ID: 1092264382

View in Genome Browser
Species Human (GRCh38)
Location 12:6969970-6969992
Sequence CTGTGGTCGTGGAGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092264382_1092264387 5 Left 1092264382 12:6969970-6969992 CCTGCTCCTCTCCACGACCACAG 0: 1
1: 0
2: 2
3: 27
4: 335
Right 1092264387 12:6969998-6970020 GAGAGATTCTCTTGTCCCTCTGG 0: 1
1: 0
2: 0
3: 20
4: 240
1092264382_1092264390 30 Left 1092264382 12:6969970-6969992 CCTGCTCCTCTCCACGACCACAG 0: 1
1: 0
2: 2
3: 27
4: 335
Right 1092264390 12:6970023-6970045 AACAACAGTTTGTATGCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092264382 Original CRISPR CTGTGGTCGTGGAGAGGAGC AGG (reversed) Intronic
900087774 1:906639-906661 CTGTGGTCATGAAGGAGAGCCGG + Intergenic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
900518292 1:3093650-3093672 CTGTGGTCGTGGTGAGAAGGAGG + Intronic
900785312 1:4645940-4645962 CGGTGGTGGTGGTGAGGAGAGGG - Intergenic
900914840 1:5629558-5629580 CTGTGATGATGGAGTGGAGCTGG + Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901029873 1:6300817-6300839 CTGTGTTTGTGGAGAGGGACCGG - Intronic
902912183 1:19607843-19607865 GTGTGGTGTTGGAGAAGAGCTGG + Intronic
903917248 1:26773509-26773531 CTGGGGGAGTGGACAGGAGCTGG - Intronic
904009050 1:27379709-27379731 CTGTGGCTGTGGGCAGGAGCTGG - Exonic
904043147 1:27595591-27595613 CTGTGGTTTTGGGGAGGAGCTGG + Intronic
904607426 1:31705372-31705394 CTGTGGTCCCAGTGAGGAGCTGG + Intergenic
905224674 1:36471544-36471566 CTGTGGTGTTGCAGAGGGGCAGG + Exonic
906141754 1:43537877-43537899 CTGGGGTCATGCTGAGGAGCTGG + Intronic
906353040 1:45080024-45080046 CTTTGCTCGAGGAGAGGAGAGGG - Intronic
906662116 1:47590429-47590451 CTGTGCTCCTGGAGTGGGGCTGG + Intergenic
908496161 1:64696977-64696999 CTGTGCTGGAGGAGATGAGCAGG + Intergenic
908807814 1:67949009-67949031 GTGTGCTGGTTGAGAGGAGCTGG - Intergenic
912218175 1:107640784-107640806 CTTTGGTTGTGGAGAGGAAGAGG + Intronic
914346897 1:146807639-146807661 CTCTGGTGGTGGGAAGGAGCTGG + Intergenic
914915377 1:151816121-151816143 CTGTGGTGGTGGAGGTGTGCAGG + Intronic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919896698 1:202013479-202013501 TGGTGGTCCTGGAGAGGAGGAGG + Intronic
920276249 1:204807184-204807206 CTCTGATCCTGGAGCGGAGCTGG - Intergenic
921164732 1:212498663-212498685 CTGTGGTCGTGGGCGGGAGGGGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922439894 1:225646369-225646391 CTGGGGTCGGGGAGATGAGGGGG - Intronic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
924619783 1:245650468-245650490 CTGTGGTCCTTCAGATGAGCTGG - Intronic
1062817744 10:513434-513456 CTGTGGTGGATGAGAGGTGCGGG - Intronic
1067044963 10:42980324-42980346 GTGATGTCCTGGAGAGGAGCTGG + Intergenic
1067817558 10:49493842-49493864 CTTTGGTGGTGTAGAGGAGCAGG - Intronic
1067838301 10:49655243-49655265 CTGTGGCCGTGGGGTGGGGCGGG - Intronic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069940961 10:71954952-71954974 CTGGACTAGTGGAGAGGAGCAGG + Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1072205802 10:93204498-93204520 TTGTTGCCGTGGAGAGAAGCAGG - Intergenic
