ID: 1092260870

View in Genome Browser
Species Human (GRCh38)
Location 12:6952662-6952684
Sequence TGGGGATGGGTCTGTCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092260858_1092260870 -4 Left 1092260858 12:6952643-6952665 CCTTGTCCCAGCCGCCCCGTGGG 0: 1
1: 0
2: 2
3: 14
4: 209
Right 1092260870 12:6952662-6952684 TGGGGATGGGTCTGTCCTGTGGG 0: 1
1: 0
2: 4
3: 32
4: 262
1092260856_1092260870 11 Left 1092260856 12:6952628-6952650 CCAAGACACTTGATGCCTTGTCC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1092260870 12:6952662-6952684 TGGGGATGGGTCTGTCCTGTGGG 0: 1
1: 0
2: 4
3: 32
4: 262
1092260862_1092260870 -10 Left 1092260862 12:6952649-6952671 CCCAGCCGCCCCGTGGGGATGGG 0: 1
1: 0
2: 1
3: 10
4: 255
Right 1092260870 12:6952662-6952684 TGGGGATGGGTCTGTCCTGTGGG 0: 1
1: 0
2: 4
3: 32
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092260870 Original CRISPR TGGGGATGGGTCTGTCCTGT GGG Intronic
900546159 1:3230430-3230452 TGGGGAAGGGTCTCTTCTCTGGG - Intronic
900708690 1:4097098-4097120 TGGGGAGGGGACTGTCCTGTGGG - Intergenic
900804294 1:4757194-4757216 AGGGGAGGGGTCTGTGCTGAAGG - Intronic
900902545 1:5526826-5526848 TGGGGACAGGTCTGTCCTCCAGG + Intergenic
903407716 1:23112269-23112291 TGAGGATGGATCTGTCATGGTGG - Intronic
903886380 1:26543285-26543307 TGGGGGTGGCTCTGTCCCTTGGG + Intronic
904446372 1:30576078-30576100 TGGGGATGGCTCTTTCCTGTGGG - Intergenic
904620163 1:31770414-31770436 TGGTGCTTGGTCTGTCCTCTGGG - Intergenic
905885129 1:41487671-41487693 TGGGGCTGGGTGTGTTCTCTTGG + Intergenic
905887039 1:41496939-41496961 TGGGCCTGGGCCTGTCCAGTGGG + Intergenic
910661180 1:89674664-89674686 TGTTGATTGGTCTTTCCTGTTGG - Intronic
912975746 1:114328720-114328742 TGGGGCTGGGTCCTTCCTGTAGG + Intergenic
915628745 1:157135665-157135687 TGGGGATGACTCTGTTTTGTAGG + Exonic
916166956 1:161973124-161973146 TGGGGCTGGGGCCTTCCTGTGGG + Intergenic
918071297 1:181135006-181135028 TGGGGATGGGTGTGCCCCATGGG + Intergenic
918474209 1:184905634-184905656 TCGGGTTGGGACTGTCATGTGGG - Intronic
919554958 1:199039794-199039816 AGGGGAAGGCTTTGTCCTGTTGG + Intergenic
920182752 1:204142703-204142725 GAGTGATCGGTCTGTCCTGTGGG - Intronic
920503077 1:206497610-206497632 TGGGGAAGGGTGAGTCCTGGAGG + Exonic
920511085 1:206552525-206552547 TGGAGATGGGTGTGAACTGTTGG + Intronic
920674308 1:208028797-208028819 AGGGCATGGGCCTGTCCTGAGGG + Intronic
920909216 1:210198761-210198783 TGGTGCTGAGTCTGTCTTGTGGG - Intergenic
922721511 1:227902445-227902467 TGGGGAGGGGCCTCTCCTGCTGG + Intergenic
923121678 1:230998115-230998137 TGGGGCTGTTTCTGACCTGTGGG + Intronic
923789199 1:237096914-237096936 TTGGAATTGGTCTGTCCTGCAGG + Intronic
1062821163 10:535432-535454 TGGGGAAGGATCTGTTCTGTGGG - Intronic
