ID: 1092265058

View in Genome Browser
Species Human (GRCh38)
Location 12:6974467-6974489
Sequence CCTTCCATACAGAGGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092265058_1092265064 23 Left 1092265058 12:6974467-6974489 CCTTTGAGCCTCTGTATGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1092265064 12:6974513-6974535 CTTCAGCCTTAACCATGTCTCGG 0: 1
1: 0
2: 1
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092265058 Original CRISPR CCTTCCATACAGAGGCTCAA AGG (reversed) Intronic
901568839 1:10142690-10142712 CATTCCCTGCAGAGGCTCTAGGG + Intronic
902332738 1:15738501-15738523 CCTACCACACAGGGGCTAAAAGG - Intronic
905343354 1:37294389-37294411 CGATCAATACAGAGACTCAAAGG + Intergenic
907942903 1:59106272-59106294 CCTTCCATGCAGAAGGGCAAGGG + Intergenic
910989685 1:93042212-93042234 CCCTCCCAACAGCGGCTCAAAGG + Intergenic
912545397 1:110447522-110447544 CCTTCTACACAGACACTCAATGG + Intergenic
912557622 1:110527648-110527670 CCTTCCATACAGAGTATCAGGGG - Intergenic
912577082 1:110682253-110682275 TCTTACATATAGAGGCTCAAGGG - Intergenic
912936202 1:114005541-114005563 CATTCCAGAGAGAGGCACAAAGG - Intergenic
915035141 1:152916535-152916557 CCTTACATATAGAGGAGCAAGGG - Intergenic
916980747 1:170134312-170134334 CCTTCTCTGCAGAGACTCAATGG - Intergenic
918845446 1:189603380-189603402 GCTTACATCCAGATGCTCAAAGG - Intergenic
919538542 1:198819615-198819637 CCTTCCTTCCAGAGACTCCAGGG + Intergenic
920346592 1:205309785-205309807 ACTTCCATCCAGAGGATCCAGGG + Intronic
922066912 1:222153068-222153090 CCCTCCACACATAGGCTTAAAGG + Intergenic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
923001757 1:230011939-230011961 CCATCCAAACAGAGTCTCCATGG - Intergenic
1062965745 10:1606482-1606504 CCTTTCAGACAGAGGCTGATTGG + Intronic
1065414955 10:25474186-25474208 CCTTCCTTGTAGAGGGTCAAGGG - Intronic
1065466138 10:26024735-26024757 GCTTCCACACAGATCCTCAATGG + Intronic
1067187307 10:44042131-44042153 CTTTCCATACTGTGGATCAAGGG + Intergenic
1067451144 10:46382785-46382807 CATTCCAAACAGTGGCTCAAGGG - Intronic
1067586098 10:47476966-47476988 CATTCCAAACAGTGGCTCAAGGG + Intronic
1068958690 10:62844841-62844863 GCTGCCACACAGAGGCTCATGGG - Intronic
1071083727 10:81843175-81843197 CTTTCCATACAAATGCTCCATGG + Intergenic
1075094396 10:119461330-119461352 CCTGCCATGCTGTGGCTCAAGGG - Intergenic
1076615366 10:131751153-131751175 CTTTCCATCCTGAGGCTCCAGGG - Intergenic
1076880650 10:133237735-133237757 CCTTCGATTCAGAGGCACAAAGG - Exonic
1077166926 11:1146498-1146520 CGTTCCTTCCAGAGGCTCCAGGG + Intergenic
1079765333 11:24385410-24385432 CTTTTCAGAAAGAGGCTCAAAGG - Intergenic
1080610140 11:33896863-33896885 CCTACCATAGAGAGGATAAAGGG - Intergenic
1080793923 11:35545911-35545933 ACTTCCAGAGAGAGGCTCAGAGG - Intergenic
