ID: 1092263779

View in Genome Browser
Species Human (GRCh38)
Location 12:6966006-6966028
Sequence TTTTCTCTTGGGAGCAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 320}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092263779_1092263789 23 Left 1092263779 12:6966006-6966028 CCTCCTTTGCTCCCAAGAGAAAA 0: 1
1: 0
2: 1
3: 28
4: 320
Right 1092263789 12:6966052-6966074 AATCTCAGGCTCATGAAAGGAGG 0: 1
1: 0
2: 1
3: 18
4: 191
1092263779_1092263786 9 Left 1092263779 12:6966006-6966028 CCTCCTTTGCTCCCAAGAGAAAA 0: 1
1: 0
2: 1
3: 28
4: 320
Right 1092263786 12:6966038-6966060 GGTTGACAGCCAGGAATCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1092263779_1092263788 20 Left 1092263779 12:6966006-6966028 CCTCCTTTGCTCCCAAGAGAAAA 0: 1
1: 0
2: 1
3: 28
4: 320
Right 1092263788 12:6966049-6966071 AGGAATCTCAGGCTCATGAAAGG 0: 1
1: 0
2: 4
3: 36
4: 344
1092263779_1092263790 26 Left 1092263779 12:6966006-6966028 CCTCCTTTGCTCCCAAGAGAAAA 0: 1
1: 0
2: 1
3: 28
4: 320
Right 1092263790 12:6966055-6966077 CTCAGGCTCATGAAAGGAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 236
1092263779_1092263785 0 Left 1092263779 12:6966006-6966028 CCTCCTTTGCTCCCAAGAGAAAA 0: 1
1: 0
2: 1
3: 28
4: 320
Right 1092263785 12:6966029-6966051 GATAAACAGGGTTGACAGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092263779 Original CRISPR TTTTCTCTTGGGAGCAAAGG AGG (reversed) Intronic
901677036 1:10891496-10891518 TTCTCTGTTGGGTGCATAGGAGG - Intergenic
906478124 1:46183598-46183620 TTTCCTCTTGTGAGGCAAGGAGG + Intronic
910503202 1:87918452-87918474 TTTTCTCTGGGGAGGGAAGAGGG + Intergenic
910741320 1:90521144-90521166 TTATCTCTTGGAAGAAAAGGAGG + Intergenic
911070806 1:93830549-93830571 TTTTCTCTTGGAGGCAGGGGCGG - Intronic
912692777 1:111816811-111816833 CTTTCTTGTGGGAGCAAGGGAGG - Intronic
915155811 1:153875046-153875068 TTTTTTCTTGTAAGCAAAGATGG + Intronic
915514171 1:156403005-156403027 TTTCCTCTTGGGAGAGGAGGTGG + Intergenic
915839573 1:159203528-159203550 TAGTGTCTTGGGAGAAAAGGGGG + Intronic
916590242 1:166183187-166183209 TGGTGCCTTGGGAGCAAAGGGGG - Intergenic
917256821 1:173124659-173124681 TTTTCTCTTGCGGGCAGGGGTGG - Intergenic
917380229 1:174398278-174398300 TTTCCTCTGGGGAGGAAAGAAGG - Intronic
917956808 1:180107814-180107836 TGTTTTTTTGGGAGCAGAGGAGG - Intronic
918208784 1:182332684-182332706 TTTTTCCTTGGGAGAAAAGAAGG + Intergenic
918378987 1:183936096-183936118 ATTTCTCTTGGGATCTAACGTGG - Exonic
919466270 1:197923863-197923885 TTTTGTCTTGGTCCCAAAGGAGG + Intronic
919518817 1:198561626-198561648 TTTTCTCTAGGGAGTGGAGGAGG - Intergenic
919569338 1:199226597-199226619 TTTTCTGTTGGGAACATAGGAGG - Intergenic
921048535 1:211494239-211494261 TTTGCTCTGGGGAGAAAAGGTGG + Intergenic
922125995 1:222724222-222724244 TTTTCTTTTGGGAGGATATGGGG + Intronic
922930440 1:229385114-229385136 TTTGCTCTTGGGAGAAAATAGGG - Intergenic
923304419 1:232675107-232675129 GGTGCTCTTGGGAGCAGAGGCGG - Intergenic
1063226589 10:4020627-4020649 TTTTCTCTTGAGATGGAAGGAGG - Intergenic
1063572732 10:7231088-7231110 TTTTCTTTTAGGAGCAGAGAAGG - Intronic
1063990706 10:11558785-11558807 TTTGCTCTTTGTAGCAAACGAGG - Intronic
1064544821 10:16439616-16439638 TTTGCACATGGAAGCAAAGGTGG - Intronic
