ID: 1092260903

View in Genome Browser
Species Human (GRCh38)
Location 12:6952832-6952854
Sequence CAGCCCCCAGCCCATGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 400}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092260903_1092260908 8 Left 1092260903 12:6952832-6952854 CCAAAGGCATGGGCTGGGGGCTG 0: 1
1: 0
2: 1
3: 40
4: 400
Right 1092260908 12:6952863-6952885 GAATGCTCCTCATGACACCATGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092260903 Original CRISPR CAGCCCCCAGCCCATGCCTT TGG (reversed) Intronic
900098820 1:952327-952349 GAGGCCCCAGGCCCTGCCTTGGG + Intronic
900572467 1:3365326-3365348 CAGCCCCCAGCCCAGGGGTGGGG - Intronic
900694642 1:4002259-4002281 CAGCCCCCAGGACATGCGTCTGG + Intergenic
900947323 1:5838456-5838478 CAGCCCCCGGCCCAAGCGCTCGG + Intergenic
900980322 1:6042614-6042636 CAGCAGCCTCCCCATGCCTTGGG + Intronic
901321970 1:8345580-8345602 CAGCCCCTAGTCCCTGCCTGTGG - Intergenic
902105607 1:14033381-14033403 CAGCCCCCATGCCATGACTGTGG - Intergenic
902662759 1:17916840-17916862 CAGCCCCCAGCCCTTACCCGGGG - Intergenic
903799334 1:25954935-25954957 CTGCCCCCAGCTCCTCCCTTTGG + Intergenic
903827935 1:26158740-26158762 GAGCCCCCACCCCAGGCCTTTGG + Intergenic
903907502 1:26696833-26696855 CCGCCCCCAGCCTACGGCTTCGG + Exonic
903962698 1:27066775-27066797 CAAGCCCCATCCCATGCCCTGGG - Intergenic
904586717 1:31584807-31584829 CAGGCGCCAGCCCTTGCCCTTGG - Intronic
904905688 1:33895744-33895766 CAGCCTGCATCCCATGCCTAGGG - Intronic
905315279 1:37078934-37078956 CAGCTCCCAGGCCAGGCATTAGG - Intergenic
906491751 1:46273960-46273982 TAGCTCCCTGCCCCTGCCTTTGG + Intronic
906532944 1:46533759-46533781 CAGCCCCCTGCCTCTGCCTCTGG + Intergenic
908414594 1:63900565-63900587 CTGCCCCCATCCCATGGATTAGG + Intronic
908480529 1:64534864-64534886 CAGCCCCCTGGCCTTGCCCTTGG + Intronic
909391370 1:75125501-75125523 CAGGCGCCAGCCCAGGCCTCCGG + Intergenic
911264245 1:95724823-95724845 TAATCCCCAGCTCATGCCTTTGG - Intergenic
912551688 1:110489308-110489330 CAGCCCTCAGCCCCTTCCCTGGG - Intergenic
914797263 1:150930824-150930846 CTGCACCCAGCCAATTCCTTAGG + Intronic
915294483 1:154910459-154910481 CAAAACCCAGCCCTTGCCTTTGG - Intergenic
919814592 1:201429562-201429584 CAGGCACCAACCCAGGCCTTGGG + Intronic
920367488 1:205455763-205455785 CCGCATCCCGCCCATGCCTTAGG + Intronic
920505478 1:206512671-206512693 CAGCCCCCAGCCCAGTCCCAAGG + Intronic
920695674 1:208179870-208179892 CACCCCCCAACCCCTGCCTAAGG + Intronic
920770966 1:208884835-208884857 GACCCTCCAGGCCATGCCTTTGG - Intergenic
922724305 1:227915329-227915351 CAGGCCACAGCCCCTGCATTGGG - Intergenic
924651817 1:245935867-245935889 CTCTCCCCAGCCCATGCCTCTGG - Intronic
924774329 1:247105200-247105222 CTGACCCCAGCCCATGCCAGAGG - Intergenic
1062928746 10:1338681-1338703 CAGCTCACAGCCCCAGCCTTAGG + Intronic
1063216771 10:3932384-3932406 CTGCCCCCAGCCCTTGCCACAGG - Intergenic
1063363966 10:5478748-5478770 CAGCCCCCAACCCATGCCAGAGG - Intergenic
1063609756 10:7552559-7552581 CAGCCCTCAGGCTATGACTTAGG - Intergenic
1063825322 10:9890966-9890988 CAGCACCTAGGCCAAGCCTTGGG + Intergenic
1064228640 10:13509429-13509451 CAGGCACCAGCCCTTGCCTCTGG - Intronic
1064371104 10:14752148-14752170 CTGGCCACAGCCCATGGCTTAGG - Intronic
1065634408 10:27715849-27715871 CAGCCCCCAGCCCATCCCATAGG - Intronic
1066321143 10:34305260-34305282 CAGGGCCCAGCCCATACCTGGGG - Intronic
1067853641 10:49771144-49771166 CAGCCCCCAGCTCAGGTCTCCGG - Intergenic
1069544152 10:69317354-69317376 CAGTCCCCACCCCCTGCCTTAGG - Intronic
1069639135 10:69943776-69943798 CAGCCCCCGGCCCCTGCCCCGGG + Intronic
1071805180 10:89111722-89111744 CACCCCCCACCCCCAGCCTTTGG + Intergenic
1072164580 10:92800731-92800753 CAGTCCCAAGCCCATTCCTATGG + Intergenic
1072518491 10:96209935-96209957 CAGCCCCCGGCTCAGGACTTGGG - Intronic
1073321992 10:102621163-102621185 GAATCCCCAGCCCATGCCCTGGG + Intronic
1073357584 10:102869622-102869644 CAGCCCCCAGCCCCTTCCCTGGG + Intronic
