ID: 1092262625

View in Genome Browser
Species Human (GRCh38)
Location 12:6960595-6960617
Sequence CACACGTGTGGGCCTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092262619_1092262625 7 Left 1092262619 12:6960565-6960587 CCTTCTGTTCATAAGCATTTCCT 0: 1
1: 0
2: 3
3: 46
4: 521
Right 1092262625 12:6960595-6960617 CACACGTGTGGGCCTCTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 154
1092262617_1092262625 9 Left 1092262617 12:6960563-6960585 CCCCTTCTGTTCATAAGCATTTC 0: 1
1: 0
2: 2
3: 24
4: 305
Right 1092262625 12:6960595-6960617 CACACGTGTGGGCCTCTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 154
1092262618_1092262625 8 Left 1092262618 12:6960564-6960586 CCCTTCTGTTCATAAGCATTTCC 0: 1
1: 0
2: 1
3: 31
4: 325
Right 1092262625 12:6960595-6960617 CACACGTGTGGGCCTCTGCTAGG 0: 1
1: 0
2: 0
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092262625 Original CRISPR CACACGTGTGGGCCTCTGCT AGG Intronic
900391475 1:2435814-2435836 CACACCTGGGGGGCTCAGCTGGG + Intronic
900598113 1:3491596-3491618 CACACTTGGGGTCCTCCGCTTGG - Intronic
900676667 1:3891831-3891853 CACACGGGTGGGCAGGTGCTAGG + Intronic
900676691 1:3891923-3891945 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676702 1:3891969-3891991 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676715 1:3892015-3892037 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676728 1:3892061-3892083 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676741 1:3892107-3892129 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676754 1:3892153-3892175 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676767 1:3892199-3892221 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676780 1:3892245-3892267 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676793 1:3892291-3892313 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676806 1:3892337-3892359 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676819 1:3892383-3892405 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676832 1:3892429-3892451 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676871 1:3892567-3892589 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676884 1:3892613-3892635 CACACGGGTGGGCGGGTGCTAGG + Intronic
900676895 1:3892659-3892681 CACACGGGTGGGCGGGTGCTAGG + Intronic
901014101 1:6217904-6217926 CCCACTTCTGGGCCTCTGCCTGG + Intronic
901220898 1:7583247-7583269 CACACACCTGGGCCTCTGCTTGG - Intronic
904498285 1:30899949-30899971 CAGACGTGTGGGCTCCTGCATGG - Intronic
906785413 1:48611209-48611231 CAGAGGTGTGGGCCTCTGCCAGG - Intronic
912713698 1:111967225-111967247 CAGACCTGTTGCCCTCTGCTGGG + Intronic
914290137 1:146265501-146265523 CAGATGACTGGGCCTCTGCTAGG - Intergenic
914551180 1:148716284-148716306 CAGATGACTGGGCCTCTGCTAGG - Intergenic
915101269 1:153502563-153502585 CACCCATGTGGGCCTTTGGTGGG + Intergenic
922462970 1:225827152-225827174 CAGATGTTTGGGACTCTGCTGGG - Intronic
923130130 1:231067823-231067845 TACAGGTGTGAGCCACTGCTCGG + Intergenic
924681149 1:246235483-246235505 CACAGTTGTGGGTCTCAGCTGGG + Intronic
1065870283 10:29950496-29950518 GAGCCGTGTGGGCCTCTGTTGGG - Intergenic
1067449888 10:46375789-46375811 GACACAGGTTGGCCTCTGCTGGG - Exonic
1067529224 10:47058484-47058506 CACACGTGTGTCCCTCTGCACGG - Intergenic