1065498299 10:26352664-26352686 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1066504543 10:36027750-36027772 CTTCCTCATGGGATCAAAGGAGG - Intergenic
1067913712 10:50374077-50374099 TTTTCTCTTTGGCACAAAGCAGG + Intronic
1068518075 10:58048452-58048474 TTGTATCTTGGGTGCATAGGAGG + Intergenic
1068926549 10:62545585-62545607 TTTTGTCTTGGGAACAAAATTGG - Intronic
1071818816 10:89259881-89259903 TTTTCTTTGGGGAGGAGAGGAGG + Intronic
1073321808 10:102620252-102620274 TTATCTCTTGGGAGAAAGCGTGG + Intronic
1073394297 10:103205676-103205698 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1073395436 10:103213466-103213488 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1074909343 10:117893510-117893532 TTTTCTGTTAAGAGCAAAGCTGG - Intergenic
1075065986 10:119289193-119289215 TTTTGTTTTGGGTGCTAAGGGGG + Intronic
1075277693 10:121109533-121109555 TCTGCTGTTGGGAGCACAGGGGG - Intergenic
1076442144 10:130487329-130487351 TTATCTATTGTTAGCAAAGGAGG - Intergenic
1076511517 10:131017522-131017544 TGTTCTCTTGGCAGGAAGGGTGG + Intergenic
1077301354 11:1848607-1848629 TTTGCTGTGGGGAGCAAAGCTGG - Intergenic
1079006992 11:16798448-16798470 TTTGCTTTTGGGAGGGAAGGGGG + Intronic
1079212949 11:18479696-18479718 TCTTCTCTTGGGAGTAGAGTGGG + Intronic
1081690237 11:45073089-45073111 TTGTGCCTTGGGAGCACAGGAGG - Intergenic
1083781484 11:64920547-64920569 TATTCTCTTGGGAGGAAATGGGG + Intronic
1083987676 11:66227116-66227138 CTTTCTCTGGCAAGCAAAGGAGG + Intronic
1084836992 11:71809508-71809530 TTTTCTCTTGGGAACTGAAGTGG + Intergenic
1086113117 11:83219740-83219762 GTTTATCTGGGGAGCAATGGAGG + Intronic
1086442918 11:86846938-86846960 GTTTATCTGGGGAGCAATGGAGG - Intronic
1087225231 11:95591780-95591802 CATTCTCTTAGGAGCTAAGGAGG + Intergenic
1087248215 11:95865615-95865637 TTTTCTCCTGGAAGCAAGGGTGG + Exonic
1087652075 11:100879546-100879568 GTTTCTCTTGGGACAGAAGGTGG + Intronic
1088720262 11:112585971-112585993 TTTTCTCTCTGGAACACAGGGGG + Intergenic
1089628141 11:119764749-119764771 TTAACTCATGGGAGCAAGGGAGG - Intergenic
1089797076 11:120989496-120989518 TTTTCTTTTGGAATCCAAGGGGG + Intergenic
1090931746 11:131303945-131303967 TTTTCTGATGGCAGCAATGGCGG - Intergenic
1092006851 12:5077276-5077298 TTTCCTCTTGGGAGGCAGGGTGG + Intergenic
1092263779 12:6966006-6966028 TTTTCTCTTGGGAGCAAAGGAGG - Intronic
1092402242 12:8186596-8186618 TTTTCTCTTGGGAACTGAAGTGG - Intronic
1092927459 12:13284608-13284630 GTTTCTCTAGGATGCAAAGGAGG - Intergenic
1092983374 12:13820198-13820220 TTTTCTCTTGGGGGCTCATGTGG - Intronic
1093072929 12:14725065-14725087 TTTTCTCTTGCGGGCAGGGGTGG + Intergenic
1093945323 12:25101164-25101186 TTTTCTCTTGCTAGGAAAGCCGG + Exonic
1093984324 12:25512342-25512364 GTTGCTTTAGGGAGCAAAGGAGG + Intronic
1094272275 12:28630045-28630067 TTTTCTCTTGGGACTAGAGTAGG - Intergenic
1094355389 12:29572556-29572578 CTTTTTTTTGGGAGCATAGGAGG + Intronic
1094589525 12:31807450-31807472 TTTTCTCTTGCAGGCATAGGTGG - Intergenic
1094723348 12:33088025-33088047 TTTTCTCTTGCAGGCAGAGGCGG + Intergenic
1095409598 12:41907624-41907646 TTTTCTGGTGTGAGCAAATGTGG - Intergenic
1097369832 12:58764556-58764578 TTTTCTTTGGGAGGCAAAGGTGG + Intronic
1098902469 12:76126891-76126913 TTTTTTTTTGGGAGAGAAGGGGG + Intergenic
1099461614 12:82928848-82928870 TTTTCCATTGGAAGCAAAGAAGG + Intronic
