TTGGATAGGCAGAGGGAAGCTGG + Intronic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1005015403 6:21370728-21370750 CTGAAAAGGCAGTGGGAGACTGG - Intergenic
1005340488 6:24839273-24839295 CTGTAAAGGCAGAAGGCACCAGG + Intronic
1005812472 6:29528139-29528161 CTGGAAAGGCAGAGGTCACCTGG - Intergenic
1006163306 6:32050198-32050220 CAGGACAGGCTGAGGGAGTCGGG + Intronic
1006163930 6:32053588-32053610 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006164557 6:32056786-32056808 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006165556 6:32062357-32062379 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006166507 6:32068590-32068612 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006294711 6:33165030-33165052 CTGGGAGGGAAGAGGGAATGTGG - Intronic
1006863459 6:37189415-37189437 CTTCAAAGACAGAGGGAAACAGG + Intergenic
1007367167 6:41403012-41403034 CTGGAGAGGCAGAGGCAATGGGG - Intergenic
1007593459 6:43037455-43037477 GGAGAAAGGCAGAGGGAGTCAGG - Intergenic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1009811539 6:68673858-68673880 CTTCAAATGCAGAGGGAATAGGG + Intronic
1009860848 6:69329796-69329818 AGGGAAATGCAGAGGGAATGGGG - Intronic
1009915431 6:69989307-69989329 TTGGAAAGGCAGGCAGAATCAGG - Intronic
1010120607 6:72371591-72371613 CCAGAAAGGTAGAAGGAATCAGG + Intronic
1010461680 6:76120769-76120791 CTGGAAAGCAAGAGGGAATCTGG + Intergenic
1011499820 6:87975752-87975774 AGAGAAAGGCAGAGGGAAACTGG - Intergenic
1011590529 6:88966348-88966370 CTGGGAGGGGAGAGGGAATGAGG - Intergenic
1011610703 6:89147282-89147304 CTGGAAAAGCAGAGTAAAACAGG - Intronic
1013333412 6:109129514-109129536 ATGGAAAGACAGAGGGTATTTGG + Intronic
1013413209 6:109900515-109900537 CAGGAGTGGCAGAGGGATTCAGG - Intergenic
1013929568 6:115514802-115514824 CTGAAGAGGCTGAGGCAATCTGG - Intergenic
1014365221 6:120531905-120531927 CTGGAAAAGCAGTGGGGATGGGG - Intergenic
1014879118 6:126700641-126700663 CTGGAAAGATAAAAGGAATCTGG - Intergenic
1014935872 6:127384040-127384062 CTGGTGAGGCAAAGGGATTCTGG - Intergenic
1015427804 6:133092533-133092555 CTGGAATAGCAGTGGGGATCTGG + Intergenic
1015798401 6:137035866-137035888 TTGGAAAGGGAGAGGGATGCTGG + Intronic
1016082436 6:139872250-139872272 AAGGAAAGGCAGAGAGAACCAGG - Intergenic
1018673120 6:166195778-166195800 CTGGAATAGTAGAGGGAATGCGG + Intergenic
1018865947 6:167747235-167747257 CTGGATAGGCACAGGGACTGCGG + Intergenic
1019067792 6:169317013-169317035 GTGGAAAGCCAGATGGAATTTGG - Intergenic
1019787599 7:2987284-2987306 ATGAAAAGGCAGAGGTGATCGGG + Intronic
1019946484 7:4333571-4333593 CTGGATAGGCAGAGGTAATCTGG - Intergenic
1022059880 7:26782998-26783020 CAGGAGAGGCAGAAAGAATCTGG - Intronic
1022169977 7:27816853-27816875 TTGGAAAGGTAGAGTGAAACTGG - Intronic
1022445509 7:30467295-30467317 CTGGAAAGGGAGAGGACACCAGG + Intronic
1023040169 7:36165993-36166015 CTGTAAACGGAGAGGGATTCAGG + Intronic
1023041980 7:36180325-36180347 CTGGGGAGGCAGAGGGGATGAGG + Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1025694403 7:63767485-63767507 TTGGGAGTGCAGAGGGAATCGGG + Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026467495 7:70667003-70667025 GTGGAAAGGCAGAGAGAAGAGGG - Intronic
1026938987 7:74275761-74275783 CTGGAGATGGAGAGGGAAACAGG - Intergenic
1027051893 7:75025868-75025890 AGGGACAGGCAGTGGGAATCGGG + Intergenic
1027756737 7:82223501-82223523 CAGGAAAGACAGAGAGCATCAGG + Intronic
1028545552 7:91995318-91995340 CTGGAAAGCCATAGGGAATTCGG + Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1033424436 7:141231157-141231179 CTGGAAATGCAGAGGCAAACAGG - Intronic
1033477807 7:141707456-141707478 CTGGAAAGGCAGGGGAAATGGGG - Intergenic
1033629205 7:143140455-143140477 CAGGAGAGGCCGAGTGAATCTGG + Intergenic
1035374955 7:158401786-158401808 CTGGGAAGACAGAGGGGCTCAGG + Intronic
1035402502 7:158576673-158576695 ATGGAAATGCACAGGGCATCTGG + Intronic
1035484906 7:159215281-159215303 TGGGAAAAGCAGAGGGACTCAGG + Intergenic
1035614036 8:989229-989251 CTGGGAACCCAGAGGGACTCCGG - Intergenic
1035678373 8:1470771-1470793 CGGGAAAGGCTGGGGGAGTCGGG - Intergenic
1035716449 8:1758909-1758931 CTGGAAAGGGAAGGGGATTCTGG + Intronic
1036011732 8:4732906-4732928 CTGGGATGGCAGAGGAGATCGGG + Intronic