1081440800 11:43078594-43078616 CATTCTATAAGGAGGCTCAAAGG + Intergenic
1085342295 11:75740899-75740921 ACTTCCCTCCAGAGGCTCTAGGG + Intergenic
1085919870 11:80940262-80940284 CCCTCCAGACAGTGGCACAATGG - Intergenic
1087983256 11:104644023-104644045 CATTCCATCCAGAGGCTTCAGGG + Intergenic
1091319708 11:134640837-134640859 CCTTCCAGACAGAGACCCCAGGG - Intergenic
1092265058 12:6974467-6974489 CCTTCCATACAGAGGCTCAAAGG - Intronic
1093743117 12:22710822-22710844 CCTTCCTGGCAGAGGCACAAAGG - Intergenic
1096152850 12:49325489-49325511 CTTTCCTTGCAGAGGCTCCAGGG + Exonic
1101948683 12:109157581-109157603 ACTTCCACACAGAGTCTCAACGG - Intronic
1104873044 12:132014396-132014418 CCTGCCAGACAGAGGCACAGCGG - Intronic
1106244852 13:27940389-27940411 CCTTCCAGTCAGAGGCACTAAGG - Intergenic
1109354639 13:61221824-61221846 CCTGCCATACAGGGGCAAAAAGG + Intergenic
1110342233 13:74405442-74405464 GCTTCCATACATAGGCAGAAAGG - Intergenic
1110367918 13:74708545-74708567 CATTCCCTGCAGAGGCTCTATGG - Intergenic
1110502826 13:76248929-76248951 CCTTCCTTTCAGAGGCTCTGAGG + Intergenic
1110893318 13:80716927-80716949 CCCTTCACACAGAGACTCAAAGG + Intergenic
1111914422 13:94346195-94346217 CCTTCCATACTGAGGTTCCTGGG + Intronic
1112207203 13:97336645-97336667 CCCTCCCTCCAGAGGCTCTAGGG - Intronic
1112431766 13:99356280-99356302 CATTCCATGCAGGGGCTAAAAGG - Intronic
1116501305 14:45626158-45626180 CCTTCATTACAGAAGATCAAAGG + Intergenic
1118199879 14:63662330-63662352 CCTTCCTTACAGAGGTTAATAGG - Intergenic
1118625077 14:67651369-67651391 CCTTCCCTATAGAAGTTCAATGG + Exonic
1119425264 14:74531040-74531062 CCTTCCTTACAGTGTCCCAATGG - Intronic
1124998253 15:34745182-34745204 CTAACCATACAGAGGCTCATTGG - Intergenic
1130251757 15:82304473-82304495 CCTTCCATACAGAGCAGCACAGG - Intergenic
1130274477 15:82469296-82469318 CCATCCCTACAGAGGCTCTGAGG + Intergenic
1130466824 15:84196670-84196692 CCATCCCTACAGAGGCTCTGAGG + Intergenic
1130497440 15:84476866-84476888 CCATCCCTACAGAGGCTCTGAGG - Intergenic
1130589119 15:85201263-85201285 CCATCCCTACAGAGGCTCTGAGG + Intergenic
1131077397 15:89503904-89503926 CCATCCATACAGAGGGTGACAGG + Intergenic
1131505298 15:93012812-93012834 CCTTCCATACAAAAGCTGGAAGG - Intronic
1131829016 15:96342588-96342610 TCTTTCATACAGAGACACAAAGG + Intergenic
1132010570 15:98272679-98272701 CCCTGCATAAAGAAGCTCAATGG - Intergenic
1132779895 16:1617439-1617461 CCTTCCAGAAAGATGCTCAGAGG + Intronic
1134732080 16:16471108-16471130 ACTCCCATACAGAGGGGCAAGGG - Intergenic
1139578204 16:67855797-67855819 TCTTCCATTCTGAGGCTCCATGG + Intronic
1140897872 16:79341021-79341043 CCTTCCAGGCAGAGGGACAAAGG + Intergenic
1144404285 17:14937581-14937603 CCTTCTGTACATAGGCTGAAGGG + Intergenic