1075125145 10:119693475-119693497 GAGCACACAGGCCATGCCTTGGG - Intergenic
1075298353 10:121297865-121297887 CACCTCACAGCCCATGCCTATGG - Intergenic
1075349237 10:121709075-121709097 CAGCCCCCAGCCCCGGTGTTTGG - Intergenic
1075384950 10:122048693-122048715 CTGCTCCCAGGCCATGCATTTGG + Intronic
1076183631 10:128430202-128430224 CAGACCCCAGCCCATTTCTCAGG + Intergenic
1076411961 10:130258059-130258081 CAGGCCCCAACCCTTGGCTTGGG - Intergenic
1076572896 10:131444138-131444160 GAGCCCCCAGCCTGTCCCTTGGG - Intergenic
1076584642 10:131537257-131537279 CAGCCCCCACCCCCAGCCTCTGG + Intergenic
1076606716 10:131694330-131694352 CAGCCCCACGCCCAGGCCTGGGG + Intergenic
1076686168 10:132199394-132199416 CACCCCCCCGCCCAGGCCTGAGG - Intronic
1076847195 10:133075136-133075158 CAGGCCCCAGCCCTGGCCTGTGG + Intronic
1077011747 11:381826-381848 CAGCCCCCAGCAGCTGCCTCGGG - Exonic
1077021103 11:417490-417512 CAGCCTCCAGCGCCAGCCTTGGG - Intergenic
1077177317 11:1196728-1196750 CACCCCCCAGCCCCGGCCTGGGG - Intronic
1077241431 11:1512694-1512716 CAGTTTCCAGCACATGCCTTTGG - Intergenic
1077350882 11:2092699-2092721 CCGGTCCCAGCCCCTGCCTTGGG + Intergenic
1077408624 11:2393447-2393469 CAGCCCTCAGCCCAGGGCCTAGG + Intronic
1078005990 11:7532664-7532686 TACCCTCCAGCCCAGGCCTTCGG + Intronic
1078106032 11:8358438-8358460 CAGACCTCAGCCCCTGCCCTTGG - Intergenic
1078327064 11:10389426-10389448 CAGCCCCAATCCCATTCCATGGG + Intronic
1078839234 11:15062866-15062888 CAGCACCCAGCTCCTGCCTGGGG - Intronic
1080011288 11:27462121-27462143 CAGCCCCCAGCCACTGAGTTAGG + Intronic
1082077028 11:47981845-47981867 GAGCACCCAGCCCGTGCCATGGG + Intronic
1082159939 11:48880080-48880102 AAGCCCCCCGCCCACGCCTCAGG + Intergenic
1082238577 11:49850544-49850566 CGGCCCCCCGCCCACGCCTCCGG + Intergenic
1082243569 11:49893786-49893808 CGGCCCCCCGCCCACGCCTCCGG - Intergenic
1083304332 11:61754804-61754826 CAGCTCCCAGCCCCTGCGATGGG + Intronic
1083356389 11:62069410-62069432 CAGCCCCCGGCCGATCCATTAGG + Intergenic
1083682770 11:64358993-64359015 GAGCCCCCAGGCCAGGCCTCAGG - Intergenic
1083752237 11:64766998-64767020 CAGCCCCCACCCCCTCCCTCTGG - Exonic
1083932316 11:65852799-65852821 CAGCCCCCAGCCCCAGCCTGGGG + Intronic
1084169580 11:67394270-67394292 CAGCCTCCTGCCCTGGCCTTGGG - Intronic
1084178885 11:67437009-67437031 CATCCCCCATCCCAGGCCTCAGG - Intronic
1084459486 11:69288445-69288467 CAGCCTCCAGCCTCTCCCTTGGG + Intergenic
1084938012 11:72597493-72597515 CAGCCCCTAGCCCTTACCTTGGG + Exonic
1085454409 11:76657579-76657601 CAGGCCTCAGCCCAGGCCTCGGG - Exonic
1085468800 11:76743610-76743632 CAGCCTCCATCCCCTGCCTCTGG + Intergenic
1085511757 11:77091716-77091738 CCACCCCCAGCTCAGGCCTTGGG + Intronic
1086143381 11:83523822-83523844 CCGCCCCCTGCCCCTGCCATTGG - Intronic
1088232680 11:107688835-107688857 CAGCCCCCAGCCTATCCCCCAGG + Intergenic
1088822158 11:113465564-113465586 CAGGCCCCTGCCTAAGCCTTTGG + Intronic
1089309877 11:117551009-117551031 CTGCCCCCAGCCCATGGCTGAGG - Intronic
1089313577 11:117575679-117575701 CACCACCCTGCCCAAGCCTTTGG - Intronic
1090474024 11:127003774-127003796 CAGCCCCCTCCCCAAGCCTCCGG + Intergenic
1090557262 11:127889930-127889952 CACCTCCCAGCACCTGCCTTTGG + Intergenic
1091437691 12:485559-485581 CAGTCGCCAGCCGAAGCCTTGGG - Intronic
1092067284 12:5601972-5601994 CAGTCACCACCCCCTGCCTTGGG - Intronic
1092247848 12:6873341-6873363 CCGCCCCCAGCTCCTCCCTTGGG + Intronic
1092260903 12:6952832-6952854 CAGCCCCCAGCCCATGCCTTTGG - Intronic
1092958445 12:13572277-13572299 AAGCCACCAGCACATTCCTTTGG - Intronic
1094045502 12:26161719-26161741 CATCCCCCACACCATGTCTTTGG - Intronic
1095654326 12:44650953-44650975 CAGTCCACGGCCCAGGCCTTGGG - Intronic
1096491370 12:52014915-52014937 CCGCCCCCGGCCCGCGCCTTCGG + Exonic
1096514706 12:52149390-52149412 AAGCCCCCAGGCCAGGCCTTAGG + Intergenic
1096550705 12:52369961-52369983 AAGCCCCCAGCCCCAGCCCTGGG - Intergenic