1067587362 10:47483974-47483996 GACACAGGTTGGCCTCTGCTGGG + Exonic
1067634417 10:47991741-47991763 GACACAGGTTGGCCTCTGCTGGG + Intergenic
1071788622 10:88931365-88931387 TACATCTCTGGGCCTCTGCTTGG + Intronic
1072579107 10:96724515-96724537 ACCACCTGTGGGCCCCTGCTCGG + Intergenic
1076767670 10:132645451-132645473 CACACGTGTGCACCCTTGCTGGG + Intronic
1083266438 11:61549040-61549062 CCCTCGTGTGAGGCTCTGCTGGG - Intronic
1091304296 11:134527764-134527786 CACTCGTGTGGAACTCAGCTGGG - Intergenic
1092084603 12:5745475-5745497 CACAAGTGGGAGCCACTGCTAGG + Intronic
1092262625 12:6960595-6960617 CACACGTGTGGGCCTCTGCTAGG + Intronic
1092349540 12:7744883-7744905 CACAGGTGTGAGCCACTGCCTGG + Intronic
1094396845 12:30016190-30016212 CACATGTGTGGGCATGTGCATGG - Intergenic
1094490548 12:30957898-30957920 TACATGTGTAGCCCTCTGCTAGG + Intronic
1098522696 12:71451469-71451491 CACATGTGTTGCCATCTGCTGGG + Intronic
1102207285 12:111099197-111099219 CACACGTTCCTGCCTCTGCTGGG - Intronic
1102282802 12:111631830-111631852 TACAGGTGTGGGCCACTGCGTGG + Intergenic
1103865566 12:124049310-124049332 CACATGTGGGGACTTCTGCTTGG + Intronic
1106003312 13:25745216-25745238 TACAGGTGTGAGCCACTGCTTGG + Intronic
1106028244 13:25975124-25975146 CCCACGTGTGGCCCAGTGCTTGG - Intronic
1107063090 13:36182599-36182621 CACACATGTGGTCTTCTGGTGGG - Intronic
1115916942 14:38325913-38325935 CACACATGGGGGCCTGTCCTGGG + Intergenic
1117095820 14:52296325-52296347 CACATCTGTGTGCCTCTGATGGG - Intergenic
1119511369 14:75214136-75214158 CAGCAATGTGGGCCTCTGCTTGG + Intergenic
1119739328 14:77004038-77004060 GACACGTCAAGGCCTCTGCTAGG + Intergenic
1121512196 14:94520809-94520831 CACACGTGCAGGCCTCTCCTGGG + Intergenic
1122789375 14:104177881-104177903 CCCACCTGTGGCCCTCTTCTTGG - Exonic
1122984366 14:105205474-105205496 CACACGTCTGAGGCTCTGCAAGG - Intergenic
1124019018 15:25903062-25903084 CACACGTGTGGGCAGCTCCGTGG + Intergenic
1124027209 15:25977575-25977597 TACAGGTGTGAGCCACTGCTCGG + Intergenic
1131180123 15:90233785-90233807 CTCGCGTGCGGGCCTCTTCTCGG - Intronic
1132205373 15:99982823-99982845 CACAGCTGTGGGCACCTGCTGGG - Intronic
1132513363 16:354558-354580 CCCACCTGTGGGCATCTGGTTGG - Intergenic
1132593185 16:735386-735408 CACACGCGGGTGCCTCTGCTGGG - Intronic
1136617679 16:31408609-31408631 CACGCGTGGGGGCCTCTCCCTGG - Intronic
1138058130 16:53857602-53857624 CACTGGGGTGGACCTCTGCTTGG + Intronic
1140039534 16:71396942-71396964 CACCCTTGTGGGCTTCTACTGGG - Intergenic
1145990899 17:29078911-29078933 CCCATGTGTGGGCCTTTGGTGGG + Intronic
1146124098 17:30218429-30218451 CCCACGTGTACCCCTCTGCTGGG - Intronic
1146907758 17:36629015-36629037 CACACGGTGGGGCCTCTTCTGGG + Intergenic
1148675715 17:49443686-49443708 CACACGTGTGGCCTCCTGCAGGG - Intronic
1152018776 17:77769550-77769572 CACAGCTGTGGGCATCTGCTCGG + Intergenic
1152375228 17:79915481-79915503 CACATGTGTGTGCACCTGCTTGG + Intergenic
1154218684 18:12433843-12433865 CACAGGTGTGTGCCACCGCTTGG + Intergenic
1155280424 18:24233926-24233948 TACAGGTGTGAGCCTCTGCGGGG + Intronic
1157285329 18:46373661-46373683 CACACCTGTGAGCCTCTGGTGGG - Intronic
1160427520 18:78788232-78788254 AACACGTGAGGGCCTCTGCAGGG - Intergenic
1160438948 18:78874316-78874338 AAGACGTGTGAGCCTCTGCATGG - Intergenic