1144752256 17:17657235-17657257 CATTCCCTCCAGAGGCTCTAGGG + Intergenic
1144769065 17:17749102-17749124 CCGTCCAGAAAGAGGCTGAATGG + Intronic
1146579632 17:34025190-34025212 CCTTCCAGACAAAGACTCAGGGG - Intronic
1147635398 17:41960871-41960893 CCTGCCCTCCAGAGGCTCACAGG + Intronic
1148623687 17:49053402-49053424 CCTTCCCTTCAGAGGCTCCTGGG + Exonic
1148864357 17:50620841-50620863 CCTTCCTGAAAGAGGCTCACAGG + Intronic
1151025502 17:70671834-70671856 CGGTCCATCCAGAGGCTCGAGGG - Intergenic
1151874480 17:76859090-76859112 CGTTCCTTCCAGAGGCTCTAGGG + Intergenic
1153759396 18:8316162-8316184 CCTTCCCTTGAGAGGCTCCAGGG + Intronic
1154145076 18:11860430-11860452 CCTTCCCTACAGAGGTCAAAAGG - Intronic
1156996855 18:43479173-43479195 CCTTCCATACTGAGGTTAATAGG + Intergenic
1157884664 18:51354980-51355002 CCTTATAAACAGAGGCTGAAGGG + Intergenic
1159329504 18:66972112-66972134 CCTTGCACACAGAAGCTTAAAGG + Intergenic
1162874653 19:13611791-13611813 GCTTCCTTCCAGAGGCTCTAGGG - Intronic
1163755268 19:19102922-19102944 CGTTCCCTCCAGAGGCTCTAGGG + Intronic
1166561325 19:43734155-43734177 CATTCCAGACACAGGCTCAGGGG + Intronic
1166641636 19:44499197-44499219 CCTACGATACAGCAGCTCAATGG + Intronic
1167242203 19:48351115-48351137 ACTTCCATACAGATGCCCCATGG + Intronic
925297284 2:2785872-2785894 CATTCCATGCAGATGCTCAGTGG + Intergenic
927006370 2:18853599-18853621 CCTTCTATCCAGAGGTTGAATGG + Intergenic
932816953 2:74869698-74869720 CCTGTCATAAAAAGGCTCAAAGG - Intronic
933835795 2:86244643-86244665 CCTTATATACAGAGGCCCCAAGG + Intronic
933987151 2:87601712-87601734 CCTTCCACACAGAGCGTCAGAGG - Intergenic
935274294 2:101463105-101463127 CCTGTCATACAGAGGCTGCAAGG - Intronic
935662865 2:105484960-105484982 CCTTCCCTACTGAGGTTCATAGG + Intergenic
935731849 2:106070793-106070815 CCTTCCATGGACAGGCTCCAGGG - Intronic
936306690 2:111349096-111349118 CCTTCCACACAGAGCGTCAGAGG + Intergenic
937319633 2:120953371-120953393 CACTCCCTCCAGAGGCTCAAGGG - Intronic
939579868 2:143935749-143935771 CCTTCCAAACTGCGGCTAAAGGG - Intergenic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
945442371 2:209895262-209895284 CCTTGCATACAGAGACTGAATGG - Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947721563 2:232372607-232372629 CCTTCCATCCAGAGGCAAGAAGG - Intergenic
1173244016 20:41321888-41321910 CCTACCATACTGAGGCTATATGG + Intergenic
1173708607 20:45135402-45135424 CCTTTCAGACTCAGGCTCAAGGG - Intergenic
1174098251 20:48106673-48106695 CATTCCTTCCAGAGGCTCTAAGG - Intergenic
1175228143 20:57457008-57457030 TGTTCCATGCAGAGGCTCCATGG + Intergenic
1175267840 20:57713356-57713378 CCAGCCATACTGAGGCTCACAGG + Intergenic
1175293539 20:57893997-57894019 CTTTCCATTCTGAGGCTGAAGGG + Intergenic
1177201246 21:17958790-17958812 CCCTCCATACAGAGAATGAACGG - Intronic