1096580370 12:52581085-52581107 CAGCCCCCTGCCCCAGCCTCGGG - Intergenic
1097521718 12:60678983-60679005 CAGCCCCATGCCCATACCTGGGG - Intergenic
1101417063 12:104517547-104517569 CAGACCCCAGGCCAGGCCTATGG - Intronic
1102057945 12:109910802-109910824 CAGCCACCACCACATGCCCTCGG - Intronic
1102228266 12:111244700-111244722 TTGCCCCCTGCCCCTGCCTTGGG - Intronic
1102414548 12:112749231-112749253 CAGCCCCCAGCCCAGCCCACTGG + Intronic
1102685957 12:114724816-114724838 CAGCCCATAGCAAATGCCTTTGG + Intergenic
1102699109 12:114823777-114823799 CAGGGCCCAGGCCAGGCCTTAGG + Intergenic
1102774218 12:115504850-115504872 CAGCCCCCTGCATAGGCCTTTGG + Intergenic
1103175874 12:118862621-118862643 CAGCCTCCATCCCACGCCCTTGG - Intergenic
1103189506 12:118989114-118989136 CTGCCCCCAGCCCAGGACCTAGG - Intronic
1103212093 12:119174676-119174698 CAGCCCCCAGCCCCTCCCCAGGG - Intergenic
1104599058 12:130140100-130140122 CGGCCCCCAGCACAGGCCTCAGG - Intergenic
1104781941 12:131427605-131427627 CAGCCCCCAGCTCATCTCTCAGG - Intergenic
1104880175 12:132065242-132065264 CCGCCACCTGCCCATGCCTACGG - Intronic
1104980314 12:132570565-132570587 CACCCCCCAACCCCTGCCCTGGG - Intronic
1105443982 13:20436860-20436882 CAGCCCCCAGTCCCTGCTTGGGG - Intronic
1106834119 13:33615261-33615283 CAGTCCCCAACCCTTGCCTTAGG - Intergenic
1107353593 13:39542158-39542180 CAGCCTCCCTCACATGCCTTTGG - Intronic
1107885175 13:44869080-44869102 CAGGCCACAGCCCAAGCCATAGG + Intergenic
1110680741 13:78309145-78309167 CAGCATTCACCCCATGCCTTTGG - Intergenic
1112247451 13:97747722-97747744 CAGCACCCAACCCAGGCCTCCGG + Intergenic
1112537093 13:100269990-100270012 CAGTTTCCAGCCCAGGCCTTGGG + Intronic
1112597268 13:100818892-100818914 CAGCCCTCTGGCCATGCCTGGGG - Intergenic
1113244196 13:108376733-108376755 CTGCCACCACCCCAGGCCTTTGG + Intergenic
1113848046 13:113403598-113403620 CAGCCCCCAGCCTCAGGCTTGGG + Intergenic
1117630328 14:57684291-57684313 CAGCCCCCACCCTAGGCCTCTGG + Intronic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1118760964 14:68879909-68879931 CAGCCCCCAACCCCTGCCCCAGG - Intronic
1119424659 14:74527759-74527781 CAGCCCCCTGCCCTGGGCTTTGG + Intronic
1120218932 14:81711062-81711084 CAACCCCCAGCCCCTGCAGTAGG - Intergenic
1121340800 14:93103971-93103993 GAGGCCCCAGGCCCTGCCTTGGG + Intronic
1122072052 14:99211272-99211294 CAGTCCCCAGCCCAAGCCCATGG + Intronic
1122214548 14:100194174-100194196 CAGCTCCCAGGCCATGCATCTGG + Intergenic
1122316542 14:100828686-100828708 CTGCCCCCCTCCCATGCCATAGG + Intergenic
1122976722 14:105173920-105173942 CAGACCCCAGCCCATACCCGGGG + Intronic
1124161691 15:27276107-27276129 CAGCCACCATCCCTTGCATTTGG + Intronic
1125473771 15:40030124-40030146 CACCCCCCAACCCCTGCCTGAGG + Intronic
1128744117 15:70101756-70101778 CAGCCCCCAGCCCCTTATTTGGG + Intergenic
1128982940 15:72199588-72199610 CTTCCCCCAGCCCATCCATTAGG - Exonic
1129182516 15:73886210-73886232 CAGCCCCCTTCCCATGCCTGGGG - Intronic
1129604821 15:77019733-77019755 CGGCCCTCAGCCCTTCCCTTGGG - Intronic
1129902012 15:79158366-79158388 CAGCCCTCTGCCCTGGCCTTGGG - Intergenic
1129925016 15:79356087-79356109 CAGCTCCCAGCACATGTCCTGGG + Intronic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131443601 15:92477118-92477140 CAGCCCCCACCCCATGCTGGTGG - Intronic
1132557198 16:577930-577952 CAGCCCCCAGCCTCTGCGATGGG + Intronic
1135989963 16:27212345-27212367 CAACCCACACCCCATGCCCTTGG - Intronic
1136061233 16:27728117-27728139 CAGCGCCCAGACCCTGCCATGGG - Intronic
1136395692 16:29991421-29991443 CAGCCCCCAGCCCCTGCGGCGGG + Intronic
1136408134 16:30061118-30061140 CTGACTCCAGCCCATGCCTAAGG + Intronic
1137830567 16:51539464-51539486 CAGTCACCAGCCCATGCCCTGGG + Intergenic
1138366230 16:56479900-56479922 CGGGCTCCAGCCCATGCCTGTGG + Intronic
1138511058 16:57508592-57508614 TAGCAACCAGCACATGCCTTGGG - Intergenic
1140032157 16:71347452-71347474 CAGCCCACATCCCATGCATCAGG + Intergenic