1072335672 10:94395836-94395858 CTGTGCTCTTGGCCAGGAGCAGG - Intergenic
1073100240 10:101002662-101002684 CCGTGGTGGCGGGGAGGAGCTGG - Exonic
1074364093 10:112844382-112844404 CTGAGGTCATGGAAAGGAGAAGG + Intergenic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075492165 10:122880324-122880346 CTGTTTTGGTGGAGAGGAGGTGG - Intergenic
1076493702 10:130882487-130882509 CTGTGGTTGTGAGGATGAGCTGG - Intergenic
1076605882 10:131689613-131689635 CGGTGCTCGTGCAGAGGCGCGGG - Intergenic
1077093088 11:788350-788372 CTGTGGTTGTTGAGAAGGGCAGG + Exonic
1077126764 11:942949-942971 CAGTGAGCGAGGAGAGGAGCTGG + Intronic
1077914651 11:6603532-6603554 CTGTGCACGTGGAGAAGAGCGGG - Exonic
1078470575 11:11582868-11582890 CTGTGGCTGTGGTGAGGAGTTGG - Intronic
1079485135 11:20928234-20928256 CTGTGGTCCTGGAGTGGACTGGG + Intronic
1081154307 11:39670137-39670159 CTGAGAGCCTGGAGAGGAGCTGG - Intergenic
1081646476 11:44793823-44793845 CTGAGGCCCTGGAGAGGAGGAGG + Intronic
1081992503 11:47345415-47345437 ATGGGGACGGGGAGAGGAGCTGG - Intronic
1083622418 11:64055750-64055772 CTGAGGCAGTGCAGAGGAGCAGG - Intronic
1084188678 11:67488995-67489017 CTGTGGTGGGGGTGAGGAGGGGG + Intronic
1084491369 11:69480346-69480368 GTGCTGGCGTGGAGAGGAGCTGG + Intergenic
1085518861 11:77126635-77126657 GTGTGGTGGTGGGGAGAAGCAGG + Intergenic
1085850851 11:80117928-80117950 ATGTGGCATTGGAGAGGAGCTGG - Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087065734 11:94026448-94026470 CTGAGGTAGGGGAGGGGAGCAGG - Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1089794607 11:120970246-120970268 GTGTGGTGGTGCAGAGGTGCTGG + Intronic
1089849044 11:121481200-121481222 CTGTGCACTAGGAGAGGAGCTGG - Intronic
1089849088 11:121481416-121481438 CTGTGCACTAGGAGAGGAGCTGG - Intronic
1090416229 11:126542361-126542383 CTTTGTTAGTGGAGAAGAGCAGG + Intronic
1091451557 12:575429-575451 CTGTAGTCCTGGAGCAGAGCAGG - Intronic
1091753693 12:3038351-3038373 CTCTGCTCTTGGAGAGGACCGGG - Intronic
1091847152 12:3666076-3666098 CTCTGGTGGTGGGGAGGAGGGGG + Intronic
1092008543 12:5089226-5089248 CTGTGGTTGTGCAGAGCACCAGG - Intergenic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1098645697 12:72898041-72898063 CTGTAGACGAGGAGAGGAGGTGG + Intergenic
1100164290 12:91898871-91898893 CTGTGGTGGAGAAAAGGAGCAGG - Intergenic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1102232530 12:111273449-111273471 CTGGGGTAGTGGGTAGGAGCTGG - Intronic
1102465898 12:113130710-113130732 GGCTGGTCGGGGAGAGGAGCTGG + Intronic
1102871217 12:116415823-116415845 ATGGGGGCGTGGGGAGGAGCAGG + Intergenic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1104090501 12:125512928-125512950 CTGATGTCCTGGAGAGGAGAGGG - Intronic
1104283149 12:127396674-127396696 CTGGTGTCCTGGAGAGGAGCGGG + Intergenic
1105271868 13:18884112-18884134 TTGTTGTCGTGGAGAAGAACTGG - Intergenic
1105849722 13:24323209-24323231 CTGTGGTTGTTGAGAAGGGCGGG - Intergenic
1111507535 13:89213633-89213655 CTGGGGTGGTGGGGAGGAGAGGG - Intergenic
1111991034 13:95117411-95117433 CAGTGGCCCTGGGGAGGAGCTGG + Intronic