1064401385 10:15024282-15024304 TGGGTTTCGGTCTGTCCTGCTGG + Intergenic
1067084743 10:43231807-43231829 TGGGGCTGAGGCTGTCCTGCAGG + Intronic
1068769437 10:60804462-60804484 CTGGGGTGGGTCTGTCCAGTGGG - Intergenic
1069925890 10:71850852-71850874 TGGGGGTGGGTGAGTCTTGTAGG - Intronic
1070400742 10:76051327-76051349 AGGGCCTTGGTCTGTCCTGTGGG + Intronic
1073318255 10:102597856-102597878 GGAGGATGTGGCTGTCCTGTTGG + Intronic
1074882633 10:117670558-117670580 TGGGGTTGGGTGTGTATTGTGGG + Intergenic
1074961190 10:118447639-118447661 TGGGGCTGTGCCTGTCCTGGAGG - Intergenic
1076420547 10:130328376-130328398 TGGGGGTGGTGCTGTGCTGTAGG + Intergenic
1076890395 10:133280552-133280574 TGCGGCTGTGTGTGTCCTGTGGG - Intronic
1077600843 11:3573440-3573462 AGGGGCTGGTTCTGGCCTGTGGG + Intergenic
1077870885 11:6260334-6260356 TGGGGAAGGGGCTGTGCTTTGGG - Intronic
1079824485 11:25174376-25174398 TGGGGATGGGGATGTCAGGTAGG + Intergenic
1080563020 11:33481684-33481706 TGAGGGTGGGTCTGTCCTACTGG - Intergenic
1081491849 11:43575506-43575528 TGGGGAGGGGGCTGTCCTGCTGG + Intronic
1081726456 11:45332838-45332860 TGGGCGTGGTTCTGTCCTCTCGG + Intergenic
1083309517 11:61777230-61777252 TGGGGCTGGATCAGTCCTGGGGG - Intronic
1083612248 11:64009864-64009886 TGGGGCTGGGACTGGCCTGCAGG - Intronic
1083993031 11:66258199-66258221 TGGGGATGGGGCTGTCCGAGGGG + Intronic
1084256764 11:67948026-67948048 GGGGGCTGGTTCTGGCCTGTGGG + Intergenic
1084483329 11:69434493-69434515 TGGGGAGGCGTGGGTCCTGTCGG - Intergenic
1084790615 11:71473360-71473382 GGGGCATGGGGCTGACCTGTGGG - Exonic
1084950751 11:72664125-72664147 TGGAGATGGGGCTGCCCTGCAGG - Intronic
1085294171 11:75421298-75421320 TGGGGCTGGCTCTGTGCTGAAGG + Intronic
1088251034 11:107860926-107860948 TGGGGATGGGTGGGGACTGTGGG - Intronic
1088361409 11:108993965-108993987 TTGCGATGGCTCTGCCCTGTTGG + Intergenic
1089097072 11:115928028-115928050 TGGGGAGAGGGCTGTCCTTTGGG - Intergenic
1090484350 11:127099189-127099211 TAGGGGTGGGTCTGTCTTCTGGG - Intergenic
1090528372 11:127562270-127562292 TGGGGAGTGACCTGTCCTGTTGG + Intergenic
1090632399 11:128661302-128661324 TGGGGATGGGCTGGACCTGTGGG + Intergenic
1090669105 11:128933794-128933816 TGGGGCTGGGTCTGTCATGAAGG - Intergenic
1092260870 12:6952662-6952684 TGGGGATGGGTCTGTCCTGTGGG + Intronic
1093690165 12:22101464-22101486 CTAGGATGGGTCTGTGCTGTGGG + Intronic
1097493371 12:60297334-60297356 TGGAAATGGGACTGTCCTGAGGG + Intergenic
1098445747 12:70564064-70564086 TGGGTGTGTGTCTGACCTGTTGG - Intronic
1098605784 12:72388108-72388130 TTGGAATGGGTTTGGCCTGTTGG - Intronic
1100312020 12:93404836-93404858 TGGGGTGGGGTTTGGCCTGTAGG - Exonic
1102225277 12:111224155-111224177 GGGGGAATGGTCTGTCCTCTCGG - Intronic
1103847415 12:123911262-123911284 TGGTGGGGGGTCTGTCCTGGGGG + Intronic