1140046595 16:71443662-71443684 GAGCCCCCAGACCACACCTTGGG - Intergenic
1140694783 16:77521914-77521936 CATCCCCCAGCCAATGACTGAGG + Intergenic
1140744021 16:77965180-77965202 CAGCTCCCGGCCCAGGGCTTTGG + Intronic
1140892334 16:79295817-79295839 CTGCCAACAGCCCCTGCCTTAGG - Intergenic
1141148761 16:81550120-81550142 GAGCACCCTGCCCATGCCCTCGG + Intronic
1141254017 16:82384197-82384219 CAGGGCCCATCCCATGCATTAGG + Intergenic
1141659754 16:85435534-85435556 CAGCCCCCAGCCCCTCCCCCAGG - Intergenic
1141880681 16:86856960-86856982 CAGTCCCCCGCCCATCCCTTTGG - Intergenic
1142280281 16:89144448-89144470 CAGCCACCAGCCCCTCCCTGTGG + Intronic
1142514039 17:415295-415317 CAGCCCTCGGCCAATGCCTTTGG - Intronic
1142631296 17:1228486-1228508 CATCCCCCAGCCCCTCCCTCCGG - Intronic
1143714956 17:8760547-8760569 CAGCCCCCACCTCAGTCCTTTGG - Intergenic
1143719416 17:8799295-8799317 CAGCCCCCAGGTCCTGCCGTTGG + Exonic
1144067066 17:11634173-11634195 GAGCTTCCAGCCCAGGCCTTGGG + Intronic
1144770721 17:17757977-17757999 GAGCTCCCAGCTCATGCCTCTGG + Intronic
1145005505 17:19335547-19335569 CACCCCCCACCCCACGCCCTCGG - Exonic
1145799053 17:27671855-27671877 CAGCCCGGAGCCCATCCCTCAGG - Intergenic
1145975144 17:28979540-28979562 CATCTCCCAGCCCTGGCCTTAGG + Intronic
1147635420 17:41960971-41960993 CAGCCCCCAGCCTGTCCCCTTGG + Intronic
1147882269 17:43661476-43661498 CAGCCCCCAGCCCCTGTCTGGGG - Exonic
1148108807 17:45132964-45132986 CACCCCCATGCCCATCCCTTCGG - Intronic
1148912551 17:50950578-50950600 CAGCCCACAGCCAGTGACTTGGG + Intergenic
1149545638 17:57501524-57501546 CTGCCCCCACCCCATCCCTGTGG + Intronic
1149691172 17:58578122-58578144 CCACCCCCATCCCATTCCTTAGG + Intronic
1151214773 17:72569881-72569903 CAGCCCCAAACCCAAGCCCTTGG - Intergenic
1151353335 17:73544280-73544302 CAGACCCCAGCCCATCCACTGGG - Intronic
1151747552 17:76019406-76019428 CAGCACCCAGGCCAGGGCTTGGG + Intronic
1152045405 17:77931706-77931728 CAGCACCCAGCCCACCCCTCAGG - Intergenic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1152589926 17:81206576-81206598 CAGCCTCCTGCCTATGCCCTTGG + Intronic
1152747322 17:82047293-82047315 CAGCCAACAGCCCAGGCCCTTGG - Intergenic
1152891181 17:82882504-82882526 CATCCCCGAGCCCATGCCCTGGG + Intronic
1152914132 17:83024212-83024234 GAGCCCCCAGCGCAGGCCTCAGG + Intronic
1153145512 18:2027334-2027356 CATCCCCCAGCCCCTGGGTTAGG + Intergenic
1153662229 18:7335075-7335097 CAGGCCCCAGCCCTGGCCTCAGG - Intergenic
1153667790 18:7381954-7381976 CACCCCCCCGCCCATGCACTGGG + Intergenic
1154488454 18:14898523-14898545 CAGTCCCCAGCCCAGGGGTTGGG + Intergenic
1155149773 18:23113724-23113746 GAGCCCCCAGGCCATGCCCATGG - Intergenic
1155150403 18:23118348-23118370 CAGCCTCCTGCCCATGCCAATGG + Intergenic
1155176108 18:23302677-23302699 CAGAGCCCAGCCCAGCCCTTTGG + Intronic
1156473209 18:37390338-37390360 CAGCCCCCAGCCTGTCACTTCGG + Intronic
1156813641 18:41282186-41282208 CAGTCACCAGTCCAGGCCTTCGG + Intergenic
1157327385 18:46678921-46678943 CTGCCCCAAGCCCAGGCCCTGGG + Intronic
1157476309 18:48025663-48025685 GAGGCCCCAGCCCATGGCTGAGG - Intergenic
1159647822 18:70940699-70940721 CAGTGCCCAGCCCATTCCTGTGG + Intergenic
1160011488 18:75109936-75109958 CAGACCCCATCCAATGCCTCAGG - Intergenic
1160412956 18:78687521-78687543 CTGCCGCCAGCCCCTGCCTGAGG + Intergenic
1161040938 19:2110482-2110504 CAGCCCCCAGCACAACCCTTGGG + Intronic
1161223982 19:3133866-3133888 CAGCCACCAGCCCACCCCTAGGG + Intergenic
1161277413 19:3426483-3426505 TAGCCCCCAGCTCCTGCCCTTGG + Intronic
1161335442 19:3710451-3710473 CTGCCCCCAGCTGATGCCTCAGG + Intronic
1161429375 19:4222618-4222640 CAGCCCCCAGCTCTGGGCTTAGG + Intronic
1161671778 19:5616127-5616149 CAGCCCCCAGAGCATGCTGTAGG - Exonic
1162325013 19:9993736-9993758 CAGCCCCCATCACCTACCTTAGG + Exonic
1162830682 19:13282401-13282423 CTGCCCGCAGCCCATGACTGAGG + Intronic
1163021346 19:14482533-14482555 CAGCATCCAGCCCAGGCCATTGG + Intronic
1163034144 19:14561900-14561922 CAGCCCGCAGCTCAGGCCTAGGG - Intronic
1163746547 19:19052190-19052212 CGGCCCCCAGCTCTTACCTTTGG - Exonic
1164721052 19:30431781-30431803 CAGCGCACAGCCCCTGCCCTGGG - Intronic
1165352485 19:35283539-35283561 CAGCCCCTTGACCATGCCTGTGG - Intronic
1165389326 19:35529359-35529381 CAGCCCCCTGCCCTTGCCCAAGG - Intergenic
1166283471 19:41809996-41810018 CAGCCCCAAGCCCTTGCCCCTGG + Exonic
1166294860 19:41883986-41884008 CCACCCCCAGCCCCTTCCTTTGG - Intronic
1166502923 19:43354380-43354402 CAGCCCCCAGCAGGTGCCTGCGG + Exonic
1166988719 19:46678011-46678033 CAGGTCCCAGCCAATGCCTTGGG + Intronic
1168155137 19:54469841-54469863 CAGCTCTCAGCCCCTGCCTCTGG + Intronic
1168351616 19:55679376-55679398 CCGGCCCCAGCCCATGTCCTTGG - Intronic
1168402274 19:56092367-56092389 CGCCCCCCAGCCCATCCCCTCGG - Intronic
1168725381 19:58578361-58578383 CAACCTCAAGCTCATGCCTTTGG - Intergenic
926636153 2:15181924-15181946 CAGCCCCCATGCAATGCCTGGGG - Intronic
928188864 2:29143067-29143089 CAGCCCCCTGCCCATTCATGGGG - Intronic
929008894 2:37421961-37421983 CAGTCCACAGCCCAGGGCTTGGG - Intergenic
930068399 2:47345400-47345422 GAGCCCCCAGCCCCTCCTTTCGG + Intronic
932470112 2:71949487-71949509 CAGCCCCCAGCTCTAGCCTGTGG - Intergenic
934588243 2:95525315-95525337 CGGCCCCCAGCCCACGCCTCCGG + Intergenic
935886982 2:107632279-107632301 CAGCCAACAGGCCATGGCTTGGG - Intergenic
937904872 2:127048227-127048249 CAGCCCCCAGCCCCGCCCTGCGG + Exonic
938014732 2:127858012-127858034 CAGCCCCGAGCCCAACCTTTAGG + Exonic
938122749 2:128645212-128645234 TTGCCCCAACCCCATGCCTTAGG - Intergenic
939262919 2:139833367-139833389 CAGCCTCCAGGCTATGCCTCAGG - Intergenic
940853218 2:158707593-158707615 CAGGCCTCAGCCCAAGGCTTGGG + Intergenic
942365304 2:175219949-175219971 CATCCCCCAACCCCAGCCTTAGG - Intergenic
942410729 2:175706913-175706935 CAGCCCCCAGTCAAATCCTTGGG + Intergenic
947565477 2:231190489-231190511 TAGCCCCCAGCCCCTGACTGTGG - Intergenic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
948383532 2:237567570-237567592 CAGCCCCCAGCCTGAGCCCTGGG + Intergenic
948601691 2:239111234-239111256 CAGTCCACAGCCCATGCCCGTGG - Intronic
948829438 2:240591008-240591030 CAGCCCCCAGCACACGCACTTGG - Exonic
948893365 2:240917431-240917453 CAGCCACCAGCCCAGGCCTGAGG + Intergenic
1170546400 20:17438763-17438785 CAGCCCACAGCCGATGACTAAGG + Intronic
1170713244 20:18810564-18810586 CGCCCCCCAGTCCAGGCCTTCGG + Intronic
1170774776 20:19365753-19365775 CTGCCCCCAGCCCATCTCTGAGG + Intronic
1171340080 20:24420668-24420690 CAGGCCCCAGCCCATGCACCTGG + Intergenic
1171424056 20:25038683-25038705 CCGCCCTCAGCACCTGCCTTGGG - Intronic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1172245366 20:33442353-33442375 CAGCCCCCAGCAGGTGCTTTGGG - Intronic
1172639554 20:36432538-36432560 CAGCCACCTGCCCCAGCCTTGGG + Exonic
1172930720 20:38584424-38584446 CAGCCCCAAACCCATCTCTTTGG - Intronic
1173862656 20:46294386-46294408 GAGGCCCCAGCCCCTTCCTTGGG - Intronic
1174373904 20:50112913-50112935 CAGCCCCCCGCCCGTGCTTCCGG + Intronic
1175062891 20:56259745-56259767 CAGGCCCCACCCCAGGCCTGTGG - Intergenic
1175182140 20:57156227-57156249 CTGCCCCCAGCCCACTCCTTGGG - Intergenic
1175374622 20:58515556-58515578 CAGCCCCCAACCCAGGCACTGGG + Intergenic
1175399943 20:58694270-58694292 CAGCCGCCACCCCATCCCTCAGG - Intronic
1175721204 20:61288513-61288535 GAGCCCCCAGCCCATGCTCAGGG - Intronic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1175841884 20:62033199-62033221 CAGCCCCCAGCGGATGGCTCTGG + Intronic
1175876092 20:62230869-62230891 CTGCCCCCTGCTCATGCCCTTGG - Intergenic
1175922289 20:62455865-62455887 CTGCCCCCAGCACCTCCCTTTGG + Intergenic
1176039626 20:63058526-63058548 CACCCCCAAGCCCCTGCCTTGGG + Intergenic
1176132575 20:63502535-63502557 CACCCCCGCGGCCATGCCTTGGG + Intergenic
1176165956 20:63673807-63673829 CAGACCCCAGGCCAAGGCTTTGG + Intronic
1176292401 21:5053022-5053044 CAGCCCCAGGCCCACCCCTTGGG - Intergenic