1113030600 13:105990013-105990035 CGGTGGTGGTGCCGAGGAGCTGG - Intergenic
1115141603 14:30177680-30177702 CTGGGGTTGTGGGGAGGAGGGGG + Intronic
1118982417 14:70727536-70727558 CTGTGGTCCTGGTCGGGAGCAGG - Intronic
1119802464 14:77458009-77458031 CGGTGGGAGTGGGGAGGAGCCGG + Exonic
1120831767 14:89003797-89003819 CTGTGGCCTTGGAGATCAGCAGG - Intergenic
1122309176 14:100783733-100783755 GTGTGGTTGAGGAGGGGAGCTGG + Intergenic
1122484152 14:102066650-102066672 CTGTGGTAGTGCAGAGGGGTTGG - Intergenic
1122597355 14:102902698-102902720 CTGTGGCCTGGGAGAAGAGCTGG + Intronic
1202841417 14_GL000009v2_random:124783-124805 CGGTGGTCGTGTAGCTGAGCAGG - Intergenic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123486309 15:20742779-20742801 GTGTTGTCGTGGAGAAGAACTGG - Intergenic
1123542800 15:21311835-21311857 GTGTTGTCGTGGAGAAGAACTGG - Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1123933233 15:25181904-25181926 CTGGGGTCGTGTGGGGGAGCCGG + Intergenic
1123948875 15:25251931-25251953 CTGGGGTGGTTGAGTGGAGCTGG + Intergenic
1124650364 15:31469489-31469511 CTGTGCTCTTGGAGGGGGGCAGG - Intergenic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1129190029 15:73931733-73931755 CTGTGGAGGTGGGGTGGAGCAGG - Intronic
1129194714 15:73956888-73956910 CTGTGGTTGTGGTGTGGATCCGG - Intergenic
1129467426 15:75731808-75731830 ATGTGGGCGTGGAGAGGAAGAGG - Intergenic
1129566105 15:76625135-76625157 CTGGGGGTGTGGAGATGAGCTGG + Intronic
1129726043 15:77902260-77902282 CTGTGTTTGTGGTGAGGACCGGG - Intergenic
1130862543 15:87903918-87903940 CTGAGGTTGTGGAGAGGGTCTGG - Intronic
1132120006 15:99168373-99168395 TTGTGGTCATGGAGGGGGGCTGG - Intronic
1202951118 15_KI270727v1_random:38965-38987 GTGTTGTCGTGGAGAAGAACTGG - Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133741090 16:8652067-8652089 CCGTGGAAGTGGAGTGGAGCTGG - Intergenic
1135629718 16:24026703-24026725 CCTAGGTCTTGGAGAGGAGCTGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136484975 16:30565864-30565886 CTGGGGTCGGGGAGAGTAGGGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139987085 16:70907631-70907653 CTCTGGTGGTGGGAAGGAGCTGG - Intronic
1141673681 16:85506356-85506378 ATGTGGGGGTGGGGAGGAGCAGG + Intergenic
1141749217 16:85946995-85947017 CTGGGGTCTTGGAGGGGAGCAGG - Intergenic
1141785263 16:86195456-86195478 CTGTGGTTTTGGAGAGGACCTGG - Intergenic
1142188291 16:88705302-88705324 CTGAGGTGGTGGAGTGGAGGGGG - Intronic
1142373159 16:89694120-89694142 CTGGGCTGGGGGAGAGGAGCCGG + Intronic
1142733868 17:1882148-1882170 CAGTGGTGGCGGAGAGGAGCTGG - Intronic
1143557831 17:7673571-7673593 CTTTGGCTGGGGAGAGGAGCTGG + Exonic
1143904662 17:10198850-10198872 GGGCGGCCGTGGAGAGGAGCTGG + Intergenic
1145023905 17:19453356-19453378 CTGTGGCTGTGGACAGGAGCTGG + Intergenic
1145276951 17:21437245-21437267 GTGGGGTCATGGAGAGGAGCCGG + Intergenic
1147133173 17:38420539-38420561 CTGTGATGGTGGTGAGGAGAGGG + Intergenic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148656908 17:49291284-49291306 CTGTGTTCATTCAGAGGAGCTGG + Intronic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1150206496 17:63412516-63412538 CTGTGGGCTTGGGGAGCAGCTGG - Intronic
