ID: 1092263449

View in Genome Browser
Species Human (GRCh38)
Location 12:6964153-6964175
Sequence CATCTTTACCAGACAGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092263449_1092263458 13 Left 1092263449 12:6964153-6964175 CCTAACACTGTCTGGTAAAGATG 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1092263458 12:6964189-6964211 TTCTCTCGGCAGTAACCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1092263449_1092263455 -1 Left 1092263449 12:6964153-6964175 CCTAACACTGTCTGGTAAAGATG 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1092263455 12:6964175-6964197 GGCTCCCGGGTGGGTTCTCTCGG 0: 1
1: 0
2: 1
3: 6
4: 148
1092263449_1092263454 -10 Left 1092263449 12:6964153-6964175 CCTAACACTGTCTGGTAAAGATG 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1092263454 12:6964166-6964188 GGTAAAGATGGCTCCCGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 69
1092263449_1092263459 14 Left 1092263449 12:6964153-6964175 CCTAACACTGTCTGGTAAAGATG 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1092263459 12:6964190-6964212 TCTCTCGGCAGTAACCTTCAGGG 0: 1
1: 0
2: 0
3: 18
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092263449 Original CRISPR CATCTTTACCAGACAGTGTT AGG (reversed) Intergenic
902195372 1:14794240-14794262 CATCTAAACCCGACAGAGTTAGG + Intronic
902770277 1:18641752-18641774 GAGATTTACCAGACAGTATTGGG + Intronic
902879022 1:19358752-19358774 CATCTTTATCAGAAAGTCTGGGG + Intronic
903790557 1:25890086-25890108 CCTACTTACCAGGCAGTGTTAGG - Intronic
907510485 1:54954405-54954427 CACCTTTCCCAGGCAGAGTTAGG - Intergenic
907632810 1:56100832-56100854 TATCTTTACCATACATTGTGTGG + Intergenic
907763337 1:57383665-57383687 TGTCTTTAGCAAACAGTGTTGGG + Intronic
909852415 1:80484863-80484885 CATCTCTACCAAATAGTGTTTGG - Intergenic
910062002 1:83105006-83105028 CATCTTTACCAAACTTTATTTGG - Intergenic
911615939 1:100010906-100010928 TGTCTTTTCCTGACAGTGTTTGG + Intronic
913471865 1:119196294-119196316 AATTTTAACCAGTCAGTGTTGGG - Intergenic
915929684 1:160052271-160052293 TGTCTTTACCAAACAGTGATTGG - Intronic
917214880 1:172668069-172668091 CATCTCTGCAAGACAATGTTAGG - Intergenic
917315045 1:173715346-173715368 CAGCTTCCCCAGACAGTGTTTGG + Intronic
918081109 1:181208385-181208407 CATCTTTAACAGCCACTGTGCGG + Intergenic
921051715 1:211515820-211515842 GATCTTTTCCAGACAGTGCCGGG - Intergenic
923082059 1:230667151-230667173 CATCTTTACACCACAGTGTCTGG + Intronic
1063460147 10:6210265-6210287 CATCTGTCCAAGACAGTGGTGGG + Intronic
1063679917 10:8177292-8177314 CATCTTTTCCAGGAGGTGTTTGG + Intergenic
1064092907 10:12400210-12400232 AATTTTTACAAGACAGTCTTTGG + Intronic
1064574849 10:16734403-16734425 CATCTATACCAGTCAGTGGATGG + Intronic
1064839725 10:19577662-19577684 CATCTTTAAGACAGAGTGTTGGG - Intronic
1066532752 10:36358314-36358336 CATCTTTACCTGCAAATGTTAGG - Intergenic
1067767805 10:49100934-49100956 CCTCTTCAACAGACAGTGTAGGG + Intronic
1067901635 10:50247742-50247764 CCTCTGTTCCAGTCAGTGTTAGG - Intronic
1067940500 10:50650992-50651014 CTTCTCTACCAGATGGTGTTTGG - Intergenic
1068401419 10:56532427-56532449 CATCTTTACCACACAGTCAAAGG - Intergenic
1069102558 10:64341230-64341252 TATATTTAACAGACATTGTTGGG + Intergenic
1070360150 10:75680393-75680415 CATATTTACCAGACAATTGTTGG - Intronic
1070723852 10:78774816-78774838 GACCTTTCCCAGGCAGTGTTTGG + Intergenic
1074647005 10:115466672-115466694 CATTTTTACCTGAAAGTTTTAGG + Intronic
1075212266 10:120501367-120501389 TATTTTTACTAGACAGTTTTCGG - Intronic
1083026204 11:59553198-59553220 GATCCTTTCCAGACAGGGTTAGG - Intergenic
1084338974 11:68480386-68480408 CTTCTGTACCAGACACTGTCTGG + Intronic
1086861468 11:91929694-91929716 ATTCTTTAGGAGACAGTGTTTGG + Intergenic
1088073441 11:105817552-105817574 CCTCTTTACATGACAATGTTTGG - Intronic
1090031292 11:123208850-123208872 CTCCTTTACCAGACCATGTTAGG - Intergenic
1092263449 12:6964153-6964175 CATCTTTACCAGACAGTGTTAGG - Intergenic
1096360286 12:50979449-50979471 TTTCATTACCAGAGAGTGTTGGG - Intronic
1097911663 12:64976629-64976651 CATTTGTAACAGACATTGTTGGG + Intergenic
1098451113 12:70618951-70618973 CATCCTTACCTGCCAGTGTGAGG - Intronic
1098479969 12:70946126-70946148 CATCTGTGACAGACAGTGTATGG - Intergenic
1098847844 12:75560161-75560183 CACCTTTACCTAACAGTGTTAGG - Intergenic
1099666464 12:85636218-85636240 TGTCTTTAACAAACAGTGTTAGG - Intergenic
1107827599 13:44342947-44342969 CATCTTTATCAGACAAAGATTGG + Intergenic
1108030312 13:46222494-46222516 CCTCTTTAATAAACAGTGTTAGG - Intronic
1108782280 13:53850687-53850709 AATATTTATCAGACAGTTTTTGG + Intergenic
1109941586 13:69374344-69374366 CAGCTTTACCAGACTGTGTGTGG + Intergenic
1110157537 13:72335936-72335958 CATGTTTCCCAGAGACTGTTAGG - Intergenic
1111116892 13:83790979-83791001 CATCTTTACCTGAAAGTAATGGG - Intergenic
1111992846 13:95133944-95133966 CATCTTAACCTGAACGTGTTTGG - Intronic
1118010219 14:61603218-61603240 CCTCTTTAACATACAGTGGTAGG - Intronic
1118946886 14:70397212-70397234 CATTTTTAACATACGGTGTTTGG - Intronic
1120380916 14:83778514-83778536 CATTTTTACCAGAAAGCGTTTGG + Intergenic
1120773495 14:88407840-88407862 CCTATTTAACAAACAGTGTTGGG - Intronic
1122368151 14:101209680-101209702 AATTTTTAACAGACAGTGTTTGG + Intergenic
1124853447 15:33363131-33363153 CATGTGTACCAGTCAGTCTTGGG + Intronic
1126139078 15:45422370-45422392 GATGTTTACCAGATATTGTTAGG - Intergenic
1128946953 15:71830719-71830741 GATCTGTACCAGTCAGTGTGGGG - Intronic
1132495573 16:261690-261712 CATCTCTACCAGGCAGCTTTGGG + Intronic
1135945169 16:26858874-26858896 CACATTTCCCAGACAGTGTGAGG - Intergenic
1137226371 16:46514950-46514972 CTTCTTTAAAAGAAAGTGTTTGG - Intergenic
1143675620 17:8430467-8430489 CATCTTTACTAGCTAGGGTTCGG + Intronic
1146576451 17:33996584-33996606 GTTCTTTCCCAGACTGTGTTGGG - Intronic
1152670520 17:81601986-81602008 GATCTCCACAAGACAGTGTTAGG + Intronic
1153496920 18:5708971-5708993 AATGTTATCCAGACAGTGTTCGG - Intergenic
1154369535 18:13747006-13747028 TCTCCTTACCAGACAATGTTTGG + Intronic
1156109072 18:33701680-33701702 CATTTTTACCAGAATGTGTCTGG + Intronic
1156229958 18:35143801-35143823 CATCTGGACAAGACAGTGCTGGG + Intergenic
1158144640 18:54298455-54298477 CATCATTAGCATACAGTGTCAGG + Intronic
1159009958 18:63049562-63049584 CACTGTTACCAGAAAGTGTTAGG + Intergenic
1161466721 19:4435035-4435057 TGTCCTTACCACACAGTGTTCGG + Intronic
1166440779 19:42813138-42813160 TATCTTCACCAGACAGCTTTGGG + Intronic
926083009 2:10004028-10004050 CATCTTCCCCAGACAGCGTTAGG + Intergenic
926775035 2:16413629-16413651 CCTCATTAGCAGACAATGTTTGG + Intergenic
927403164 2:22737409-22737431 TCTCTTCAACAGACAGTGTTGGG + Intergenic
929086205 2:38169779-38169801 CATCTGTCCCACACAGTGTCCGG - Intergenic
930146503 2:48012374-48012396 CATCTTTTTTAGACAGTGCTTGG - Intergenic
930838534 2:55820984-55821006 CATCTTTAATAAACAGTGTTGGG + Intergenic
942230488 2:173857168-173857190 CAGCTTTTCCACTCAGTGTTGGG + Intergenic
942378175 2:175358071-175358093 CAGCTTTACCAGGCAGTCTCAGG - Intergenic
942971917 2:181967366-181967388 CATCTTTAACAGGCATTGTAAGG + Intronic
943813378 2:192219227-192219249 CATCATGACCACATAGTGTTTGG - Intergenic
945747861 2:213740761-213740783 CATCTTTACCCCACACTCTTGGG - Intronic
946752202 2:222903768-222903790 CATCTTTACCACACAGTAACAGG - Intronic
947115943 2:226770578-226770600 CATCTATAACATACAGTCTTTGG + Intronic
947276890 2:228401817-228401839 CATCTTTACCACCCAGTACTGGG - Intergenic
948771632 2:240254231-240254253 CATCTGGAGCAGACAGTGTGGGG - Intergenic
1169763177 20:9119552-9119574 CAATTTTACCATACAGTTTTAGG + Intronic
1173275378 20:41576160-41576182 CATCTTTACCAAAACATGTTAGG + Intronic
1174341305 20:49897984-49898006 TCTCTTCACCAGATAGTGTTGGG + Intergenic
1174646303 20:52088885-52088907 CATTTTTCCCAAACAGGGTTTGG - Intronic
1175253745 20:57625744-57625766 CGCCTTTACCAGTCAGTGCTGGG - Intergenic
1176055698 20:63146776-63146798 CATCCATACCAGACAGGGTGGGG - Intergenic
1176309648 21:5142828-5142850 CAGCTTCACCAGCCAGTGATGGG + Intronic
1176999079 21:15589631-15589653 CATCTTTATTGGACAGTTTTAGG - Intergenic
1179362794 21:40728048-40728070 CATCTTTACCAGGCAGTCAGGGG - Intronic
1179847410 21:44119205-44119227 CAGCTTCACCAGCCAGTGATGGG - Intronic
1185161578 22:49233065-49233087 CACCAGCACCAGACAGTGTTGGG - Intergenic
949548007 3:5089294-5089316 CATCTATACCAGACGCTGGTGGG - Intergenic
949892500 3:8743757-8743779 CATGTTGCTCAGACAGTGTTGGG - Intronic
955482792 3:59406351-59406373 CATTTGAACCAGACAGTGATGGG + Intergenic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
956355523 3:68388185-68388207 AATTTTTACCAGAGAGTTTTAGG + Intronic
957747199 3:84361160-84361182 CCTATTTAATAGACAGTGTTGGG - Intergenic
958954510 3:100452689-100452711 GATACTTACTAGACAGTGTTTGG - Intronic
959442068 3:106389324-106389346 CATCTCTACCAGTCAGTGAGAGG - Intergenic
960085519 3:113586447-113586469 CATATTTACCAGCCAGCTTTTGG - Intronic
960429590 3:117552492-117552514 CCTCTTTATCATCCAGTGTTTGG + Intergenic
961053749 3:123768792-123768814 CATCTTCACCATACACTGTCTGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961904921 3:130252947-130252969 AATCTTGGGCAGACAGTGTTGGG + Intergenic
965109963 3:164408135-164408157 CATCTTCACTAGACATGGTTTGG - Intergenic
970501309 4:16679957-16679979 CATCTATAGCAGACAGTGAGAGG - Intronic
970873847 4:20847051-20847073 CATACTTCCCAGGCAGTGTTTGG - Intronic
975982067 4:80172323-80172345 CCTTTTTACAAGAAAGTGTTGGG + Intergenic
977039789 4:92001963-92001985 CATTTTTCCCTGATAGTGTTGGG + Intergenic
977171863 4:93772297-93772319 CAGCTTTAGCTGACAGTGTGCGG - Exonic
980489208 4:133504124-133504146 CATCTTAAACAGCCAGTTTTAGG + Intergenic
980876564 4:138667703-138667725 CACCTTTACCTGACATTGTTTGG + Intergenic
981816513 4:148837019-148837041 CTTCATTTCCAGACACTGTTAGG - Intergenic
981991835 4:150930814-150930836 CATCACTACCAAGCAGTGTTAGG + Intronic
985992878 5:3577953-3577975 CATTTCTACCAGCCAGTCTTCGG + Intergenic
987211999 5:15693018-15693040 CATCAGGACCAGACAGTGATGGG + Intronic
989307847 5:39977965-39977987 CATCATTACCATATATTGTTTGG + Intergenic
990823681 5:59873092-59873114 CATGTATACAAAACAGTGTTTGG + Intronic
991283603 5:64943872-64943894 ACTCTTTGCCAGCCAGTGTTTGG - Intronic
994271849 5:97786951-97786973 CATCTTTACTAGAAATTGATTGG + Intergenic
996846946 5:127910448-127910470 CATCTTTACTAGCAAGTGATTGG + Intergenic
999857684 5:155612985-155613007 AATCTTTACATGACAGTGTAGGG + Intergenic
1000321332 5:160136944-160136966 CATCTTAGCCAGCCTGTGTTGGG + Intergenic
1000761111 5:165225987-165226009 TATCTTTAGCATACAGTCTTTGG - Intergenic
1000859681 5:166441196-166441218 CATCTTTTCCAGAAATTGTGAGG - Intergenic
1001230854 5:169986870-169986892 TATCTTTGCCAGACAATGCTTGG - Intronic
1001878595 5:175222650-175222672 CATCTTCACCACAAAGTGCTTGG + Intergenic
1008368752 6:50710898-50710920 CTTCTTTTCCAGAGAGTGATTGG - Intergenic
1010131164 6:72495204-72495226 TATCTTTATTAGACAGTTTTAGG - Intergenic
1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG + Intronic
1013660322 6:112289292-112289314 CAGCTTTCTCAGACAGTGCTTGG - Intergenic
1013828822 6:114248534-114248556 GATATTTACCAGACAGTCATGGG + Intronic
1017760890 6:157567205-157567227 CAGCTTGACAAGACAGTTTTGGG - Intronic
1021692789 7:23247195-23247217 CATTCTTGCCAGACAGTGGTTGG + Intronic
1023045697 7:36208408-36208430 CATGTGTACCTCACAGTGTTTGG + Intronic
1023938070 7:44753956-44753978 CACCTTTGTCAGACATTGTTTGG + Intronic
1025599951 7:62984348-62984370 CTGCTTTACCAGAAAATGTTAGG + Intergenic
1026505729 7:70980907-70980929 CATCTTTCACAGACAGTCTTTGG - Intergenic
1030831913 7:114234303-114234325 TTTCTTTAGGAGACAGTGTTAGG + Intronic
1034742107 7:153484985-153485007 CATCTTCAACAAACAGTGCTGGG + Intergenic
1038289631 8:26237297-26237319 GGTCTTTACCTGACAGTGTTTGG + Intergenic
1040035048 8:42861822-42861844 CATCTTCACCAAATACTGTTAGG + Exonic
1041389775 8:57338204-57338226 CATCTTTTTCAGACAGTGTTGGG + Intergenic
1043195021 8:77281092-77281114 CATCTTTACCATCCAGTGAATGG - Intergenic
1045846727 8:106645696-106645718 CATCTTTCCCAGATTGTGTTTGG + Intronic
1047019823 8:120763201-120763223 CATCATTACCAGGCAGTTCTTGG - Intronic
1048157665 8:131975294-131975316 CTTCTTTACCAGACAATGTGTGG + Intronic
1049126756 8:140796125-140796147 TTTCTTTACCAAACAGTGGTCGG - Intronic
1050793905 9:9512171-9512193 CGTCTTTGCTAGACACTGTTGGG - Intronic
1055459395 9:76503602-76503624 CCTCTTTGCCATCCAGTGTTTGG + Exonic
1055906222 9:81296076-81296098 CATCAGAACCAGACAGTGTAGGG + Intergenic
1057110737 9:92468382-92468404 CATCATTAACAAACAGTGTAAGG + Intronic
1187310380 X:18135881-18135903 CAACCATGCCAGACAGTGTTAGG - Intergenic
1187310528 X:18137065-18137087 CAGCCATGCCAGACAGTGTTAGG - Intergenic
1189128083 X:38469089-38469111 CATCTTTTTCAAACAGTGGTTGG + Intronic
1196106555 X:111902615-111902637 CACATTAACAAGACAGTGTTGGG + Intronic
1198047308 X:132915631-132915653 CATCTTTACCACAGCTTGTTAGG - Intronic
1198128002 X:133666269-133666291 CATTTTTAAAAGACAGTTTTGGG + Intronic