1178901305 21:36601210-36601232 CAGCCCCCAGCGCTGGCCTCAGG + Intergenic
1179317008 21:40252926-40252948 CAGCCCCCCGCCCCTTACTTGGG - Intronic
1179576206 21:42310050-42310072 GAGCCCCCCGACCATGCCTGGGG + Intergenic
1179595171 21:42438415-42438437 CATCTCCCAGCCCATGTCCTGGG - Intronic
1179800612 21:43810051-43810073 CAGCCCCCAGCCCACGTGGTAGG + Intergenic
1179864856 21:44210628-44210650 CAGCCCCAGGCCCACCCCTTGGG + Intergenic
1179896175 21:44364921-44364943 CAGGCCCCATCCCAGGCCTGTGG + Intronic
1179959591 21:44760606-44760628 CAGCACCCAGCTGAGGCCTTGGG - Intergenic
1180013320 21:45065526-45065548 TACCCCCCCCCCCATGCCTTAGG + Intergenic
1180042362 21:45287262-45287284 CCGCCCCCATCCCATCCCTCGGG + Intronic
1180636558 22:17266773-17266795 CAGCCCCCAGATCAAGCCTCAGG - Intergenic
1180663187 22:17486912-17486934 CAGGCCCCAGCCCAAGCCTACGG - Intronic
1181039427 22:20184847-20184869 CAGCCCCAAGTCCATGGCTGGGG - Intergenic
1181510640 22:23387243-23387265 CAGGCCACAGCCCAGGCCCTGGG + Intergenic
1181687741 22:24541287-24541309 CTGCCACCATGCCATGCCTTGGG + Intronic
1181870062 22:25891030-25891052 CACCCCCAAGGCCAAGCCTTAGG - Intronic
1182005332 22:26955070-26955092 CAGCCCAGAGCTCATGCCTCTGG - Intergenic
1183520877 22:38295407-38295429 CAGCCCCCTGCCCTTCCCTGTGG - Intronic
1183987333 22:41576698-41576720 CCACCCCCAGCCCCTTCCTTGGG - Intronic
1184095585 22:42314597-42314619 TAGCCCTCAGCCCTTGGCTTGGG - Intronic
1184366426 22:44054553-44054575 CAGCCCCCAACCCCTGCCCCTGG - Intronic
1184371615 22:44085790-44085812 CAGCCCCATGCCCAGCCCTTTGG + Intronic
1184978009 22:48076749-48076771 CAGCCCACAGCCCATCCATGTGG - Intergenic
1185037337 22:48486372-48486394 CAGGCACCTGCCCTTGCCTTCGG + Intergenic
1185227447 22:49661063-49661085 CGTCCCCCAGCCTATGCATTGGG - Intergenic
1185238031 22:49725813-49725835 GTGCACCCAGCCCATCCCTTCGG - Intergenic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
1185415189 22:50705696-50705718 CAGCCCCCACCCCATGGCTCTGG + Intergenic
949871559 3:8593736-8593758 AAGCCTCCAGGCCTTGCCTTTGG - Intergenic
950228901 3:11259106-11259128 CAGCCCCCAGCTGATGCCCCTGG + Exonic
950490503 3:13301806-13301828 CAGCCACCACCCCAGGCCTTCGG + Intergenic
950502568 3:13373572-13373594 CAAGCCCCAGCCCTTCCCTTAGG - Intronic
950706236 3:14784266-14784288 TGGCCCCCAGCTCAGGCCTTGGG + Intergenic
952373712 3:32747657-32747679 CCGAGCCCAGCCCATGCCTGTGG - Intronic
952600197 3:35070849-35070871 CAGTCCCCAGCCCAGGGGTTGGG - Intergenic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
954301339 3:49702237-49702259 CTTCCCCCAGCCCCTGCCATGGG - Intronic
954602153 3:51878224-51878246 CAACCCTCAGCCCCTGCCTCAGG + Intergenic
954608060 3:51929074-51929096 CAACCCTCAGCCCCTGCCTCAGG + Intergenic
958824366 3:99012392-99012414 AAGACCCCAGCTCATGCTTTCGG + Intergenic
958927469 3:100174362-100174384 CAGCCCCCACCCCATGCAACAGG + Intronic
961536275 3:127572926-127572948 CAGCAGCCAGCCCAGGGCTTGGG + Intergenic
961754934 3:129121871-129121893 CCGCCCCCAGCCCAACCCTCGGG + Intronic
962813729 3:138980138-138980160 CAGCCCCCACCCCAGCCCGTCGG - Intergenic
966090048 3:176122920-176122942 CAGTCTGCAGCCCATGGCTTGGG - Intergenic
966887295 3:184383675-184383697 CTTCCCACAGCCCATGCATTGGG - Intronic
968133080 3:196203567-196203589 CAGCCCGCAGCACCTGCCTCAGG - Intronic
968282708 3:197489349-197489371 CCACTCCCAGGCCATGCCTTGGG - Intergenic
968664017 4:1810890-1810912 CAGCCCCCAGCCCGGACCTCTGG - Intergenic
968877888 4:3283729-3283751 AAGTCCCCACCCCACGCCTTAGG - Intergenic
969175156 4:5393168-5393190 CAACCCCCAGTAAATGCCTTTGG + Intronic
969468095 4:7369704-7369726 CAGCCCCTCGCACATGCCTCTGG + Intronic
972368615 4:38399637-38399659 CAGTCCACAGCCCAGGGCTTGGG - Intergenic
972817015 4:42656471-42656493 CAGCCCGCCGCCCCTGCCTCCGG - Intronic
973676790 4:53271751-53271773 CTGCACCCAGCCCATCACTTTGG + Intronic
974628894 4:64457810-64457832 CAGCCCCGATCCCAGGCTTTAGG - Intergenic