1150433788 17:65139076-65139098 CTGGGGTGGAGGAGGGGAGCTGG - Intronic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151425715 17:74029851-74029873 CTGTGGGGGTGGAAAGCAGCTGG + Intergenic
1151828573 17:76537132-76537154 CTGAGGCCGGGGAGAGGAGGGGG + Intronic
1151857793 17:76735771-76735793 CTGTGGGCGTGTATTGGAGCAGG - Exonic
1152285445 17:79410053-79410075 GAGTGGCAGTGGAGAGGAGCAGG - Intronic
1152848061 17:82614455-82614477 CTGTGGGCCTGAAGAGGCGCCGG - Intronic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154370905 18:13762321-13762343 TTGTGTTCAGGGAGAGGAGCTGG + Exonic
1155100945 18:22609240-22609262 CTGTGCTCTAGGGGAGGAGCAGG + Intergenic
1156202685 18:34852480-34852502 GGGTGGTGGTGGAGATGAGCTGG - Intronic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1157161665 18:45319143-45319165 CAGTGGTCCTAAAGAGGAGCTGG - Intronic
1157807582 18:50669545-50669567 ATGTTGTAGTGGAGATGAGCAGG - Intronic
1157833661 18:50879336-50879358 CGGGGGTCCGGGAGAGGAGCGGG + Intronic
1158045658 18:53152620-53152642 CTGTTGTCATGGAGAAGAGGAGG - Intronic
1159173425 18:64802906-64802928 GTGTGGTATTGGAGAGGAACAGG + Intergenic
1159612161 18:70538137-70538159 ATGTGGTGGTGCAGAGGAGATGG + Intergenic
1160026038 18:75217058-75217080 CTGTGGTGGTGGAGAGGCCTGGG + Intronic
1160212083 18:76889381-76889403 CTGTGGTCTAGGGGAGAAGCGGG - Intronic
1160774029 19:846597-846619 CTGTGGTCCTAGAGGGGAGTGGG - Intronic
1161199361 19:3005969-3005991 CTGGGGTCGGGGAGAGAAGCAGG + Intronic
1162486296 19:10962367-10962389 CTGCAGTCTTGGAGGGGAGCGGG + Intronic
1163884017 19:19950166-19950188 CTGTTGTTGGAGAGAGGAGCTGG - Intergenic
1165038913 19:33055014-33055036 CTGTGGCCTTGGAGAGGGGAGGG - Intronic
1165152198 19:33767327-33767349 CTGTGAGCCTAGAGAGGAGCGGG + Intronic
1165391809 19:35543324-35543346 CTGTGGTCTTGGGGAAGAGAAGG - Exonic
1167765341 19:51478816-51478838 CAGGGGTCGGGGAGAGGAGAAGG + Intronic
1168648430 19:58076847-58076869 CTGGGGCCTTGGTGAGGAGCTGG + Intronic
924978318 2:197683-197705 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978329 2:197735-197757 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978340 2:197787-197809 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978350 2:197839-197861 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978361 2:197891-197913 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978372 2:197943-197965 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978383 2:197995-198017 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978394 2:198047-198069 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978405 2:198099-198121 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978415 2:198151-198173 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978425 2:198203-198225 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978436 2:198255-198277 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978447 2:198307-198329 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978458 2:198359-198381 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978469 2:198411-198433 CTGTTGACGTGGAGACGCGCGGG + Intergenic