1103847539 12:123911546-123911568 CTGGGAGGGGTCTGTCCTGGGGG + Intronic
1103847563 12:123911594-123911616 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103847600 12:123911671-123911693 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103847629 12:123911732-123911754 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103847649 12:123911777-123911799 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103847664 12:123911808-123911830 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103847743 12:123911987-123912009 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103847779 12:123912063-123912085 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103847794 12:123912094-123912116 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103847964 12:123912474-123912496 TGGGGGGGGGTCTGTCCTGGGGG + Intronic
1103914682 12:124370139-124370161 TGTGGCTGGGTCTGCCCTGGAGG - Intronic
1103995589 12:124827941-124827963 TGGCGATGTGTCTGTCCTCAGGG + Intronic
1104876274 12:132037151-132037173 TGGGGGTCCGTCTGTCCAGTGGG + Intronic
1105796447 13:23858753-23858775 AGGGGAAGGGTTTGTACTGTGGG + Intronic
1106125588 13:26897894-26897916 TGGGGCTGGGCCTGGGCTGTGGG + Intergenic
1108139850 13:47408887-47408909 TGGGGCTGAGTCTGTGTTGTTGG - Intergenic
1108829853 13:54464209-54464231 TGTGGATGGGTCTGACCGGAGGG + Intergenic
1111622552 13:90743286-90743308 GGTGGATGGGGCTGTTCTGTTGG - Intergenic
1113851504 13:113421064-113421086 TGGGGATAGGCATGTCCTGGGGG - Intergenic
1113851516 13:113421098-113421120 TGGGGATAGGCATGTCCTGGGGG - Intergenic
1113908255 13:113830289-113830311 TGGGGAAGGGCCTGTCTTGGTGG + Intronic
1114565005 14:23624149-23624171 TGGAGATGGGACTGTCCTGAAGG + Intergenic
1117512822 14:56470914-56470936 TGGGGATGGGGATGACATGTGGG + Intergenic
1117534187 14:56688351-56688373 TGGGGCTGGAGCTGTCCTGCAGG - Intronic
1119484853 14:74980706-74980728 TGGGGATGGGGGTGGGCTGTGGG - Intergenic
1120201303 14:81540815-81540837 TGTGAATGGTTCTGTCTTGTTGG - Intergenic
1120858653 14:89234868-89234890 TGGGGATGGGGCAGCCCTGCTGG - Intronic
1121020882 14:90579328-90579350 TGAGGAAGGGTCTGGCCTGCAGG - Intronic
1121334752 14:93070423-93070445 TGGGGCTGGGGCTCTCCTGTGGG - Intronic
1122122399 14:99561492-99561514 TGGGGGAGGGACTGCCCTGTAGG - Intronic
1122234406 14:100323677-100323699 TGGGGATGGGGCTGTGGTCTAGG + Intronic
1122597544 14:102903728-102903750 TGCGCTTGGGCCTGTCCTGTGGG - Intronic
1123461795 15:20479374-20479396 GTGGGCTGGGTTTGTCCTGTGGG - Intergenic
1123656261 15:22521008-22521030 GTGGGCTGGGTTTGTCCTGTGGG + Intergenic
1124272479 15:28295357-28295379 GTGGGCTGGGTTTGTCCTGTGGG - Intronic
1124310172 15:28616184-28616206 GTGGGCTGGGTTTGTCCTGTGGG + Intergenic
1124813577 15:32966134-32966156 TGGGGATGGGGCTGAGCAGTTGG - Intronic