1100870453 12:98905377-98905399 CTTTCTCTTGTGAGCCAATGTGG - Intronic
1101213107 12:102554287-102554309 CTTTCTCTAGCTAGCAAAGGAGG - Intergenic
1102066546 12:109981038-109981060 TTTTCTCTTGGTAGGCAAGGAGG - Exonic
1102171222 12:110843916-110843938 TATTCTCTTGGGAAGAGAGGAGG + Intergenic
1103116696 12:118340260-118340282 TTTGCTCTTGGGAGGGAAGGTGG - Intronic
1103389423 12:120560619-120560641 TTTTCTCTGGGGTGAAAATGGGG - Intronic
1103839860 12:123853685-123853707 TTTTCTCTTTGAAACAAAAGAGG + Intronic
1104988386 12:132610492-132610514 CTTTCTCCTGGGACCGAAGGAGG - Intronic
1105464985 13:20631546-20631568 TCTTGTCTTTGGAACAAAGGAGG + Intronic
1106999757 13:35528835-35528857 CTTTTTCTAGGGAGCAAGGGTGG + Intronic
1107272438 13:38635628-38635650 CTTCCTCTTGGGAGCAAACCTGG + Intergenic
1108579338 13:51815319-51815341 TTCTCACCTGGGAGGAAAGGGGG + Intergenic
1109207080 13:59494552-59494574 TTTTCTCTTGTTTGGAAAGGTGG - Intergenic
1109272154 13:60267277-60267299 ATTTATCTGGGGAGCAATGGAGG + Intergenic
1109339790 13:61041410-61041432 TTTTCTCTTCTGAGAAAAGGAGG - Intergenic
1110167740 13:72463733-72463755 TTTTCCTCTGGGAGCAGAGGAGG - Intergenic
1110658219 13:78025977-78025999 TTTTCTCCTGGTGGCAGAGGAGG + Intergenic
1110716476 13:78710557-78710579 TTTTCACTTGGGACCAAAAGTGG + Intergenic
1111132487 13:83995813-83995835 TTTTGTTTTGGGAGCAATGTTGG + Intergenic
1112169111 13:96951224-96951246 TTTTCTCTGGGAATAAAAGGAGG - Intergenic
1112633445 13:101187354-101187376 GTTTCCCTTGGGGACAAAGGAGG + Intronic
1112680341 13:101757327-101757349 GTGTCTTTTGGGAGAAAAGGGGG + Intronic
1113535514 13:111063224-111063246 TTTTCTCTTGTGGGCAAGGGTGG - Intergenic
1114346053 14:21796472-21796494 TTTTCTCTTGCGGGCAGGGGCGG - Intergenic
1114412499 14:22514261-22514283 TTGTCTCCTGGGATCAGAGGAGG - Intergenic
1115217535 14:31027141-31027163 TTTTTTCTTGGGAGAAGAAGAGG + Intronic
1116629051 14:47305917-47305939 GATGCTCTTGGGAGCAAAAGAGG + Intronic
1118322771 14:64763118-64763140 TTTTCTCCTGGGAGAGAAGGAGG - Intronic
1119217108 14:72877349-72877371 GTTCCTCTGGGCAGCAAAGGAGG + Intronic
1119386959 14:74263419-74263441 AGTTCTCTTGGGGGCCAAGGTGG - Intergenic
1120661273 14:87254099-87254121 TTTTCTCTTGTGGGCAGGGGTGG - Intergenic
1122310720 14:100792395-100792417 TTTTCTCTAGGTAGAAAAAGGGG - Intergenic
1122397991 14:101448457-101448479 TTTATTCCTGGTAGCAAAGGAGG - Intergenic
1124480046 15:30070587-30070609 TTTTCTCTTGAGAAGGAAGGAGG + Intergenic
1125124944 15:36209117-36209139 TTTTTTCTGGGTAGCACAGGAGG - Intergenic
1126447954 15:48771091-48771113 TTTTCTATTGGGAGTATAGATGG + Intronic
1128476004 15:67997343-67997365 CTTGCTCTTGGGGGGAAAGGGGG - Intergenic
1128695308 15:69757498-69757520 TTTTCACCTGGGGGTAAAGGAGG - Intergenic
1128840126 15:70843401-70843423 TTACCTCTAGGGAGGAAAGGTGG - Intronic
1130251966 15:82305631-82305653 TTTTCACTTGGGATCAACTGGGG + Intergenic
1130567844 15:85012851-85012873 TTTACCCTTGGGAACAAAGAAGG + Intronic
1131969099 15:97874510-97874532 TTTTGTCTGGGGAGGAAAGGAGG + Intergenic
1132758962 16:1499777-1499799 AGTTCTCGTGTGAGCAAAGGAGG - Intronic
1133169421 16:3972007-3972029 TTCTTCCTTGGAAGCAAAGGTGG - Intronic
1135468934 16:22712171-22712193 TTTCCTCTTGAGAGCAAGGTTGG + Intergenic
1135728727 16:24876905-24876927 CTTTATCTTGGGGGCAATGGGGG + Intronic