974818042 4:67031503-67031525 CAGCCACCATCCCTTGCATTTGG + Intergenic
977758066 4:100697196-100697218 CTGCCCCCATCCCCTGCCTGTGG - Intronic
980033458 4:127856937-127856959 CAGCTCCCAACCCCTGCCTAGGG + Intergenic
983650927 4:170035605-170035627 AAGCCCGCAGCCCATGCTTGGGG - Intergenic
985704061 5:1390525-1390547 GAGCCCCCAGGGCCTGCCTTGGG - Intergenic
985857712 5:2443112-2443134 CAGCCCTCCGCCCATGGCGTTGG + Intergenic
986037571 5:3954785-3954807 CAGCACCCATCCCATTCCTGAGG - Intergenic
986301052 5:6478767-6478789 CAGCCCTAAGCCCTTGCCTGTGG - Intronic
986310937 5:6550769-6550791 CTGCCTCTAGCCCATGCCTGAGG + Intergenic
986674086 5:10168431-10168453 CAGCCCACAGCCTATGGCTTTGG + Intergenic
987069507 5:14322550-14322572 CAGGCCCCAGCCTATTTCTTCGG + Intronic
988842048 5:35092849-35092871 CAGCCCCCACACCTTGCCTGTGG + Intronic
990042007 5:51387601-51387623 CAGCCGCCAGCTCATCCCTGGGG + Exonic
990511581 5:56493916-56493938 CAGGCCCCATCCCAGGCCTGAGG - Intergenic
990698780 5:58452661-58452683 CTGAGCCCAGCCCATGCCTGGGG + Intergenic
995747359 5:115417854-115417876 CAGACCACAGCCCAAGGCTTTGG - Intergenic
996581582 5:125037516-125037538 CAGCCTCCAGCATAAGCCTTGGG + Intergenic
997470172 5:134113252-134113274 CACCCCCCAGCCCCAGCCTGGGG + Intergenic
997871633 5:137510868-137510890 CAGCCAACAGCCAATGCCATGGG - Intronic
998370778 5:141659672-141659694 AAGCCCCCAGCCCAGGCCTCTGG - Intronic
998521133 5:142801689-142801711 CCTCCCCCAGCCCCCGCCTTTGG + Intronic
999198411 5:149798942-149798964 CAGCACCCAGCCCCTGCTTGGGG - Intronic
1000304485 5:159983168-159983190 AAGCCACCAGCCTCTGCCTTTGG - Intergenic
1001455291 5:171855481-171855503 CTGCGACCAGCCCATTCCTTGGG + Intergenic
1001542671 5:172550400-172550422 CAGCCCTCAGCCCCAGCCTCCGG - Intergenic
1001633659 5:173194737-173194759 CAGCACCTAGCACATACCTTGGG + Intergenic
1002602662 5:180362881-180362903 CAGCACCCAGCCTAGGCATTGGG - Intergenic
1002641244 5:180631614-180631636 CAGCCACCACCTCCTGCCTTGGG + Intronic
1003890176 6:10557075-10557097 CTGCCCCCAGCTCATGCAATTGG + Intronic
1004187491 6:13433401-13433423 GAGCCACCAGCCCTGGCCTTTGG + Intronic
1004370372 6:15047248-15047270 CAGCCCCCAGCCAAAGCCGCTGG + Intergenic
1005470005 6:26153905-26153927 CCTCTCCCAGCCCATGCATTTGG + Intergenic
1005716632 6:28555422-28555444 CAGCCTCCAGCCAATGTCTCAGG + Intergenic
1006133023 6:31879996-31880018 CTGCTCGCAGCCCATGCCTGGGG - Exonic
1006447945 6:34090448-34090470 CAGAGCCCAGCCCCTCCCTTGGG - Intronic
1006924989 6:37649159-37649181 CAGCCCCCAGCGCATCGCCTCGG - Exonic
1007393961 6:41566719-41566741 CAGCCAACAGCCCTGGCCTTGGG + Intronic
1007726363 6:43918279-43918301 CAGCCACTGGCTCATGCCTTTGG - Intergenic
1007789539 6:44301182-44301204 CAGCCCCCAGCCCATGGGGAAGG - Exonic
1009823831 6:68840543-68840565 CAGCCACCAGCACAGGCCCTTGG - Intronic
1011631190 6:89326283-89326305 CAGACCTCAGCAAATGCCTTTGG - Intergenic
1013510500 6:110840364-110840386 CAGTCCCAAGTCCAGGCCTTTGG + Intronic
1013631634 6:111991620-111991642 GAGCTCCCAGCCCATCCCGTGGG - Intergenic
1016811036 6:148261645-148261667 CTGCCACCAGCCCATATCTTTGG + Intergenic
1019132696 6:169888971-169888993 GAGTTCCCAGCCCATGCCTTGGG - Intergenic
1019132722 6:169889131-169889153 GAGTTCCCAGCCCATGCCTTGGG - Intergenic
1019487453 7:1295904-1295926 CAGGCCCCTGCCCAGGCCTGGGG - Intergenic
1019624363 7:2008570-2008592 CAGCCCCCACCCCGGGCCTTGGG - Intronic
1021191204 7:17621694-17621716 CAGTCACCATACCATGCCTTTGG - Intergenic
1023055125 7:36284789-36284811 CGGGCCCCAGCCCATACCTCGGG + Exonic
1026621935 7:71957132-71957154 CAGCATCCAGACCATGTCTTCGG - Intronic
1026852929 7:73736076-73736098 CAGACCTCAGCCCAGGACTTTGG + Exonic
1027058505 7:75066948-75066970 CAACTCCCAGCCCATGGCATGGG + Intronic
1029302853 7:99598508-99598530 CCGCCCCCAGCCCCTGCCCCGGG - Intronic
1029518991 7:101048134-101048156 CTTCCCCCACCCCATGCCCTGGG + Intronic
1029557935 7:101283239-101283261 CAGCCCCTGGCCTATACCTTGGG - Intergenic