1127263581 15:57343795-57343817 AGGGGATGGGGCAGGCCTGTAGG + Intergenic
1128260335 15:66228619-66228641 AGGAGATGGTTCTGTCGTGTGGG - Intronic
1128336599 15:66790207-66790229 TGGCACTGGGTCTGTCCTGGTGG + Intergenic
1129229966 15:74191625-74191647 TGTGGATGGGGCTGACCTGTGGG + Intronic
1130125797 15:81093317-81093339 AGGGGATAGATCTGTCCTGCAGG + Intronic
1130980256 15:88807495-88807517 CAGGGATGGCTGTGTCCTGTTGG - Intronic
1131002631 15:88950902-88950924 TCAGCATGGGCCTGTCCTGTGGG - Intergenic
1132828791 16:1917771-1917793 TGGGGTTGGGACCGCCCTGTGGG - Intronic
1133152042 16:3841250-3841272 TGGGGATGCTTATGTCCTCTTGG - Intronic
1135791594 16:25401549-25401571 TGGGGATGGGTCAATCTTATTGG + Intergenic
1135948794 16:26892614-26892636 TAGAGATGGGTTTGTCGTGTTGG + Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138353172 16:56357562-56357584 AGGGGATGGGAAGGTCCTGTGGG - Intergenic
1139110759 16:63887751-63887773 TGAGGATGGGTCTGTAGTTTGGG - Intergenic
1139659193 16:68409381-68409403 TCGGGCTGGGTCTGTGTTGTGGG + Intronic
1141509090 16:84501149-84501171 TGGGGATGGGTGTGGCCTGGGGG + Intronic
1141967160 16:87453262-87453284 TGTGGAAGGGTTGGTCCTGTAGG - Intronic
1142304453 16:89277806-89277828 TGAGGCTGGGTCTGTGCTGCTGG - Intronic
1142416600 16:89946742-89946764 TGGGGGTGGGCCTGGCTTGTTGG + Intergenic
1142416619 16:89946794-89946816 TGGGGGTGGGCCTGGCCTGTTGG + Intergenic
1143253827 17:5541365-5541387 GGGGGATGGCTCTGTCCCCTCGG + Intronic
1143718968 17:8797227-8797249 AGAGGATGGGTCTGTGCTGAAGG - Exonic
1144829238 17:18122302-18122324 TGGGGATGGGTGTGTACTCGTGG - Exonic
1145991451 17:29081547-29081569 TGAGGAAGGGTGTGTCCTGGAGG + Intronic
1146461153 17:33046930-33046952 CGGGGTTGGTTCTGCCCTGTGGG - Intronic
1146657836 17:34645484-34645506 TGTGGAAGGGTCTGTCAGGTGGG - Intergenic
1147628271 17:41913955-41913977 TGGGAGTGGGTCTGCCCTGCTGG - Intronic
1147722913 17:42549840-42549862 TGGGGATCGCTCAGTCCTCTGGG - Exonic
1147724125 17:42556067-42556089 TGGGGATCGCTCAGTCCTCTGGG - Intergenic
1147922871 17:43929078-43929100 TGGGGAGGGGTCTGGGCAGTAGG + Intergenic
1148213486 17:45821725-45821747 TGGGCATGGGACTGTCCTGGGGG + Intronic
1151146446 17:72046136-72046158 TGGGTATTGGTCTTTCCCGTGGG - Intergenic
1152583819 17:81180402-81180424 TGGGGCGGGGCCTGTCCTGAGGG + Intergenic
1152734999 17:81992903-81992925 TGGGGAAGGGGCTCCCCTGTAGG + Intronic
1154165563 18:12011814-12011836 TGGGACTGGGTCTGGCCTTTGGG + Intronic
1156498113 18:37539083-37539105 TGGAGAAGAGTCTGTCATGTCGG - Intronic
1157320028 18:46627288-46627310 TGGGGCTGGGTCTCTGCTGGTGG - Intronic
1160243234 18:77137519-77137541 AGGGGGTGGGTCTCTCCTGTGGG - Intergenic
1161494246 19:4579015-4579037 TGGGCGTGGCCCTGTCCTGTGGG - Intergenic