1135734333 16:24918823-24918845 TTTTCTCTTGGGAACAGAGTGGG - Intergenic
1135970251 16:27067025-27067047 TTTTCTCGAGGGAGAAAAAGGGG + Intergenic
1137270593 16:46900215-46900237 TTTCATCTAGGGAGGAAAGGGGG + Intronic
1137803608 16:51283633-51283655 CTTTCTCATGGGGGCAAAGAAGG - Intergenic
1138019242 16:53462463-53462485 TTTTATTTTGTGAGTAAAGGAGG + Intronic
1138799311 16:60007439-60007461 TTTTTAGTTGGGAGGAAAGGAGG - Intergenic
1139508352 16:67411075-67411097 TTTTTTGTTGGGAGCAGAGGTGG - Intronic
1140411929 16:74746380-74746402 TTTTTTTTTGGTAGAAAAGGGGG + Intronic
1141300333 16:82809702-82809724 TTCCCTCTTGGGAACAAAGATGG - Intronic
1141499806 16:84436259-84436281 GCTTCTCTTGGGAGCATGGGAGG + Intronic
1144712475 17:17410909-17410931 TTTACTCTTGTGAGGTAAGGTGG + Intergenic
1144733390 17:17541427-17541449 TTCTCTCCTGGGAGCTAAGTGGG - Intronic
1147808351 17:43148474-43148496 TTTTCTCTTGTGGGCAGGGGTGG + Intergenic
1148563182 17:48617980-48618002 TTTTCCCATGGGCGCGAAGGCGG - Intronic
1149319248 17:55467990-55468012 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1149491609 17:57088936-57088958 GTTGCACTTGGGAGCAAAGAAGG + Intronic
1151327477 17:73388100-73388122 CTTTCTCGAGGGAGGAAAGGAGG + Intronic
1152251121 17:79213205-79213227 GTTTCTCTTGTGAGCAGATGAGG + Intronic
1153411424 18:4798113-4798135 TTTTCTTTAGGGAACAAAGTGGG - Intergenic
1153989808 18:10386173-10386195 TGCTCTCTTGAGAGCAAAGAAGG - Intergenic
1154294209 18:13135405-13135427 TGTTTTCTTGGGTGCTAAGGAGG + Intergenic
1155889583 18:31249913-31249935 TTTTCTCATGGGAGCAAAGCAGG + Intergenic
1156605851 18:38666263-38666285 TTCCCTCTCGGCAGCAAAGGTGG + Intergenic
1156743882 18:40366062-40366084 TTTTCTTTTAGTAGCAAACGTGG - Intergenic
1157558772 18:48631809-48631831 AGTTCTCTTGGGGGTAAAGGTGG - Intronic
1160056461 18:75486604-75486626 TTATCTCTGGGGTGCAAAGTTGG - Intergenic
1160113803 18:76058366-76058388 TGTTCTCGTGGGAACAAGGGAGG + Intergenic
1161827340 19:6577102-6577124 TTATCTCTTGGGGGCAGGGGCGG - Intergenic
1162043592 19:7984826-7984848 GTTTCTATTGGAGGCAAAGGTGG - Intronic
1162427344 19:10604357-10604379 TTTTGCCTTGGGGCCAAAGGGGG + Intronic
1162986826 19:14276203-14276225 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1163927423 19:20359359-20359381 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1164082066 19:21867191-21867213 TTTTCTCTTGTGGGCAGGGGCGG - Intergenic
1166398466 19:42460179-42460201 TTTTCTCTTGTGGGCAGTGGTGG - Intergenic
1167473646 19:49688456-49688478 TTGTTTCCTGGGGGCAAAGGAGG + Intronic
925658593 2:6178608-6178630 TTTTCTCCAGGAAGGAAAGGTGG + Intergenic
927410859 2:22824786-22824808 TTTTCTCATTGGAACATAGGAGG - Intergenic
927495063 2:23546554-23546576 TTTTCTCATGGGAGTAGAGACGG - Intronic
928750448 2:34464571-34464593 TTTCTTCTTGAGAGGAAAGGGGG + Intergenic
930543931 2:52743520-52743542 TGTTCACTAGGAAGCAAAGGTGG - Intergenic
931318992 2:61158099-61158121 GGTTCTCTTTGGAGCAAGGGGGG - Intronic
931402608 2:61944838-61944860 TTTTTTTTTGGCAGCAAAGATGG + Intronic
932120124 2:69091059-69091081 TTTTCTCCTTGGAGCAAATTTGG - Intronic
933358432 2:81245127-81245149 TTTTTTATTGAGAGGAAAGGTGG + Intergenic
933788935 2:85868188-85868210 TTTTCTGTTCGGTGAAAAGGTGG + Intronic