1177479662 21:21669825-21669847 CCTTCCCATCACAGGCTCAAAGG - Intergenic
1177574594 21:22935979-22936001 CCTTCCAAAGAGATGCTTAAGGG - Intergenic
1182106332 22:27692476-27692498 TGTTCCATCCAGAGGCTCTAGGG - Intergenic
1183364697 22:37400654-37400676 CCTTCCCTCCAGGGGCTCAGGGG - Intronic
1184841761 22:47056256-47056278 CTTTACATACAGAGCCCCAAGGG - Intronic
1185022033 22:48382236-48382258 CGTTCCACACAGGGGCTCGATGG - Intergenic
1185103547 22:48854532-48854554 CCTAACATGCACAGGCTCAAAGG - Intergenic
952702010 3:36337999-36338021 TCTTCCATAGAGAATCTCAAAGG + Intergenic
952841453 3:37650098-37650120 CTGTCCATGCAGAGGCTCACAGG - Intronic
953462800 3:43095098-43095120 CCATCCAGAGAGAGGCTCAGAGG + Intronic
959967572 3:112374141-112374163 CATTCCATCCAAAGGCTCTAGGG - Intergenic
960259297 3:115547361-115547383 CCTTCCATACAGCTGCTACATGG - Intergenic
960309385 3:116102160-116102182 CCTTCCAGACAAAGGATCAGTGG - Intronic
961459424 3:127040816-127040838 CCTTCCTTTCAAAGGCTGAATGG - Intergenic
962888206 3:139647728-139647750 CATTCAGTTCAGAGGCTCAAGGG - Intronic
965617670 3:170611534-170611556 CATTCCAGACAGAGGCTCTGAGG - Intronic
966217766 3:177520364-177520386 GCTTCCAAACAGAGACTCAAAGG + Intergenic
967650073 3:191974735-191974757 CCTTACATACAGATGCTCCTTGG - Intergenic
969333091 4:6491322-6491344 TCTTCCATGCAGAAGCTCATTGG - Intronic
972160881 4:36225766-36225788 CATTTCATACAGCTGCTCAAAGG - Intronic
975312499 4:72918280-72918302 CCTTACAAAAAGAGGCCCAAGGG - Intergenic
977397641 4:96490613-96490635 CCTTCCAGAATGAGGCTCCATGG - Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
982059486 4:151590137-151590159 TCTTCCATGCAGAGGCTTAGAGG - Intronic
983356775 4:166671141-166671163 ACTTCCATACACAGTCACAATGG + Intergenic
987207218 5:15640226-15640248 CCTTCCCTACAGATCCTCAAAGG - Intronic
990346952 5:54880803-54880825 CCTTCCTTCTAGAGGCTCTAGGG + Intergenic
990861066 5:60328179-60328201 CCTTCCATACAATGACTAAAGGG + Intronic
998504365 5:142660276-142660298 CCTTCCAGTCAGAGGCTGAGTGG - Intronic
1000136269 5:158354631-158354653 CATTACATACAGAGGAACAAAGG - Intergenic
1004487828 6:16084167-16084189 CGCTCCATCCAGAGGCTCTAAGG + Intergenic
1005105349 6:22218669-22218691 CCTTCCTTCCAGAGGCTCTAGGG - Intergenic
1007109112 6:39302883-39302905 CCTTGCAAACAGAGGCTAGAAGG + Intronic
1007191436 6:40022269-40022291 CTTGCCATACAGAGCCTGAATGG - Intergenic
1007839775 6:44706285-44706307 CCTGCCTTACAGAGAATCAAGGG - Intergenic
1013631582 6:111991324-111991346 CCTTCCCTACAGAGGTTAATAGG - Intergenic
1016192388 6:141287130-141287152 CCTGCCTTACAAAGGCTGAAAGG - Intergenic
1016308050 6:142703800-142703822 CCTTCTTTCCAGAGGCTCTAGGG - Intergenic
1018250294 6:161862734-161862756 CCTTCCATTCAGAGGCGAGAAGG + Intronic