1162721650 19:12666455-12666477 TGTGGGTGGGTCTGTCCTGTGGG - Intronic
1162807283 19:13144542-13144564 AGGGGAGGGGTCAGTCCTGGTGG - Intronic
1162809708 19:13156283-13156305 TGGGGATGGGTGTGTCTTAAGGG - Intergenic
1163822085 19:19501876-19501898 AGGGGACGGGCCTGTCCTGTGGG + Intronic
1166768438 19:45266018-45266040 TGGGCATGGGGGTGTCCTGGGGG + Intronic
1166882688 19:45939127-45939149 TGGGATTGGGCCAGTCCTGTGGG - Exonic
1167251146 19:48398951-48398973 GGGGGCGGGGACTGTCCTGTGGG + Intronic
1167557141 19:50203597-50203619 TGGGGGCGGGGCTGTCCTGGCGG + Intronic
925445480 2:3923552-3923574 TGGGGGGGGGTCTTTGCTGTAGG + Intergenic
928435794 2:31253723-31253745 TGGGGCGGGGTGTGTCTTGTGGG + Intronic
928528086 2:32162731-32162753 TGAGGATGGGACTGTCATGATGG - Intergenic
931089787 2:58873387-58873409 TGGTGATAGGCCTGTGCTGTAGG + Intergenic
931431998 2:62215730-62215752 TGAGGATTTGTGTGTCCTGTTGG + Intronic
931578032 2:63740823-63740845 TGGGCATGGCTCTGGGCTGTAGG - Intronic
931873341 2:66484883-66484905 TGGTGATGACTCTGTTCTGTTGG + Intronic
936286169 2:111182990-111183012 TGGGGCTGGGCCTGGCCAGTTGG - Intergenic
937450422 2:121998107-121998129 TGCGGGTGGGTTTGTGCTGTGGG + Intergenic
938091188 2:128435860-128435882 TAGGTAAAGGTCTGTCCTGTAGG + Intergenic
938149709 2:128871557-128871579 TTGGGATGGGGGTGTCCTGAGGG + Intergenic
938371232 2:130769631-130769653 TGGGGTTTGGTCTGGTCTGTTGG + Intergenic
939323316 2:140653026-140653048 TTGGTCTGGGTCTTTCCTGTTGG - Intronic
939878496 2:147603944-147603966 TGGGGATGGGGAGGTCCTGTGGG + Intergenic
940238646 2:151539123-151539145 TAGGGATGGTGCTGTCCAGTGGG + Intronic
942792672 2:179778507-179778529 GATGGATGGGTCTGTCTTGTAGG - Intronic
943018556 2:182545249-182545271 AGGGGATGGGATTGTCCAGTGGG - Intergenic
943128997 2:183833720-183833742 TGGGAATGGGACTGTTCTCTGGG - Intergenic
944878436 2:203986622-203986644 TAGAGATGGGTGTTTCCTGTAGG + Intergenic
946371874 2:219286032-219286054 GGGGGAAGGCGCTGTCCTGTTGG - Exonic
948048030 2:234958436-234958458 TGGGGAAGGGTCTGTCCTGCTGG + Intronic
948429930 2:237912652-237912674 TTTGGATGGGGCTGTCCTGTGGG - Intergenic
948613801 2:239185424-239185446 TGGGGAAAGGTGTGCCCTGTGGG + Intronic
1168836236 20:879681-879703 TGGGGCTGGGGCTGGGCTGTTGG - Intronic
1169689297 20:8312291-8312313 TGGGAATGGGATAGTCCTGTAGG - Intronic
1171032733 20:21691754-21691776 TGGGGAGGGGGCTGTGATGTTGG + Intergenic
1172195991 20:33091971-33091993 TGGGGAAGGGAATATCCTGTGGG + Intronic
1175776905 20:61659432-61659454 TGGGGAGGGGTCTGCTCAGTGGG + Intronic
1177007882 21:15696566-15696588 TGGGGATATGTATGTACTGTGGG - Intergenic
1178503918 21:33148031-33148053 TGGGGATGTGGCTGTCCCTTTGG - Intergenic
1180093715 21:45544787-45544809 TGGGGATGGGGCACTGCTGTGGG - Intergenic
1180187582 21:46147090-46147112 TGGAGCTGGGTCTGCCCTGGGGG + Intronic
1180192705 21:46173733-46173755 TGGGGATGGGGGGCTCCTGTTGG - Intronic
1181668322 22:24413429-24413451 TGGGGCTTGGACTGGCCTGTGGG - Intronic
1182070671 22:27461557-27461579 TGGGGATGGGTGTACTCTGTAGG + Intergenic
1182288799 22:29263785-29263807 TGGGGATGTGTGGGTTCTGTGGG - Intronic
1182836660 22:33347681-33347703 TGGAGCTGGGTCTGGCTTGTAGG - Intronic
1183076713 22:35431927-35431949 TGGTGATGGGCCTGATCTGTCGG + Intergenic
1184246426 22:43237996-43238018 TGGGGCTCCGTCTGTCCTTTGGG + Intronic
1185236144 22:49714434-49714456 ACGGGATGGCTCAGTCCTGTAGG - Intergenic
1185362227 22:50415116-50415138 TGTGGATGCGTCTGTTCTGATGG + Intronic
949216824 3:1580949-1580971 TGGGGAGGGTTGTTTCCTGTGGG - Intergenic
950018678 3:9770822-9770844 TGGGGATGGGGCTGAACTGGGGG + Intronic
952324751 3:32311130-32311152 ATGGGCTGGGTCTGGCCTGTAGG - Intronic
952943557 3:38460721-38460743 TCTGGATGGGTCTGACCTGCTGG + Intronic
954157367 3:48693936-48693958 TGAGGATGGGGCTGTCAGGTGGG + Intronic
957845328 3:85725614-85725636 TGAGTAAGGGACTGTCCTGTAGG + Intronic
958750698 3:98191327-98191349 TAGGGATGGGGCTGTTTTGTAGG - Intronic
961190811 3:124959773-124959795 TGAGGATGTTTCTGTCCTGCTGG + Intergenic
961236673 3:125374088-125374110 TGAGAAAGGGTCTGGCCTGTGGG - Intronic
962794025 3:138835178-138835200 GGGTGATGGGTCTCTCCTGAAGG - Intergenic
966288060 3:178320981-178321003 AGGGGAAGGGACAGTCCTGTGGG - Intergenic
966852405 3:184172109-184172131 TGGGGGTGGGAATGGCCTGTCGG - Exonic
968281021 3:197476715-197476737 TGGGGAGGGGGATGTGCTGTGGG + Intergenic
968519877 4:1030425-1030447 TGGGGAAGGGGCTCTCCTGGGGG + Intergenic
969153050 4:5186716-5186738 TGGGGATGGGTATGTCGAGGAGG - Intronic
969337342 4:6519434-6519456 TAGGCATGGGCCTGTCCCGTGGG - Intronic
969720349 4:8890106-8890128 TGGGGATGACCCTGTCCTCTTGG - Intergenic
969738667 4:9008548-9008570 GGGGGCTGGTTCTGGCCTGTGGG - Intergenic
969797850 4:9540091-9540113 GGGGGCTGGTTCTGGCCTGTGGG - Intergenic
977051210 4:92129886-92129908 TGGGGATGGGACTGCCAAGTGGG - Intergenic
979518825 4:121642644-121642666 TGATGATGGGTGTGTCCTGCAGG + Intergenic
981815238 4:148823540-148823562 TGTGGATGTGTCTGACATGTTGG + Intergenic
982113531 4:152077730-152077752 TGGGGCTTGGTCTTTGCTGTGGG - Intergenic
987203243 5:15598806-15598828 TGAGGATGGGTCTGTGTTGATGG + Intronic
988116967 5:26906838-26906860 TGGGGATGGGGGTTTCATGTAGG - Exonic
990181710 5:53167930-53167952 TGGGGAAGTCTCTGTCTTGTGGG + Intergenic
990616411 5:57513034-57513056 TGTGTCTGGGGCTGTCCTGTTGG + Intergenic
996978189 5:129460023-129460045 TGGCTGTGGGTCTGTCTTGTGGG + Intergenic
997601994 5:135146657-135146679 TGGGCATGGGTGGGGCCTGTTGG + Intronic
997668795 5:135653687-135653709 TGGAGATTGGTCTGTCTTATGGG - Intergenic
998397735 5:141829951-141829973 TGGGGGTGGGGTTGTCCTTTAGG - Intergenic