937684775 2:124683402-124683424 TTTTTTTTGGGGAGAAAAGGTGG + Intronic
937948642 2:127366084-127366106 TTGTTCCTTGGAAGCAAAGGAGG - Intronic
938631104 2:133168682-133168704 TTTTCTCTCAGGATGAAAGGAGG - Intronic
938649047 2:133362211-133362233 GTTTGTCTTGATAGCAAAGGTGG - Intronic
940103562 2:150070742-150070764 TTTTCTCTGAGGAGAAAAGCAGG - Intergenic
940142918 2:150514217-150514239 AGTTCTCTTGGGAGGGAAGGAGG - Intronic
940576380 2:155509827-155509849 TTTTCTCTTGGTCCCAAATGTGG - Intergenic
940811540 2:158248228-158248250 TTGTCTCTGGGGAGGAAAGAAGG + Intronic
941214836 2:162693662-162693684 ATTTCTCTTGGGAAGAAAGTTGG + Intronic
942363748 2:175199831-175199853 TTTTCTCTTGCGGGCAGCGGTGG + Intergenic
942400305 2:175594551-175594573 TTATATCTTGGGAGCCAAGATGG - Intergenic
943023267 2:182600013-182600035 TTTTCTCCTGGGAGTAGAGTAGG - Intergenic
943949890 2:194120143-194120165 TTGTGTGTTGGGAGCAAGGGAGG + Intergenic
943993266 2:194725701-194725723 TTATCACCTGGGAGCAAGGGTGG - Intergenic
945068305 2:205965858-205965880 TTCTCTCTGGAGAGCAAGGGAGG - Intergenic
945497028 2:210520945-210520967 ATTTCTCTTGGGGGAAAAAGGGG + Intronic
945507685 2:210661640-210661662 TTTTATGTTGGGAGGAGAGGTGG + Intronic
945867023 2:215187967-215187989 GTTTCTCTTGGGAGCACTGGGGG - Intergenic
946804932 2:223462607-223462629 TTTTCTCTTGCGGGCAGGGGCGG - Intergenic
946895815 2:224322317-224322339 TTTTATCTTGGAAGGAAAGTCGG + Intergenic
947048942 2:226020430-226020452 TTCTCCCTTGGGAGAAAAGGTGG - Intergenic
947364032 2:229375579-229375601 TTTCCCCTTGGAAGCAATGGTGG - Intronic
947497308 2:230647229-230647251 TTTTCTCTTGCGGGCAGGGGCGG + Intergenic
948170580 2:235898492-235898514 TTTTCACTTTGTAGCACAGGCGG - Intronic
1168740633 20:188204-188226 TGTTCACTTGGGACCATAGGAGG - Intronic
1168943601 20:1733314-1733336 TTTTCTCTTGTGGGCAGGGGTGG + Intergenic
1171298541 20:24039743-24039765 TTTCCACGTGGGGGCAAAGGAGG - Intergenic
1173116664 20:40249840-40249862 TTTTCTCTTTGCAGAAAAGAAGG - Intergenic
1173802853 20:45905611-45905633 TTTTCTCTTTGTAGAGAAGGAGG + Intronic
1174089884 20:48038441-48038463 TTTTCCCTTTGGAGAAAACGAGG - Intergenic
1174126406 20:48310132-48310154 TTTTCCCTTTGGAGAAAATGAGG + Intergenic
1174678382 20:52379771-52379793 TTTTCTCTTGGGGAAAAAGGTGG + Intergenic
1176522742 21:7837119-7837141 ATTTCTCTTGGCAGCAAGAGTGG + Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178497126 21:33096653-33096675 TTTTCGGTGGGGAGCAAAGAAGG - Intergenic
1178656762 21:34467131-34467153 ATTTCTCTTGGCAGCAAGAGTGG + Intergenic
1179037677 21:37773515-37773537 TGTTGTCTGGGGAGGAAAGGGGG - Intronic
1183385313 22:37510747-37510769 TATTCTCATGGCAGAAAAGGAGG + Intronic
1183636710 22:39068111-39068133 TTTTCTCTTGCGGGCAGGGGTGG + Intronic
1184627079 22:45743674-45743696 TTTTGTCTTCTGGGCAAAGGAGG - Intronic
1185191232 22:49437870-49437892 ATTTCTCTGGGGAGGAATGGAGG - Intronic
1185258805 22:49850302-49850324 GTTTCTCTCGGGTGCAGAGGAGG - Intergenic
949592485 3:5508894-5508916 TTTTCTCTTGTGGGCAGGGGTGG + Intergenic
951613591 3:24519474-24519496 GTTTCACTTTGAAGCAAAGGGGG - Intergenic
952376222 3:32769868-32769890 CTTTCTGTTTTGAGCAAAGGCGG + Exonic
952753467 3:36844626-36844648 TTTTCCTTTGGGAGAGAAGGTGG + Intronic
953241894 3:41156894-41156916 TTTTGTCTTGTGAGCAGAGTGGG - Intergenic
