ID: 1092261254

View in Genome Browser
Species Human (GRCh38)
Location 12:6954341-6954363
Sequence CTAAGGATGAATCTCCGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092261254_1092261259 29 Left 1092261254 12:6954341-6954363 CCTTCACGGAGATTCATCCTTAG 0: 1
1: 0
2: 1
3: 10
4: 75
Right 1092261259 12:6954393-6954415 CCAGCCTTTCTGCCTTTCAGAGG 0: 1
1: 0
2: 0
3: 34
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092261254 Original CRISPR CTAAGGATGAATCTCCGTGA AGG (reversed) Intronic