998879112 5:146629128-146629150 TGGGGAGAGGTCTGAGCTGTAGG - Intronic
999357103 5:150946043-150946065 TGGGGATGGATGTGTTCTGTGGG - Intergenic
1000310824 5:160042933-160042955 TGGGGATGGCTCTGATCTGAAGG - Intronic
1000416425 5:160988517-160988539 TGAAGAGGGGACTGTCCTGTGGG + Intergenic
1001048548 5:168395220-168395242 TGGACATGGGTCTGTACTGTGGG - Intronic
1001218572 5:169878933-169878955 TGGTGTTGGGTCTGTGCTCTTGG + Intronic
1001930738 5:175671096-175671118 TGGGGATGGGGCAGTGCTTTGGG + Intronic
1002261630 5:177997234-177997256 TGGGAATCAGACTGTCCTGTGGG - Intergenic
1002897103 6:1385618-1385640 TGCGGATGCGTCTCTCCTGTCGG + Intergenic
1003308464 6:4948676-4948698 TGGTGTGGGGGCTGTCCTGTGGG - Intronic
1005999646 6:30955346-30955368 AGGGGAGGGGTCTGTCCGGTTGG - Intergenic
1006486529 6:34347429-34347451 TATGGATGGGTGTGTTCTGTGGG - Intronic
1011309818 6:85969622-85969644 TGGGGATGAGCCTGTCATGAAGG - Intergenic
1013369389 6:109456056-109456078 TCTGGGTGGGTCTGGCCTGTTGG + Intergenic
1013386417 6:109636172-109636194 TGGGCATGGGTTTGTGCAGTAGG - Intronic
1013961828 6:115910284-115910306 TGTGGAAGGGGCTGTCCTGGAGG - Intergenic
1016699058 6:147033509-147033531 TGGGGATGTGTTTTTCTTGTGGG - Intergenic
1018327795 6:162692558-162692580 TTGGGGGGGGTCTGTCTTGTAGG - Intronic
1019331930 7:464577-464599 TGGGGATGGGCCCCTCCTGGTGG - Intergenic
1020112506 7:5455542-5455564 AGGGGATGGCACTGTCCTGTGGG - Intronic
1022815790 7:33913000-33913022 TGGGCAAGAATCTGTCCTGTTGG - Intronic
1024059706 7:45688855-45688877 TGGGGATGGGTTTCTCTTGAGGG - Intronic
1024131178 7:46354526-46354548 TGGGGATGTGTCTCTCCCTTTGG - Intergenic
1026539538 7:71268189-71268211 TGGGGAGGAGTCCCTCCTGTTGG - Intronic
1027134092 7:75611984-75612006 TGGGCCTGGGCCTGGCCTGTGGG + Intronic
1028492371 7:91426254-91426276 AAGGGATGGGTCAGTCCTGTTGG - Intergenic
1029434595 7:100555603-100555625 TGGGAAGGTGTCTGGCCTGTAGG - Exonic
1032009902 7:128338448-128338470 TGGGGAAGGGCCTGACCTGCTGG - Intronic
1033262820 7:139858296-139858318 TGGGGATGGGTCCTTCTTGGAGG + Intronic
1034056663 7:148042470-148042492 CAGGGCTGGGTCTGTCCTTTAGG - Intronic
1034233523 7:149551020-149551042 TGGGGAGGGGGCTCTGCTGTTGG + Intergenic
1034429282 7:151033131-151033153 TGGGGCTGTGTCTGCCCTGGTGG + Intronic
1035048433 7:155984146-155984168 TGGGGCTGGTTCTGTCCTATGGG - Intergenic
1036257053 8:7214227-7214249 GGGGGCTGGTTCTGGCCTGTGGG + Intergenic
1036309103 8:7672826-7672848 GGGGGCTGGTTCTGGCCTGTGGG + Intergenic
1036360432 8:8073293-8073315 GGGGGCTGGTTCTGGCCTGTGGG - Intergenic
1036701010 8:11013934-11013956 TGGATTTGGGTCTGTCCTGCGGG - Intronic
1036815202 8:11897227-11897249 TGGGGAGGGAACTGGCCTGTGGG - Intergenic
1036890538 8:12593674-12593696 GGGGGCTGGTTCTGGCCTGTGGG + Intergenic
1037735209 8:21560367-21560389 AGGAGATGGGGCTGGCCTGTGGG + Intergenic
1038790608 8:30664858-30664880 TGGTGAAGGGTATGTCCTCTGGG + Intergenic
1038811803 8:30854508-30854530 TGGGGATGGGTTTTTCCTTGTGG - Intronic
1039470162 8:37808379-37808401 TGAGGAGGCGTCTGTCTTGTGGG + Intronic
1039546099 8:38412642-38412664 TGGGGCTAGGTCTGTCCCGAGGG - Exonic
1040292234 8:46131407-46131429 TTGGGATGGGAGTGTCCTCTTGG + Intergenic
1042791789 8:72615625-72615647 TGGGGATGGGTGTGTTTTGGGGG + Intronic
1044517553 8:93156729-93156751 TGGGGAGGAGTCTGGCCTCTTGG + Intronic
1049330826 8:142049708-142049730 TGGTGATGGGGATGTTCTGTGGG - Intergenic
1049330854 8:142049858-142049880 TGGTGATGGGGATGTCCTGTGGG - Intergenic
1049415451 8:142492876-142492898 TGGGGAGGGGCCTGTGCTGGTGG - Intronic
1049488511 8:142878862-142878884 TGGGGTCGTGTCTGCCCTGTGGG - Intronic
1049692715 8:143969670-143969692 TGGGCAGGGGCCTGTCCTGGGGG + Intronic
1049732705 8:144186664-144186686 AGGGGCTGGCTCTGTCCTGACGG + Intronic
1052360931 9:27556246-27556268 TGGGGCTGGGGCTGTCTGGTTGG + Intronic
1054864110 9:69982290-69982312 GGGGGAAGGGCCTGTGCTGTAGG + Intergenic
1056393857 9:86163780-86163802 AGGGAATGAGTCTGTCCTTTGGG - Intergenic
1057249746 9:93491192-93491214 TGGGGTTGGGTCAGTGGTGTGGG - Intronic
1057599752 9:96447926-96447948 TGGGCATGGGAGTTTCCTGTGGG - Intergenic
1057773329 9:97984994-97985016 TGGGCGTGGGTCCGACCTGTGGG + Intronic
1059251376 9:112890456-112890478 TGGAGATGGCTCTCTGCTGTTGG + Exonic
1060089691 9:120732089-120732111 CTGGGATGGGTGTTTCCTGTTGG - Intergenic
1060722148 9:125986472-125986494 TGGGTCTGGCTCTGTCCTGCAGG + Intergenic
1061988289 9:134143139-134143161 TGGGGATGGCCCAGTCCTGGTGG + Intronic
1062047773 9:134432374-134432396 TGGGGATGGGTCAGGCCTGCCGG + Intronic
1062192305 9:135254308-135254330 AGGTGCTGGGGCTGTCCTGTGGG - Intergenic
1062244634 9:135559157-135559179 TGGGGGTGGTGGTGTCCTGTAGG - Intergenic
1062245577 9:135564305-135564327 TGGGGGTGGTGGTGTCCTGTAGG - Exonic
1062383193 9:136297604-136297626 TGGGGCTGGGGCTGGCCAGTCGG - Intronic
1062646558 9:137551111-137551133 AGGGGATGGATCTGGGCTGTGGG + Intergenic
1188617769 X:32179739-32179761 CGGGGATGGTTCTGTGCTGAGGG + Intronic
1188869674 X:35358912-35358934 GGGGGATGGGTGGGACCTGTGGG + Intergenic
1191738885 X:64416698-64416720 TGGGGGTGGGTGGGACCTGTGGG + Intergenic
1193586878 X:83333465-83333487 TGGGGATGACTTTGTCCTCTAGG - Intergenic
1194838895 X:98714796-98714818 GGGGGATGGGTCAGACCAGTGGG + Intergenic
1196887906 X:120264766-120264788 TGGGGGTGGGTCTGTGCTTCAGG + Intronic
1197481819 X:126995711-126995733 AGGGGATTGCTCTGTCCTGAAGG + Intergenic
1197684648 X:129426948-129426970 TGGGGATAGGTTTGTCAGGTGGG + Intergenic
1197754503 X:129984310-129984332 TGGGGAGGGGGCCGTCCTGGGGG + Intronic