1029691235 7:102183416-102183438 CAGCACCCACCCCATTGCTTTGG + Intronic
1030536263 7:110771014-110771036 CAGTCCCCTGCCCAGGCCTTGGG - Intronic
1031575584 7:123412105-123412127 CAACCCCCATCCCAAGCCTTGGG + Intergenic
1033263055 7:139860216-139860238 CAGTACCCAGCCTCTGCCTTGGG - Intronic
1033363405 7:140653765-140653787 CAGCCACCATCACTTGCCTTTGG + Intronic
1034193642 7:149229512-149229534 CAGCCCCCAGCACAGGCCCTAGG + Intergenic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1034425628 7:151012625-151012647 CAGGGCCCAGCCCTTGCCTTTGG - Exonic
1035214779 7:157357348-157357370 CAGACTCCAGCCCATGCCACCGG - Intronic
1035270351 7:157716085-157716107 CAGCTCCCGGGCCATCCCTTTGG + Intronic
1035404478 7:158588420-158588442 CTGGCCCCAGCCCACGCCCTGGG - Intergenic
1035475237 7:159139088-159139110 CAGCCACCAGTCCTTGCTTTAGG + Intronic
1036176253 8:6541078-6541100 AAACCCCCAGGCCATGCCTAGGG - Intronic
1036610577 8:10346546-10346568 CAGCCACTAGCCCTTGCGTTCGG + Intronic
1037258413 8:16980550-16980572 CAGCCTCCCTCCCATGCCATAGG + Intergenic
1037821960 8:22139368-22139390 CAGCCCCCATCCCACCCCTAAGG - Intronic
1037994012 8:23339860-23339882 CAGCCCCCAGCCCCTCACATGGG - Intronic
1038547397 8:28436032-28436054 CAGCCCCCAACCTATGCTTTAGG - Intronic
1039885252 8:41650619-41650641 CAGGGCCTGGCCCATGCCTTAGG - Intronic
1043116928 8:76268290-76268312 CTTCCCCTAGCCTATGCCTTTGG - Intergenic
1044730547 8:95225567-95225589 CAGCCCCCAGGCCAAGCCCCAGG - Intergenic
1049064434 8:140301802-140301824 CAGCCCCCAGCTCTCTCCTTCGG + Intronic
1049319710 8:141989581-141989603 CAGCCAGCAGCCCCTTCCTTGGG + Intergenic
1049408058 8:142460448-142460470 CTGCTCCCCGCCCAGGCCTTGGG - Intronic
1049619902 8:143593417-143593439 CAGCCACCAGCCCATGTCCTGGG + Intronic
1049861618 8:144902435-144902457 CAGCCCCCAGCCCCGCCCTGTGG - Intergenic
1053009535 9:34625307-34625329 TAGTCCCCAGCCCACCCCTTGGG + Intronic
1053200142 9:36146797-36146819 CAGCCCCACCCCCATGGCTTAGG + Intronic
1055116024 9:72606293-72606315 CAACCCCCATTCCATGCTTTTGG - Intronic
1055898130 9:81203310-81203332 CAGCCCCCAGCCTCTTCCTTTGG + Intergenic
1057190564 9:93084721-93084743 CAGCCCGCAGCATATGCCCTAGG + Exonic
1057214542 9:93220639-93220661 CAGCCCCCAGCCCCCTCCTCAGG - Intronic
1057290143 9:93801240-93801262 CCGCCCCCAGCCCCTGGCTGAGG - Intergenic
1057553993 9:96073025-96073047 CAGCCCCCAGCCCACTCCCTGGG + Intergenic
1059041777 9:110822667-110822689 CAGCACTCAGCACAGGCCTTGGG + Intergenic
1060210287 9:121706281-121706303 CCTCCCACAGCCCAAGCCTTGGG - Intronic
1060481381 9:124018445-124018467 CCGCCCCCTGCCCTTGCCTCTGG + Intronic
1060718459 9:125956607-125956629 CAGCCACCAGACCAAGCCTCTGG - Intronic
1061150615 9:128826111-128826133 CAGCCCCCACCACATGCGTCAGG - Exonic
1061409237 9:130409746-130409768 CTGCCCTCAGCCCATTACTTAGG - Intronic
1061445016 9:130632657-130632679 CAACTCCCTGCCCCTGCCTTGGG + Intronic
1061696620 9:132380583-132380605 CAGACCCAAGCCCATGCTTCAGG + Intronic
1061874572 9:133537327-133537349 CTGCCCCCACCCCATGCCCGAGG - Intronic
1062037983 9:134391149-134391171 CAGGCCCCAGGACATGCCTGGGG + Intronic
1062134782 9:134919577-134919599 CAACCCCAAACCCATACCTTTGG - Intergenic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1185778903 X:2829119-2829141 CAGCCCCCAGCCTCGGCCTCTGG - Intronic
1186438905 X:9567765-9567787 TTGCCCCCATCCCTTGCCTTTGG + Intronic
1189480222 X:41386778-41386800 CAGCCCCCACCGCATGCCTGGGG + Intergenic
1194757030 X:97749646-97749668 CAGGCCCCAGCCCCTGCATGTGG + Intergenic
1196791273 X:119467591-119467613 CCACCCCCAGCCCAGTCCTTTGG + Intergenic
1196940636 X:120772501-120772523 CCGCCCCCAGCCTATTCATTTGG + Intergenic
1199324180 X:146477121-146477143 CAACCCCCAGTCTAGGCCTTGGG - Intergenic
1199847453 X:151701373-151701395 CAGCCCCCAGGCCAGGCCTGTGG - Exonic
1200239969 X:154488256-154488278 GAGCCCCCAGCCCATGCTGCTGG - Exonic
1201291123 Y:12421385-12421407 CAGCCCCCAGCCTCTGCCTCTGG + Intergenic