953834717 3:46332594-46332616 TTATCTCTTGAGGGCAGAGGTGG + Intergenic
953937276 3:47056473-47056495 TTCTCCCTTGGGAGAAATGGAGG + Intronic
954113466 3:48449505-48449527 ATTACTCTTGAGAGCAAAGCAGG - Intronic
954162079 3:48729977-48729999 TTTTCTCTTGCGGGCAGGGGTGG + Intronic
954907048 3:54071741-54071763 TTTTCTCAGGGGAAGAAAGGGGG + Intergenic
954951890 3:54482178-54482200 TTGTTACTTGGGAGCAGAGGAGG + Intronic
955798403 3:62661587-62661609 TTTTGTCCTGGGAGCAATGAGGG + Intronic
955982130 3:64537774-64537796 TTTTCTCTTAGGTTTAAAGGAGG - Intronic
957197289 3:77085607-77085629 TTGTATCTTGGAAACAAAGGAGG - Intronic
957319730 3:78614096-78614118 TATTCTCGAGGGAGCACAGGAGG - Intronic
957394142 3:79618529-79618551 TTTTCTCTTGTGGGCAGGGGTGG - Intronic
957890944 3:86356506-86356528 TATTCACTTGGGAGAAAAAGAGG - Intergenic
958258145 3:91348528-91348550 TTTTCTCCTGGGAACAAAATCGG - Intergenic
958898713 3:99860604-99860626 TTTCATCTTGAGAACAAAGGAGG + Intronic
959157051 3:102679478-102679500 TTTTCTCTTGGCCCCTAAGGGGG + Intergenic
959513681 3:107241551-107241573 TTGTCATTTTGGAGCAAAGGAGG - Intergenic
960835660 3:121904096-121904118 TTTTCTCTTTGTAGCAATTGTGG + Intronic
961831931 3:129627339-129627361 TGGTCACTTGGGAGCAAAGCTGG + Intergenic
962259384 3:133893443-133893465 TGTGATTTTGGGAGCAAAGGGGG + Intronic
963113807 3:141708637-141708659 TTTTCTCCTGTGTGCAAAGGGGG + Intergenic
964589883 3:158349479-158349501 TTATTTGGTGGGAGCAAAGGCGG - Intronic
965462583 3:168985972-168985994 TTTTCTCTTAGGAGGAAAACTGG - Intergenic
965668614 3:171122685-171122707 TTCTCTCTTACTAGCAAAGGAGG + Intronic
966223927 3:177577871-177577893 TTCTTTCTTGGGGGCAAAGATGG - Intergenic
968751792 4:2393794-2393816 TTTACTGTTGTGAGCAAAGCTGG + Intronic
969778391 4:9377003-9377025 TTTTCTCTTGGGAACTGAAGTGG + Intergenic
969865514 4:10074582-10074604 TTTGCTCTTGAGAGCAGAAGAGG + Exonic
969913717 4:10468924-10468946 TTTTATTTTGGAAGAAAAGGAGG + Intergenic
970436557 4:16041143-16041165 TTTGCACTAGGGTGCAAAGGCGG + Intronic
970585939 4:17514256-17514278 ATATCTCTGGGGAGCAAAGTTGG - Intergenic
972066645 4:34953800-34953822 TCTTCTATTGGCAGCAAATGAGG + Intergenic
974363076 4:60908429-60908451 TTGTATTTTGGGAGAAAAGGTGG - Intergenic
974730265 4:65854977-65854999 TTTTATGTTGTGATCAAAGGTGG + Intergenic
974968811 4:68801322-68801344 GTTTATCTGGGGAGCAATGGAGG - Intergenic
975659896 4:76678151-76678173 TTTTCCTTTGAGAGCCAAGGAGG + Intronic
977558915 4:98512813-98512835 TTTTCTCTTGGGATAAATGAAGG + Intronic
979443251 4:120778007-120778029 TTTTATGTTGGGAGCAAAACTGG - Intronic
980675447 4:136073119-136073141 TTTTATTTAGGGAGCAAATGTGG + Intergenic
980862257 4:138513642-138513664 TTCTCTCTTTGGAGCAAAATAGG - Intergenic
984500983 4:180558264-180558286 TTTGCTTTGGGGAGCTAAGGGGG + Intergenic
987332121 5:16866626-16866648 TTTCCTCTTGAGAGAAAAAGGGG + Intronic
990225576 5:53648745-53648767 TTTTTTCTTGGTTGCAAAGGAGG - Intronic
992034522 5:72759444-72759466 TTGTTTCTTGGGAGCAAAGAGGG - Intergenic
993005887 5:82427900-82427922 TTTTCTCTTTGGAGAAGAGTTGG + Intergenic
993339130 5:86700901-86700923 TTTTCTCTTTGTATCAAAGAAGG - Intergenic
993748712 5:91637707-91637729 TTTTCTCCTTAGAGCCAAGGAGG - Intergenic
994211364 5:97090425-97090447 TTTCCTCTTTGGAGCAAGGTAGG - Intronic