924978480 2:198463-198485 CTGTTGACGTGGAGACGCGCGGG + Intergenic
925420658 2:3708131-3708153 CGGTGGGGGTGCAGAGGAGCTGG + Intronic
925955544 2:8960554-8960576 CTATGGTTGTGGAGATCAGCGGG - Intronic
926991810 2:18688244-18688266 CTGGGGTCGGGGAGCGGAGTTGG + Intergenic
927783090 2:25954890-25954912 CAGTGGCTTTGGAGAGGAGCAGG - Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929701959 2:44169496-44169518 CTGAGGTCTGGGAGAGGCGCAGG + Intronic
930052441 2:47226928-47226950 CTGTAATCGCGCAGAGGAGCTGG - Intergenic
930218920 2:48726016-48726038 CTGTGGTGGGGGAGAGGGGTGGG - Intronic
930349222 2:50228429-50228451 CTGTGATCGTGTAGATGAGTGGG + Intronic
931928081 2:67096984-67097006 GTGTGGTAATGGAGAGGATCTGG + Intergenic
932580308 2:72989057-72989079 CGTTGGTCATAGAGAGGAGCTGG - Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
934540985 2:95174955-95174977 GTGTGGTCCTGGTGAGGAGGAGG - Intronic
935401446 2:102664551-102664573 GTGTGGGCGGGGAGAGGAGGTGG + Intronic
935998333 2:108798690-108798712 GTGTAGGCGTGGAGAGGAGGAGG - Intronic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
937701673 2:124869143-124869165 ATGTGGTCCTGGGGAGGAGAGGG - Intronic
937859648 2:126697651-126697673 CCGTGGTGGGGGAGATGAGCTGG + Intergenic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
940122469 2:150282083-150282105 GTGTGGGCGTGGAGTGGATCAGG - Intergenic
944661095 2:201922622-201922644 CGGTGGTTGTGGAGGGGAGTGGG - Intergenic
945931953 2:215864317-215864339 GAGGGGTGGTGGAGAGGAGCAGG - Intergenic
946025242 2:216667990-216668012 CTGAGATTGGGGAGAGGAGCGGG + Intergenic
946127018 2:217571756-217571778 GTGTTGTCATGGAGAGGAGGAGG + Intronic
946192241 2:218013703-218013725 CTGTGGCTGAGGAGAGGTGCGGG - Intergenic
946776275 2:223144892-223144914 CTGTGGTCCTATGGAGGAGCTGG - Intronic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
947286347 2:228519762-228519784 CTGTGGTGGTGGGGTGGAGGTGG - Intergenic
948355577 2:237374614-237374636 CCGTGGTCGTGAAGAGGGGTGGG - Exonic
948492724 2:238323843-238323865 GTGTGGTGGTTGAGAGGAACAGG + Intronic
948798530 2:240419528-240419550 TCGTGGGTGTGGAGAGGAGCTGG - Intergenic
948981369 2:241496589-241496611 CTGTGGCCGAGCAAAGGAGCAGG - Intronic
1168831409 20:847054-847076 CGGTGGGCGTGGAGAGGGGGTGG + Intronic
1168875016 20:1165332-1165354 CTTGGGAAGTGGAGAGGAGCTGG - Exonic
1169430241 20:5530038-5530060 CTGGGGTGGTGGAGAAGACCTGG - Intergenic
1169883480 20:10372672-10372694 CTGTTGTCGGGGGGAGGAGGGGG - Intergenic
1170372675 20:15666763-15666785 CTGTGGTTGTGCAGGGGTGCTGG - Intronic
1171037735 20:21729357-21729379 CTGGGGTGCTGGGGAGGAGCGGG + Intergenic
1172857844 20:38021664-38021686 CTGTGGTCCTGGAAAGTAGTTGG + Intronic
1172937331 20:38629583-38629605 CGGTGCTCCTGCAGAGGAGCAGG + Exonic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1173705555 20:45107925-45107947 CTGAGGTCTTGGAGAGGGGAAGG - Intergenic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1174070791 20:47897682-47897704 TTGTGGACCTGGGGAGGAGCCGG + Intergenic