1161138139 19:2632908-2632930 CACCCGCCTGGGCCTCTGCCTGG + Intronic
1161151575 19:2712947-2712969 GACCCGTCTGGGACTCTGCTTGG - Intergenic
1161525142 19:4749901-4749923 CCCACGTGTAGGTCTCTGCATGG - Intergenic
1164810774 19:31154173-31154195 CCTACGGGTGGGGCTCTGCTGGG - Intergenic
1166669029 19:44698702-44698724 CACAGGTGTGGCCCCCTGCCCGG + Intergenic
1167765354 19:51478904-51478926 CACATGTGTGGGTCTGTGCAGGG - Intronic
1168630591 19:57953253-57953275 CAGACCTGTGGGCCTCAGCCTGG + Intergenic
926170252 2:10548710-10548732 GCCGCGTGTGCGCCTCTGCTGGG + Intergenic
926719181 2:15946239-15946261 CACCAGTGTGGGGTTCTGCTGGG + Exonic
927250518 2:20991733-20991755 CACACTTCTGGGCCACAGCTGGG - Intergenic
928063086 2:28134763-28134785 CACATGTGAGGCCCTTTGCTAGG + Intronic
928073133 2:28237668-28237690 CACACGTGTGTGCATGTGTTTGG + Intronic
928904789 2:36356877-36356899 CACACGTGTGCGCGTCTGCGCGG - Intronic
928993000 2:37255550-37255572 CTCTCCTGTGGACCTCTGCTGGG - Intronic
932023555 2:68112402-68112424 CACACTTCTGGGCCTCTCCTGGG + Intergenic
932500831 2:72181313-72181335 CACATGTGGAGGCCTGTGCTTGG + Intronic
933770546 2:85741472-85741494 AACACGTCTGGGACTCTCCTGGG + Intergenic
936133993 2:109873526-109873548 CACCCGCCTTGGCCTCTGCTGGG + Intergenic
936210704 2:110497959-110497981 CACCCGCCTTGGCCTCTGCTGGG - Intergenic
937808179 2:126169906-126169928 CAAACGTGAGGGCTTCTGTTAGG - Intergenic
937888384 2:126916004-126916026 GACACATGGGGGACTCTGCTGGG + Intergenic
937913169 2:127085970-127085992 CACATGTGGGGGCCTCAACTGGG - Intronic
939169200 2:138674427-138674449 TACAGGTGTGAGCCACTGCTCGG + Intronic
942066228 2:172274299-172274321 CACAGGTGTGGCCCTTTGCAGGG - Intergenic
943153007 2:184138211-184138233 CACAGGGGTGGGCCACTGCTGGG + Intergenic
946373930 2:219297042-219297064 CACAGGTGTTTGGCTCTGCTTGG + Exonic
948902087 2:240961210-240961232 CACACGTGTGGACCTCAGGCAGG - Intronic
1170716880 20:18839542-18839564 CACATGTATGGGCCTCAACTGGG - Intergenic
1172409024 20:34709028-34709050 CTGACGTGCGGGCCTCTCCTGGG - Intronic
1173530746 20:43767424-43767446 CACTCGTGTGTGCCTCTGTCAGG + Intergenic
1175326144 20:58129810-58129832 CAGAAGTGGGGGCCTCTGCTTGG - Intergenic
1176186492 20:63782825-63782847 CACAGGTGTGAGCCACTGCCTGG - Intronic
1176191355 20:63811618-63811640 CACACGTGCAGATCTCTGCTGGG - Intronic
1179925526 21:44532052-44532074 CACACAGCTCGGCCTCTGCTAGG + Intronic
1180085243 21:45505301-45505323 CACACGAGGCGGCCTCTGCCCGG - Intronic
1180123052 21:45766671-45766693 GACATCTGTGGGCATCTGCTGGG - Intronic
1182279268 22:29208633-29208655 CACCCCTGTGGGCATCAGCTGGG - Intronic
1182512402 22:30828593-30828615 CCCACGTCGGGCCCTCTGCTGGG - Intronic
1183471725 22:38011574-38011596 CACATGTGTGGGTCTATTCTTGG + Intronic
1184572466 22:45334764-45334786 CACACATGTGGGCCGGTGCCAGG - Intronic
949194051 3:1284256-1284278 CACAATTGTGAGCCTTTGCTTGG - Intronic
949500027 3:4670935-4670957 GACACGTGTGGGGCTCAGATTGG + Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
952289358 3:32000452-32000474 CACACCAGTGGGCCTCTGTGAGG + Intronic
961812563 3:129530361-129530383 GACATGTGGGGGCCTCTCCTAGG - Intronic
967791564 3:193554985-193555007 CCCACGAGTCGCCCTCTGCTAGG + Exonic
967941617 3:194770763-194770785 CACAGGTGTGGGTTTCTGCTGGG - Intergenic
968054688 3:195682400-195682422 CACACGTGTTGGATTCTGCCTGG + Intergenic
968101217 3:195966872-195966894 CACACGTGTTGGATTCTGCCTGG - Intergenic
975470083 4:74755858-74755880 CACACAGGAGGGCGTCTGCTCGG + Exonic
980464599 4:133156144-133156166 CACACTTGTGGACCTCTGGATGG + Intronic
981446347 4:144842810-144842832 CACACATGGGGGCCTCTCGTGGG + Intergenic
982241371 4:153303058-153303080 CACACGCATGGGACTATGCTAGG + Intronic
985358587 4:189147486-189147508 GTCAAGTGTGGGCCTCGGCTTGG + Intergenic
985735150 5:1575598-1575620 CACACGTGTTGGATTCTGCCTGG - Intergenic
987264222 5:16235509-16235531 CTCAGGTCTGGTCCTCTGCTTGG + Intergenic
990915989 5:60906309-60906331 TACAGGTGTGAGCCACTGCTGGG + Intronic
996623461 5:125539177-125539199 CACACCTGTGGTCCGCTGCTTGG + Intergenic
997737914 5:136228087-136228109 TACTCTTGTGGGCCTCTCCTGGG - Intronic
1002599937 5:180348331-180348353 CACACCTGTGGGCCTCACCCAGG - Intronic
1002905073 6:1441624-1441646 CACAGGTTTTGGCATCTGCTGGG - Intergenic
1002913114 6:1506192-1506214 CACCCGTGTAAGACTCTGCTTGG - Intergenic
1003542553 6:7031312-7031334 CACACGTGGGGGCCTGTTGTGGG + Intergenic
1004942948 6:20580397-20580419 GACACGGGAGGACCTCTGCTAGG - Intronic
1004989218 6:21117888-21117910 CACACGTGTTAGCCTTTGATGGG - Intronic
1006350716 6:33519156-33519178 CTGACGTGGTGGCCTCTGCTTGG - Intergenic
1006641172 6:35490576-35490598 CCCATGTGTGTGCCTCAGCTTGG - Intronic
1007337511 6:41164068-41164090 CACACGTGGGTCCCTGTGCTTGG - Intergenic
1007772577 6:44203060-44203082 CACAGATGTGGGCCAGTGCTTGG + Intergenic
1012719177 6:102719679-102719701 CACACTTGTTGACCTCTGCTGGG + Intergenic
1013816101 6:114100141-114100163 CACACATGTAGGCTTCAGCTAGG - Intronic
1014909329 6:127071060-127071082 CACATGTGTGGGCCTGTGGAAGG + Intergenic
1016195610 6:141335112-141335134 CACACGTGGGGGACTGTTCTAGG - Intergenic
1016657902 6:146543258-146543280 CACACTTGCGGGCCTTGGCTTGG - Intergenic
1018740319 6:166723366-166723388 CACACGTGTGGGACCCCCCTGGG - Intronic
1019143827 6:169964070-169964092 CACAGGTGCGGGGCTGTGCTCGG + Intergenic
1019301235 7:304519-304541 CCCACGTGTGCACGTCTGCTGGG + Intergenic
1023874635 7:44280262-44280284 CACACCTGTGGGCCCATGCAGGG - Intronic
1028797960 7:94926100-94926122 TACAGGTGTGGGCCACTGCTGGG + Intronic
1032023876 7:128426069-128426091 CACAGCTGTGGGCCTCTCCATGG + Intergenic
1034870295 7:154677630-154677652 CTCACGTGTGGGCGTCTGCACGG + Intronic
1046766396 8:118074485-118074507 GACACGCGTGGGGCTCTGCCTGG - Intronic
1046789672 8:118307543-118307565 CACATGCCTGGGGCTCTGCTAGG + Intronic
1048572211 8:135665571-135665593 CCTATGTGTTGGCCTCTGCTGGG + Intergenic
1049008894 8:139874493-139874515 CACACGTTTGTGCCTCGCCTGGG - Intronic
1056729950 9:89156900-89156922 ATGACCTGTGGGCCTCTGCTTGG + Intronic
1056754412 9:89373032-89373054 CACACCTGTGGGCCTGTGTCAGG - Intronic
1056808930 9:89749267-89749289 CATGAGTGTGGGCCTCTGCAAGG - Intergenic
1057273325 9:93663049-93663071 CACACGTGTGTGTGTCAGCTTGG + Intronic
1062229970 9:135476634-135476656 CTCCCCTCTGGGCCTCTGCTTGG - Intergenic
1203360831 Un_KI270442v1:218174-218196 CACACGTGGGGGCCACGGCAGGG + Intergenic
1186141257 X:6576683-6576705 ATCAGGTGTGGGCCTGTGCTCGG + Intergenic
1187059279 X:15770556-15770578 TACAGGTGTGAGCCACTGCTGGG + Intronic
1201471122 Y:14336042-14336064 CACACTTGTTGTCCACTGCTTGG + Intergenic