1036415524 8:8544312-8544334 CTCCAAAGGCAAAGGGAATTTGG - Intergenic
1036572872 8:9997369-9997391 CCAGAAAGACAGAGGGAAACAGG - Intergenic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1037821997 8:22139567-22139589 CTGCAGAGGAAGAGGGACTCTGG - Intronic
1037981846 8:23259891-23259913 CTTCAAGGGCAGTGGGAATCAGG + Intronic
1038525937 8:28273406-28273428 CTGGAAAGCCAGGGGCATTCAGG - Intergenic
1039550762 8:38441172-38441194 CTTAAAAGACAGAGGGACTCTGG + Intronic
1039745258 8:40419840-40419862 CAGGGAAGGAAGAAGGAATCTGG + Intergenic
1040543524 8:48380063-48380085 CTGGCAAGGGAGAAGGAAACAGG + Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1041501096 8:58539609-58539631 CTGGAAAGGCAAAATGACTCAGG + Intergenic
1042509965 8:69600927-69600949 CTGGAGAGGTAGATGGAATGAGG - Intronic
1043095889 8:75971532-75971554 CTGGCTAGGCAGAGTGAATTAGG - Intergenic
1044224291 8:89701987-89702009 ATGGAAAAGAAGAGGGAATTGGG - Intergenic
1045479921 8:102583572-102583594 TTGGCAAGGCTGAGGGCATCAGG - Intergenic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1046510860 8:115200675-115200697 CTGAAAAGGCAGAGGGTAAGAGG - Intergenic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1047549953 8:125860108-125860130 ATGGAAAGGTAGATGGAAGCGGG + Intergenic
1047801921 8:128318923-128318945 CTGGGAAGGGAGAGGGAACCAGG + Intergenic
1048154009 8:131924608-131924630 CCAGAAAGGCTGAGGGAAACAGG - Intronic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049149987 8:141028605-141028627 ATGGAAAGGCAGTAAGAATCTGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049793978 8:144488104-144488126 CTGGAAAGACAGAGGCTGTCAGG - Intronic
1050148902 9:2599473-2599495 CTGGAAAGGAAATGGGAATTAGG + Intergenic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1052093176 9:24354985-24355007 CTGGAAAGAGAAAAGGAATCAGG - Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052492468 9:29187816-29187838 TTGGAAAGCCAGAAGGAAACTGG + Intergenic
1052781066 9:32782860-32782882 CTGGAAAGCCACGGGGACTCCGG + Intergenic
1053148695 9:35729436-35729458 ATGGAAAGGCAGAGGAAGACTGG + Intronic
1054744707 9:68843018-68843040 CGTGAAGGGCAGAGGGAAGCTGG - Intronic
1055460784 9:76518510-76518532 CAGGAAAGGTAGAGGGTATATGG - Intergenic
1055463596 9:76542385-76542407 TTGGAAAGGAAGAGGGAAGTTGG - Intergenic
1056419057 9:86405969-86405991 CTAGAAAAGCAGAGTGACTCAGG + Intergenic
1056888974 9:90471551-90471573 CTGGGAAGGCAGGTGAAATCAGG + Intergenic
1057524060 9:95784068-95784090 CTGGGAAGGAAGAGGGGATGTGG - Intergenic
1058909290 9:109506240-109506262 CTGGAAAGGCAGCAGTAATAGGG + Intergenic
1059331735 9:113539838-113539860 TTGGGAAGGTAGAGGGAGTCAGG + Intronic
1060036932 9:120263799-120263821 CTGGAGAGGCAGAGGCGACCAGG + Intergenic
1061200249 9:129133920-129133942 CTGGCAAGGCAAAGGGAGTGAGG - Intronic
1061404589 9:130386296-130386318 CTGGGGAGCCAAAGGGAATCAGG - Intronic
1061531603 9:131218497-131218519 TTTGAAAGGCAGAAGGAACCAGG - Intronic
1061773717 9:132946525-132946547 ATGGAAAGGTCGAGGGAAACGGG + Intronic
1061936507 9:133860638-133860660 CTGGAATGGCAGAGAGAGCCTGG - Intronic
1061995088 9:134179140-134179162 CTGGAAAGACAGAGGAACACGGG - Intergenic
1062261204 9:135664030-135664052 CTGGAAGGGCGGAGGGGTTCTGG + Intronic
1187042668 X:15613353-15613375 CTGGAAAGGTAGAAGGACCCGGG + Intergenic
1191674866 X:63784019-63784041 GTGGAGGGGAAGAGGGAATCTGG - Intronic
1192200309 X:69062295-69062317 CTGGCAAGGAAAAGGGATTCTGG + Intergenic
1193361716 X:80586851-80586873 CTGGAAAGGGAGCTGAAATCAGG - Intergenic
1193988136 X:88272500-88272522 CTAAAAAGGTACAGGGAATCTGG + Intergenic
1197076989 X:122364426-122364448 CTGGAAAAGCAGGGGCAATTAGG - Intergenic
1199070902 X:143474423-143474445 CTGGGAAGACAGTGGTAATCTGG - Intergenic
1199202748 X:145112209-145112231 CTGTAAAGGAAGATTGAATCTGG - Intergenic
1199354968 X:146851429-146851451 CTGGCAAGGCAGTGGGACTTGGG - Intergenic
1199892631 X:152102053-152102075 CTGGAAAGGCAGAATAAAGCTGG + Intergenic
1199975081 X:152890005-152890027 CTTGGATGGCAGAGGGAATGAGG + Intergenic
1199980474 X:152917803-152917825 CTGGAAAGGCCAAGGGGACCCGG + Intronic
1201504319 Y:14681110-14681132 ATGGAATGGCAAAGGGAATTGGG - Intronic