1018836789 6:167491222-167491244 CGTTCCTTCCAGAGGCTCTAGGG + Intergenic
1022413016 7:30154024-30154046 CCTTCCCTACTGAGGTTAAAGGG - Intronic
1023514185 7:40984122-40984144 CTTTCATTACAGAGGCTGAAAGG - Intergenic
1024672747 7:51611359-51611381 CCTTTCATGCAGGGCCTCAAAGG - Intergenic
1024946281 7:54810517-54810539 ACTTCCTTACACATGCTCAATGG + Intergenic
1026376290 7:69754254-69754276 TGTTACATACAGAGGCTCCAAGG + Intronic
1030991729 7:116309228-116309250 GCTTTCATACAGAGGAGCAAAGG + Intronic
1034417232 7:150971563-150971585 CCTTCCAGATAGAGGCTCCGAGG + Intronic
1035363514 7:158329472-158329494 CCTTCCTTACACAGGCCCCAAGG + Intronic
1036412423 8:8514462-8514484 ACTTCCCTACAGTGGCTGAATGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039026815 8:33267615-33267637 CCTTCCCTACAGAGACATAAGGG + Intergenic
1040657058 8:49522677-49522699 CCTTCCATCCAGAGGCACGAAGG - Intergenic
1041827852 8:62118168-62118190 CATTCTCTAGAGAGGCTCAATGG - Intergenic
1044618574 8:94166878-94166900 CGTTCCCTCCAGAGTCTCAAGGG - Intronic
1045500243 8:102739034-102739056 CCCTCCATACAGACCCTCCACGG - Intergenic
1047104750 8:121720250-121720272 CCTCCCATCCAGAGGCTCGGGGG - Intergenic
1047303443 8:123634570-123634592 CATTCCCTCCAGAGGCTCTAGGG + Intergenic
1048035502 8:130673694-130673716 TCTCCCATCCAGAGGGTCAAAGG - Intergenic
1050267964 9:3910916-3910938 CTCTCAATACAGAAGCTCAATGG + Intronic
1053011464 9:34636089-34636111 ACTTCCATACAGTGGGTCCATGG - Intronic
1056069527 9:82971714-82971736 CCTTCCTTCTAGAGGCTCTAGGG - Intergenic
1056540278 9:87565096-87565118 CTTTTCACACAGAAGCTCAAAGG + Intronic
1057230758 9:93320014-93320036 CCCTCCATGCAGAAGCTCGAAGG - Intronic
1060273913 9:122167811-122167833 CATTCCATCCAGAGGCTCTACGG + Intronic
1061551352 9:131336602-131336624 CCTTCCCTTTGGAGGCTCAAAGG + Intergenic
1185650476 X:1644145-1644167 CATTCCCTCCAGAGGCTCTAGGG - Intergenic
1186089644 X:6031631-6031653 CCTTTCAGACAGAGACCCAAAGG + Intronic
1186292798 X:8118810-8118832 CCTTCCTTCTAGAGGCTCTAGGG - Intergenic
1189975114 X:46453298-46453320 CCATCCAGACGGAGACTCAACGG - Intronic
1194168862 X:90557106-90557128 CCTTCCAAACACAGGCTCTGAGG + Intergenic
1194496386 X:94621580-94621602 CCTTCCATTCACAGGCCCAGAGG - Intergenic
1196090153 X:111732081-111732103 CCTTGCATACAGGGACTCACAGG - Intronic
1197156143 X:123272397-123272419 CCCACTATTCAGAGGCTCAAAGG - Intronic
1198430914 X:136565344-136565366 CCTCCCAACCATAGGCTCAAGGG - Intergenic
1198503237 X:137274685-137274707 CCGTCCATGCACATGCTCAATGG + Intergenic
1200515106 Y:4134891-4134913 CCTTCCAAACACAGGCTCTGAGG + Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1201507584 Y:14720577-14720599 CCTTTCAGACAGAGACCCAAAGG - Intronic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic