ID: 1092261254

View in Genome Browser
Species Human (GRCh38)
Location 12:6954341-6954363
Sequence CTAAGGATGAATCTCCGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092261254_1092261259 29 Left 1092261254 12:6954341-6954363 CCTTCACGGAGATTCATCCTTAG 0: 1
1: 0
2: 1
3: 10
4: 75
Right 1092261259 12:6954393-6954415 CCAGCCTTTCTGCCTTTCAGAGG 0: 1
1: 0
2: 0
3: 34
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092261254 Original CRISPR CTAAGGATGAATCTCCGTGA AGG (reversed) Intronic
900378796 1:2373582-2373604 CTCAGGTGGAGTCTCCGTGAGGG - Intronic
903306660 1:22417708-22417730 CTAAGGCTGAGTCTCAGAGAAGG + Intergenic
914333909 1:146698047-146698069 CTAAGGATGGATCTTGGAGAAGG - Intergenic
917901639 1:179548659-179548681 GTAAGTATGCATCTCCTTGATGG - Intronic
921262127 1:213393926-213393948 CTGAGGATTAATCTCTGAGAAGG + Intergenic
924530957 1:244893240-244893262 CTAAGGCAGAATCACCCTGAAGG + Intergenic
1074202832 10:111254662-111254684 CTAAAGATGAATTTTGGTGATGG + Intergenic
1075022453 10:118961631-118961653 GTAGGAATGAATCTCAGTGATGG - Intergenic
1075473595 10:122713109-122713131 CCAAGGTTGAATCTCAGTCAAGG - Intergenic
1084581648 11:70027849-70027871 CTAAGGATGCGCCTCCGTGGTGG - Intergenic
1092261254 12:6954341-6954363 CTAAGGATGAATCTCCGTGAAGG - Intronic
1093175938 12:15913324-15913346 TTAAGGATTAATACCCGTGAAGG - Intronic
1102307942 12:111820572-111820594 TTAAGGAAGAATCTCCTTGCAGG + Intergenic
1104523452 12:129496825-129496847 CGGAGGATGAATCTCAGTGAGGG - Intronic
1106778794 13:33034688-33034710 CTAAAATGGAATCTCCGTGAGGG + Intronic
1107051755 13:36058185-36058207 TTAAGGATCCATCTCTGTGAAGG + Intronic
1117860513 14:60087793-60087815 ATAAGGATGAATCTCTGGGCTGG - Intergenic
1118381573 14:65221791-65221813 CTAGGGAAGAAGCTCCATGAGGG + Intergenic
1119241448 14:73063443-73063465 CTAAGTATGAAACTCCGGGCCGG - Intronic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1134485287 16:14653272-14653294 TTAAGGATGAATCACTGTGGAGG + Intronic
1137030607 16:35520477-35520499 CTAATGGAGAATCTCCTTGAAGG - Intergenic
1139999709 16:71013202-71013224 CTAAGGATGGATCTTGGAGAAGG + Intronic
1140630722 16:76848896-76848918 ATAAGGGTGAATCTCCCTAATGG + Intergenic
1141311823 16:82920845-82920867 CTAAGTATGATGCTCCCTGAAGG + Intronic
1147036677 17:37686720-37686742 CTTAGGATGTTTCTCCATGAGGG + Exonic
1149320050 17:55473196-55473218 TTAAGGATGAATTTCCATGAAGG - Intergenic
1154134434 18:11763187-11763209 CTATCGATGAATCTGGGTGAAGG - Intronic
1155400122 18:25429028-25429050 CTAGGGATGAATCTCTGTGTGGG + Intergenic
1157769344 18:50331956-50331978 CTAAGAATGAATATCCTTCAGGG + Intergenic
1160279509 18:77474516-77474538 CTAAGGACGAATCTCCGTTAAGG - Intergenic
1162622787 19:11857643-11857665 CTAATGAAGAATCTCCTTGCAGG + Intronic
1163210078 19:15833849-15833871 TTAAGGATGGATTTCCATGATGG - Intergenic
1166148260 19:40851762-40851784 CTAAGGAAGAATTTCCCTGAGGG - Intronic
1166152403 19:40883547-40883569 CTAAGGAAGAATTTCCCTGAAGG - Intronic
1166171282 19:41029071-41029093 CTAAGGAAGAATTTCCCTGAGGG - Intergenic
1166177778 19:41087098-41087120 CTAAGGAAGAATTTCCTTGAGGG + Intergenic
1167875743 19:52410810-52410832 TTAAGGAAGAATCTCCTTGCAGG + Intronic
1167945918 19:52988763-52988785 CTAATGAAGAATCTCCTTGGAGG + Intergenic
1168453094 19:56481054-56481076 ATAAAGATGAATCTCCATGTTGG + Intergenic
1168576344 19:57514406-57514428 CTAATGAAGAATCTCCTTGGAGG - Intronic
1168680182 19:58309520-58309542 CTAATGAAGAATCTCCTTGGAGG - Intronic
925055542 2:854177-854199 TGAAGGATGAATCTTCCTGAGGG - Intergenic
925926697 2:8676306-8676328 CTAAGGCTGCATCTCCAGGAGGG - Intergenic
937943432 2:127309064-127309086 CTAAGAATGAAGCTCAGTGAAGG + Intronic
941740615 2:169031373-169031395 CTAAGGATCAATGTCCCTAAGGG + Intergenic
1168905458 20:1399829-1399851 CTAAAGAAGAATCTCCCTGCGGG - Intergenic
1175216620 20:57394701-57394723 CATAGGAAGAATCTCGGTGAAGG - Intronic
1183787167 22:40036415-40036437 CTAAGGATGAACCTGCATGAGGG - Exonic
957154895 3:76534868-76534890 TTAAGGATGGATTTCCATGATGG + Intronic
957177053 3:76824831-76824853 CGAAGTCTGAATCTCAGTGATGG - Intronic
961144260 3:124581077-124581099 CCTAGAATGAATCTCCATGATGG + Intronic
962385261 3:134927684-134927706 CCAAGGAAGATTCTCCTTGAGGG + Intronic
964455930 3:156866263-156866285 TTAAGGATGACTTTCTGTGAAGG + Intronic
964902603 3:161677840-161677862 CTAAGGAATAATTTCCCTGATGG - Intergenic
974964985 4:68749525-68749547 CTAATGAAGAATCTCCTTGGAGG + Intergenic
976353280 4:84084741-84084763 ATAAGGAAAAATCTCTGTGATGG + Intergenic
976748346 4:88428646-88428668 CTAAGTATAAATCTGGGTGATGG - Exonic
979256201 4:118610177-118610199 CTGAGGATGAATGTCCCTGCAGG - Intergenic
979332147 4:119430359-119430381 CTGAGGATGAATGTCCCTGCAGG + Intergenic
980948873 4:139351537-139351559 CTAAGGATGAATTTCAGCAAGGG + Exonic
985788850 5:1914697-1914719 CTAAGGAGACATCTCAGTGAGGG - Intergenic
986215389 5:5714759-5714781 GTAAGGATTAGTCTCCTTGAGGG - Intergenic
987726320 5:21704428-21704450 CTAACCAAGAATCTCAGTGATGG + Intergenic
991692748 5:69241234-69241256 ATAAGGATGAATCCTGGTGAGGG - Intronic
994286455 5:97974265-97974287 ATAAGGATGAATCAACATGAGGG - Intergenic
996040306 5:118801845-118801867 CTAAGCATGAATCTACCTGTGGG + Intergenic
1006228704 6:32563409-32563431 CTAATGAAGAATCTCCTTGTAGG + Intronic
1009389626 6:63130390-63130412 CTAAGGATGGAGCTTCCTGAGGG + Intergenic
1013821202 6:114155050-114155072 CTAAGGGTGCCTCTCCGTGCTGG - Intronic
1019191677 6:170254811-170254833 CTCAGGAGGTATCTGCGTGAGGG - Intergenic
1019326628 7:441629-441651 CTCAGCATGGATCACCGTGAGGG - Intergenic
1022090563 7:27105354-27105376 CTAAGGATGAAGATCCTTCAGGG - Intergenic
1028667582 7:93364330-93364352 CTCGGGATGAAGCTCAGTGATGG + Intergenic
1033741245 7:144277337-144277359 CTAAGGCTCACTCTCCGTGCAGG - Intergenic
1033752658 7:144372277-144372299 CTAAGGCTCACTCTCCGTGCAGG + Exonic
1034343991 7:150374693-150374715 CTAAGGCTCAAACTCCCTGATGG + Intronic
1035147162 7:156830780-156830802 CTGAGGTAGAATCTCCGAGATGG - Intronic
1040741003 8:50575598-50575620 GTTTGGATGACTCTCCGTGAGGG + Intronic
1043651876 8:82605310-82605332 CTAAATATGACTCTACGTGATGG + Intergenic
1050140875 9:2514493-2514515 TTAAGGATGGATTTCCATGAAGG - Intergenic
1053078201 9:35152909-35152931 TTAAGGATGGATTTCCATGATGG + Intergenic
1055550833 9:77430912-77430934 CTAAGGATAAATCTTGGAGAAGG + Intronic
1059680584 9:116581551-116581573 CTAAGGAAGAATATCCGTCTGGG - Intronic
1061818785 9:133211223-133211245 CTTACGATGAATCTCAGTTAAGG + Intergenic
1191142072 X:57125342-57125364 CCAGGGATGAAGCTCAGTGAGGG + Intergenic
1200007402 X:153096680-153096702 TTAAGGATGGATTTCCATGAAGG + Intergenic