1174100672 20:48124091-48124113 CTGTAGACCTGGGGAGGAGCTGG - Intergenic
1174149293 20:48474850-48474872 CTGGGGACCTGCAGAGGAGCTGG - Intergenic
1174153275 20:48500974-48500996 CTGTGGACCTGGGGAGGAGCCGG - Intergenic
1174526084 20:51172629-51172651 CTGAGTTCCTGGTGAGGAGCTGG + Intergenic
1174772844 20:53317499-53317521 CTGGGGTGGGGGAGAGGAGGAGG - Intronic
1174935382 20:54862084-54862106 CTGTTGTCATAGAGAGGAGCTGG + Intergenic
1177011806 21:15739457-15739479 GTGTGGTGGTGGAGGGGTGCTGG + Intronic
1177027425 21:15936644-15936666 CTGGGGTGGGTGAGAGGAGCAGG - Intergenic
1179133763 21:38661417-38661439 CCTCGGTCGTGGGGAGGAGCCGG + Intronic
1179899397 21:44381187-44381209 CTGCGGACGAGGAGAGAAGCAGG + Intronic
1180255573 21:46624988-46625010 CTGCTGTCGTGGATCGGAGCAGG + Intergenic
1180786063 22:18548491-18548513 CTGTGGTGGTGGGGCTGAGCCGG + Intergenic
1181131345 22:20734216-20734238 CTGTGGTGGTGGGGCTGAGCCGG + Intronic
1181242985 22:21488045-21488067 CTGTGGTGGTGGGGCTGAGCCGG + Intergenic
1182634331 22:31712428-31712450 CCATAGTCTTGGAGAGGAGCTGG + Exonic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183257051 22:36769326-36769348 CTGAGCTCTAGGAGAGGAGCAGG - Intronic
1183564202 22:38601472-38601494 CTGTGGTCATGGTGAGGAGCTGG + Intronic
1183777161 22:39973791-39973813 CTGTGGCTGGTGAGAGGAGCTGG - Intergenic
1184165008 22:42721783-42721805 GGGTGGTCGTGGCCAGGAGCTGG - Intergenic
1184281456 22:43439937-43439959 CTCTGGGCGTACAGAGGAGCAGG - Intronic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
1184825173 22:46945678-46945700 CTGTGGGCCTGTACAGGAGCAGG + Intronic
1185056571 22:48581854-48581876 CTGTGTTCCTGGAGAGGGGAGGG + Intronic
1185338586 22:50281755-50281777 CAGTGGTCGGGGTGAGGAGGAGG + Intronic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950569616 3:13791967-13791989 CTGTGGGCCTGAAGAGGGGCTGG + Intergenic
950625638 3:14244695-14244717 CCATGGGCGTGGAGAGCAGCAGG + Intergenic
951580788 3:24160347-24160369 CTGTGGTGGTGCAGAGGATGGGG + Intronic
953024603 3:39137604-39137626 CTGAGGACCTGGAGAAGAGCTGG + Exonic
953604356 3:44401144-44401166 CTCTGGTGGGGGAGAGGAGAGGG + Intronic
954224526 3:49173464-49173486 CTGGGGTGGGGGAGAGGAGTAGG + Intronic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
955281240 3:57596959-57596981 CTGTGGTGGGGGAGGGGCGCCGG - Intronic
955748595 3:62165097-62165119 CTCTGGACATGGAGAAGAGCTGG + Intronic
956393146 3:68795972-68795994 TGGTGGTCTTGGAGAAGAGCTGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
961530170 3:127535855-127535877 CTGTGGTGAGAGAGAGGAGCAGG - Intergenic
964394799 3:156234142-156234164 CTGGGGTTGGGGAGAGGAGGAGG + Intronic
967823756 3:193862261-193862283 CTTTGGTCGTGGTGAGGGTCAGG - Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
973628819 4:52799186-52799208 CTGTGCTACTGGAGAGGAGAAGG + Intergenic
975897161 4:79106735-79106757 CTGTGGTGGTGGGCGGGAGCAGG + Intergenic
979145263 4:117239491-117239513 CTGTGCTCTTGGAGGGGACCAGG + Intergenic
979624584 4:122830277-122830299 ATGGGGTCCTGGAGAGGTGCAGG + Intronic
984751745 4:183284400-183284422 CAGTGCTCGTGGTGAGGCGCTGG + Intronic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985506092 5:281294-281316 CTGAAGACCTGGAGAGGAGCTGG + Intronic
985652646 5:1114030-1114052 CTGTGGACCTTCAGAGGAGCTGG + Intergenic
988696094 5:33623968-33623990 CTGTGGTTGTGCACAGGAACAGG - Intronic
990492380 5:56315133-56315155 CAGGGGTCGGGGAGAGGAACCGG - Intergenic
990557537 5:56951557-56951579 CTGGGGGCGCGGAGAAGAGCGGG - Intronic
992810773 5:80386296-80386318 GTGTGGTGGTGGAGAGGGGCAGG + Intergenic
995851795 5:116553987-116554009 CTGTATTCCTGGAGAGGAGTGGG + Intronic
997215778 5:132109324-132109346 CTGTTGTGGTGGGGGGGAGCGGG + Intergenic
997748307 5:136319308-136319330 AGATGGTCTTGGAGAGGAGCAGG - Intronic
999037889 5:148373953-148373975 ATGTGGGCGTGGGGAGAAGCAGG - Intergenic
999817614 5:155193097-155193119 TTCTGGTCTTGGAGAGGAGCAGG + Intergenic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000171329 5:158705741-158705763 CTGTGGTCCTAGGAAGGAGCAGG - Intronic
1002284311 5:178152094-178152116 CTGTAGTCCTGGAGAGGTGATGG - Intronic
1002315438 5:178340435-178340457 CTGGAGTCGTGGTGTGGAGCTGG - Intronic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1004340601 6:14804585-14804607 CTGTGGTCGGGGACACGGGCTGG - Intergenic
1005342673 6:24858054-24858076 CTCTAGTTGGGGAGAGGAGCAGG - Intronic
1005475747 6:26205955-26205977 CTGTGGCAGTGAAGGGGAGCTGG - Intergenic
1006735340 6:36269241-36269263 GTGTGGTCTTTGAGGGGAGCGGG + Intronic
1007102787 6:39261555-39261577 GTGTGGTGGTGGAAAGGAACGGG + Intergenic
1007742289 6:44020267-44020289 CTGGGGTGATGGGGAGGAGCAGG + Intergenic
1010288593 6:74108975-74108997 GTCTGGTGGAGGAGAGGAGCAGG + Intergenic
1010725414 6:79327273-79327295 GTGTGGTGGTGGTGAGTAGCAGG + Intergenic
1010735306 6:79437198-79437220 CCGTGGAGGAGGAGAGGAGCAGG + Intergenic
1011786692 6:90854421-90854443 CTGTGGTCCAGGAGAGCAGGTGG + Intergenic
1012446679 6:99314208-99314230 TTGTGGTGATGGAGAGGGGCGGG - Intronic
1013913732 6:115310040-115310062 CTGTGGTAGTATAGAGGATCAGG + Intergenic
1017009844 6:150055827-150055849 CTGGGGACCTGGGGAGGAGCTGG - Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1019147713 6:169985623-169985645 CTGGGCTCGGGGAGAGGCGCGGG - Intergenic
1019542955 7:1559708-1559730 CCGTGCCCGTGGACAGGAGCCGG - Intronic
1019599562 7:1874456-1874478 CTCTGGTGGAGGAGAGGAGGCGG + Intronic
1020076587 7:5262753-5262775 CTGTGGTGGTGGGGTGGAGGGGG - Intergenic
1020286143 7:6682660-6682682 CTGGGGTCGGGGAGAGCAGCTGG - Intergenic
1020899804 7:13990442-13990464 CTGTGGCTGTGGGGAGGAGGAGG + Intronic
1021926078 7:25534930-25534952 CGGTGGCTGGGGAGAGGAGCAGG + Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022567016 7:31413678-31413700 CTGTGGTCTTGGAAAGGAAGAGG + Intergenic
1024296986 7:47852487-47852509 CCCTGGCCCTGGAGAGGAGCTGG - Intronic
1024596100 7:50939170-50939192 CTGTGGTCGTGGAAAACAGCTGG - Intergenic
1024840979 7:53587299-53587321 CTGATGTCCTGGAGATGAGCTGG + Intergenic
1025233753 7:57219922-57219944 CTGTAGACCTGGGGAGGAGCCGG + Intergenic
1028268520 7:88759086-88759108 CTGTGGTGGAGGAGATGGGCAGG - Intergenic
1028605588 7:92651832-92651854 CTGGGATCTTGGAGAGGGGCAGG + Intronic
1029730045 7:102433254-102433276 CTGGGGCCGGGGACAGGAGCTGG + Intronic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033300043 7:140177185-140177207 CGGCCGTCGCGGAGAGGAGCGGG - Intergenic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1034430810 7:151040382-151040404 GTGTGGGCGGGCAGAGGAGCTGG + Intronic
1034451122 7:151137890-151137912 CTGTGGTCCGGGAGCGGGGCGGG - Intronic
1034452271 7:151143329-151143351 CTGTGGTTGCAGAGAGGAGAAGG + Exonic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035548258 8:500406-500428 CTGTGCTCATGGACAGGATCTGG - Intronic
1036472079 8:9061200-9061222 ATGTGATCGGGGTGAGGAGCAGG + Intronic
1037354879 8:18007838-18007860 TTTTGGTGGGGGAGAGGAGCAGG + Intronic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1039009168 8:33074372-33074394 CTGTGCTGGTGGGGTGGAGCAGG - Intergenic
1041973427 8:63769212-63769234 TTGTGGTGGTGCAGGGGAGCTGG - Intergenic
1045673970 8:104588594-104588616 CTCGGGTGGTGGAGAGGGGCTGG - Intronic
1046982932 8:120356164-120356186 CTGTGGTCTTTGAGAAGAACGGG + Intronic
1049304486 8:141893708-141893730 CTGAGGGGGTGGGGAGGAGCTGG - Intergenic
1049364997 8:142232852-142232874 TTGGGGTCGGGGAGGGGAGCTGG - Intronic
1049425376 8:142535734-142535756 CTGTGGGCGAGCAGAGGAGCTGG - Intronic
1049602937 8:143516318-143516340 ATGTGGTGGTGGCCAGGAGCAGG + Intronic
1049808992 8:144554894-144554916 CTGTGGTGCTGGGGAGGAACTGG - Intronic
1052402012 9:28012265-28012287 ATGTGAAGGTGGAGAGGAGCTGG + Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053601673 9:39617232-39617254 CTATGGGCATGGAGAGGCGCAGG - Intergenic
1053859321 9:42370999-42371021 CTATGGGCATGGAGAGGTGCAGG - Intergenic
1054251862 9:62725214-62725236 CTATGGGCATGGAGAGGCGCAGG + Intergenic
1054565975 9:66759715-66759737 CTATGGGCATGGAGAGGCGCAGG + Intergenic
1054916585 9:70500176-70500198 CTGTGGCCATGAAGAGGAACTGG + Intergenic
1056552014 9:87660005-87660027 CTGAGGGCGTGGACAGGGGCTGG + Intronic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1060376231 9:123117234-123117256 CTGTAATCCTGGAGGGGAGCAGG - Intronic
1061034007 9:128103469-128103491 CTGGGGTCCTGGAGAGGCACAGG - Intronic
1061070957 9:128310437-128310459 CTGTGCTCAAGCAGAGGAGCAGG + Intronic
1061207939 9:129175187-129175209 CTGTGGCCGGGGAAAGCAGCCGG - Intergenic
1061726274 9:132583561-132583583 CAGTGCTGGTGGACAGGAGCAGG + Intronic
1062272026 9:135714151-135714173 CTGGGGACGGGGAGGGGAGCTGG + Intronic
1062325817 9:136012072-136012094 CTGTGGCCTTGGGGAGGGGCGGG - Intronic
1062486288 9:136778035-136778057 CTGGAGACTTGGAGAGGAGCTGG - Intergenic
1190783695 X:53623137-53623159 CTGGGATAGTGGTGAGGAGCAGG - Intronic
1195967400 X:110440895-110440917 CTGTGGTCCTGGAAAGGACGAGG + Intronic
1196852355 X:119949501-119949523 CTGTGGAGGTGGAGTGGGGCAGG - Intergenic
1198058658 X:133021215-133021237 ATATGGTCGTGCAGAGGAACTGG + Intergenic
1198230151 X:134681284-134681306 CTTTGGTCGTTAAGAGGAGGGGG + Intronic