994855951 5:105119151-105119173 ATAACTCTTGGGAGCAAAGTTGG - Intergenic
996219706 5:120915574-120915596 ATTTCTGTTTGGAGTAAAGGGGG + Intergenic
997754452 5:136383112-136383134 TTTTCTCTTGCGGGCAGGGGCGG - Intronic
1000641696 5:163710659-163710681 TATTGTATTGGGAGCTAAGGAGG + Intergenic
1000647143 5:163772632-163772654 ATTTCCTATGGGAGCAAAGGAGG + Intergenic
1001533798 5:172483763-172483785 TTCTCTCTTTGGAGCTAAAGAGG + Intergenic
1003271529 6:4611825-4611847 TGCTCTCTTGGGAGCACGGGTGG - Intergenic
1003782002 6:9439678-9439700 TTTTCTTTTGGGAGTGGAGGAGG - Intergenic
1003861947 6:10330431-10330453 TTTTCTCTTGGGAGAAAGAAAGG - Intergenic
1005672376 6:28120112-28120134 TTTTTCCTTGGGGGCAGAGGAGG + Intergenic
1005934681 6:30511730-30511752 CTTTCTCTTGGGGGTGAAGGTGG - Intergenic
1006049950 6:31334601-31334623 TTTTATTTTGGGAGCAAAAGGGG - Intronic
1007494654 6:42251459-42251481 TTTTCTCTGTGGATAAAAGGGGG + Intronic
1008209824 6:48707179-48707201 TTTACACTTGGGAGCAAGGATGG - Intergenic
1008292901 6:49739447-49739469 TTTTCTCATGTGTGCAAAAGAGG + Intronic
1008997108 6:57672180-57672202 TTTTCTCCTGGGAACAAAATCGG + Intergenic
1009185626 6:60571516-60571538 TTTTCTCCTGGGAACAAAATCGG + Intergenic
1010376031 6:75171628-75171650 TTTTCTCTTGGGAGAGGAGGTGG - Intronic
1011359151 6:86503256-86503278 TTTGCTCGTAGGAGAAAAGGGGG + Intergenic
1012501623 6:99894938-99894960 TCTTCTCTTGGCCACAAAGGTGG + Intergenic
1013003722 6:106050620-106050642 TTTTCTCTTGGCAGGTAAGATGG - Intergenic
1014947295 6:127514573-127514595 TGCTCTCCTGGGAGCAAAGGTGG - Intronic
1015137785 6:129892955-129892977 TTTTCCCTTTCAAGCAAAGGAGG - Intergenic
1016934811 6:149441741-149441763 TGGTCTCTTGGGAGAGAAGGAGG - Intergenic
1017036400 6:150271219-150271241 AGTTATCTTGGGAGCAAAGTGGG - Intergenic
1017234687 6:152106941-152106963 TTTTGTATTGGAAGCAATGGAGG - Intronic
1017445697 6:154505426-154505448 TTCTGTCCTGGGACCAAAGGTGG + Intronic
1020605943 7:10336998-10337020 ATTTCTCTGGGAAGCAGAGGTGG + Intergenic
1021237001 7:18154431-18154453 TTTTCTCTTGGGATGAAATTTGG + Intronic
1022539336 7:31121547-31121569 TTCTTTCTTGGGAGCAAATAAGG - Intergenic
1027328730 7:77068826-77068848 TTTCCTCTTAGGAGGAAAGGTGG + Intergenic
1027524486 7:79249967-79249989 TTATCCCTTGGAAGCAAAGATGG + Intronic
1027879017 7:83808859-83808881 TTTTCTGTTGGAAGGAAAGAAGG + Intergenic
1028590190 7:92485019-92485041 TTTTCTCTTAGGGGCAGGGGCGG + Intergenic
1029787040 7:102802541-102802563 TTTCCTCTTAGGAGGAAAAGTGG - Intronic
1030709000 7:112727327-112727349 TTCTCTCTTGGGTGGAAAGTAGG + Intergenic
1030979868 7:116173837-116173859 CTTTGTTCTGGGAGCAAAGGAGG - Intergenic
1032497633 7:132374700-132374722 TGTTTTCTTGGGGGCAAAGCTGG - Intronic
1032785973 7:135199697-135199719 TTCTGCCTTGGAAGCAAAGGTGG + Intronic
1033426616 7:141250583-141250605 TGTTCTCATGGGAGCTAAGTGGG + Intronic
1035085695 7:156255536-156255558 TTTTCTCCTGGTCTCAAAGGTGG + Intergenic
1035383627 7:158456272-158456294 TCTTCTCTGTGGAGCAATGGGGG - Intronic
1035383685 7:158456578-158456600 TCTTCTCTGCGGAGCAATGGGGG - Intronic
1036275848 8:7350999-7351021 TTTTCTCTTGGGAACTGAAGTGG + Intergenic
1036402026 8:8417597-8417619 CTTCCTCTTGGAAGCAAAAGAGG - Intergenic
1036840835 8:12120113-12120135 TTTTCTCTTGGGAACTGAAGTGG - Intergenic
1037057974 8:14468519-14468541 TTAGATCTTGAGAGCAAAGGTGG + Intronic
1038784330 8:30597265-30597287 TTATCTCATAGGAGCAAAGAAGG + Intronic
1040513935 8:48119336-48119358 TTTCCTCTGGGGAGGAAGGGTGG + Intergenic
1040615852 8:49037657-49037679 TTTTCTCCTTGGAGCACAGCTGG + Intergenic
1041448531 8:57981354-57981376 TTTTCTCTTGTAAGCAAATCTGG - Intergenic
1042537538 8:69873740-69873762 TTTTCTCCTGGTAGCGGAGGAGG - Intergenic
1042555457 8:70030725-70030747 TTATCCCTTGGGAGTGAAGGAGG - Intergenic
1042700006 8:71601819-71601841 ATTTCTCTTGGCAGCATAGGGGG + Intergenic
1043060611 8:75497166-75497188 TTCTCTATTGGCAGAAAAGGTGG + Intronic
1043885239 8:85591662-85591684 GCTTCTCTTGGGAGCCAGGGTGG - Intergenic
1044229186 8:89756079-89756101 TTTTCTCTTGCGGGCAGGGGTGG - Intergenic
1048212731 8:132468925-132468947 TTTTCTCTAGGGAACAAATTGGG - Intronic
1048557798 8:135497554-135497576 TCTTCTCTTGGGCGTGAAGGGGG + Intronic
1049043413 8:140129700-140129722 TTTTCTCTTGGGGAGAAAGCTGG - Intronic
1050019240 9:1266753-1266775 CTTTATTTTGGGAGCAAAGAAGG + Intergenic
1050123798 9:2335497-2335519 CAATCTCTTGGCAGCAAAGGAGG + Intergenic
1051552992 9:18350878-18350900 TTTTCTATTAGGAGAAAAGGTGG + Intergenic
1051724725 9:20077521-20077543 TCTTCTCTTGGGACTAAAGAAGG - Intergenic
1051994596 9:23200136-23200158 TTTCCTCTCTGGAGAAAAGGTGG - Intergenic
1052713713 9:32089532-32089554 ATTTCTCTTGGGAGCACTGTTGG - Intergenic
1052859950 9:33431499-33431521 ATCTCTCTTGGGACCAGAGGTGG + Intergenic
1055604184 9:77950588-77950610 TTATCTCTAGGGAGGAAATGGGG + Intronic
1056396020 9:86181907-86181929 TTTTCTTTTAGGCGGAAAGGAGG + Intergenic
1056521751 9:87408246-87408268 TTTTCTCTTGCGGGCAGGGGCGG + Intergenic
1056536156 9:87529610-87529632 TTATTTCTTGGCTGCAAAGGTGG + Intronic
1057260758 9:93581864-93581886 TTTTCTGGTGGGAGCAAGTGTGG + Intronic
1057948539 9:99351384-99351406 TTTTCTCTCTGTGGCAAAGGAGG + Intergenic
1058610342 9:106769387-106769409 TTTTCTCCTGGGAGAAAAGAAGG - Intergenic
1059652185 9:116325248-116325270 TTTTCTCTGGTGAGAAAATGAGG - Intronic
1062258982 9:135648472-135648494 TTTTCACTTGGTACCAAAGATGG - Intergenic
1186240452 X:7560016-7560038 TTATCTCTGGAGAACAAAGGAGG + Intergenic
1187107105 X:16254541-16254563 TTGTCTCTTAGGAGCCCAGGAGG + Intergenic
1187269634 X:17768189-17768211 TTTTCCCCTGGAAGAAAAGGAGG - Intergenic
1188201279 X:27294725-27294747 TTTTCTCTTGTGGGCAGGGGCGG + Intergenic
1188643740 X:32538393-32538415 TTTTCTCTTGTGGGCAGGGGCGG - Intronic
1190418776 X:50206740-50206762 TTTTCTTTTGGTAGAAATGGAGG - Intronic
1191123442 X:56929153-56929175 TTGTCTCTTGGATGCAAAGGCGG + Intergenic
1193086110 X:77448646-77448668 TTGTCTCTTGGGCCCAAAGCAGG + Intronic
1193912510 X:87323244-87323266 TTTTGTCTTGTTAGCAAAGACGG - Intergenic
1195884877 X:109627183-109627205 TTTTTTTTTGAGAGGAAAGGAGG + Intronic
1196463717 X:115952737-115952759 CCTTCCCTTGGGAGCAAAGAGGG - Intergenic
1196634431 X:117985614-117985636 GTTCATCTTTGGAGCAAAGGTGG + Intronic
1197238941 X:124102509-124102531 TTTTCTCTTGTACTCAAAGGGGG + Intronic
1198017820 X:132629837-132629859 TATTATCATAGGAGCAAAGGTGG - Intronic
1199376197 X:147112548-147112570 TTTTCTCTGGGATGCAAAGTTGG + Intergenic
1200852329 Y:7897247-7897269 GTTTCTCTTGGGATCATAGCAGG + Intergenic
1201460326 Y:14215404-14215426 TTATCTCTGGAGGGCAAAGGAGG + Intergenic