ID: 1092265377

View in Genome Browser
Species Human (GRCh38)
Location 12:6976745-6976767
Sequence GCCAGCCAAGTCTTCATTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092265377_1092265382 19 Left 1092265377 12:6976745-6976767 CCCCAAATGAAGACTTGGCTGGC 0: 1
1: 0
2: 2
3: 14
4: 125
Right 1092265382 12:6976787-6976809 GCATCGATCTTCCACCTCCCTGG 0: 1
1: 0
2: 2
3: 61
4: 578
1092265377_1092265381 -6 Left 1092265377 12:6976745-6976767 CCCCAAATGAAGACTTGGCTGGC 0: 1
1: 0
2: 2
3: 14
4: 125
Right 1092265381 12:6976762-6976784 GCTGGCAGCAGAGGCACAGCTGG 0: 1
1: 0
2: 12
3: 85
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092265377 Original CRISPR GCCAGCCAAGTCTTCATTTG GGG (reversed) Exonic
901482913 1:9538518-9538540 GCCAGGAAAGTCTCCATCTGGGG + Intergenic
905312346 1:37058554-37058576 GCCAGCGTGGTCTGCATTTGAGG - Intergenic
906766176 1:48436525-48436547 GCCAGCCATATCCTCATTTCTGG + Intronic
907982090 1:59493382-59493404 GCAAACCAAGTGTTCATTAGTGG + Intronic
918743186 1:188163168-188163190 GGCACCCAAGTCTTCATTTCAGG + Intergenic
920896745 1:210058546-210058568 GGCAGCCAAGTCTTCCCCTGTGG - Intronic
922177522 1:223208278-223208300 GCCTGCCAAGTCTTACATTGTGG + Intergenic
924433550 1:244018699-244018721 GCAACCCAAGTGTTCATCTGTGG + Intergenic
1062845909 10:704921-704943 GACAGCCAAGTCCTCATCTGGGG + Intergenic
1063227686 10:4031933-4031955 GCCAGCCAAGTGTTCAAATCAGG + Intergenic
1063681280 10:8189964-8189986 GTCAGCCCATTCTCCATTTGTGG - Intergenic
1064200883 10:13283852-13283874 GCAAGTGAAGTCTACATTTGAGG + Intronic
1072791791 10:98323199-98323221 GCCCTCCAATTCTTCATGTGAGG - Intergenic
1073748287 10:106494714-106494736 CCCAGACAAGTCTTTATTTTGGG - Intergenic
1074788786 10:116865478-116865500 GCCAGCCAATTCTTTATATACGG + Intronic
1075308390 10:121389632-121389654 GCAACCCAAGTCTTCATCAGTGG + Intergenic
1078371567 11:10751000-10751022 GCCTTCCAAGTTTTCATTCGGGG + Exonic
1079023364 11:16926165-16926187 TCCAACCAAGTCTTCATTCCTGG - Intronic
1079351199 11:19693500-19693522 GCCACCAAAGTCATCTTTTGAGG + Intronic
1080870501 11:36232777-36232799 GACAGCCCAGTCTTCATTTGAGG - Intergenic
1083497478 11:63069785-63069807 TACAGCCATATCTTCATTTGTGG - Intergenic
1083909443 11:65697439-65697461 ACCAGCCAAGGCTTCTTATGTGG - Intergenic
1085235415 11:75010677-75010699 TCAAGCCAAGCCTTGATTTGGGG + Exonic
1086932402 11:92706858-92706880 CCCAACCAAGTCTTCATATGTGG - Intronic
1087031880 11:93714667-93714689 TGCAGCCATGTCTTCATTAGGGG + Intronic
1089435683 11:118464038-118464060 GCCATCCAATTATTTATTTGGGG - Intronic
1089568739 11:119388106-119388128 TGCAGCCATGTCTTCTTTTGGGG + Intergenic
1091354539 11:134925887-134925909 AACACCCAGGTCTTCATTTGTGG - Intergenic
1091638642 12:2216998-2217020 GCAATCCAAGTATTCATTCGTGG + Intronic
1092043074 12:5402738-5402760 GGCAGCCCAGCCATCATTTGAGG - Intergenic
1092265377 12:6976745-6976767 GCCAGCCAAGTCTTCATTTGGGG - Exonic
1096739717 12:53684008-53684030 GCCAGCCAAGGCATAATCTGGGG - Intergenic
1097633219 12:62089636-62089658 GCCAGCCAAATCTATATTTATGG + Intronic
1102297896 12:111751090-111751112 TCCAACCAAGTCTTCAGTGGAGG - Intronic
1105510276 13:21045921-21045943 GCCATCCAAGTCTTCGGTTCAGG - Exonic
1108366703 13:49723274-49723296 CCCAGCCAAGATTTCTTTTGAGG - Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1110690637 13:78427182-78427204 GCCTGCCAAGTCTTACCTTGTGG - Intergenic
1112476773 13:99738471-99738493 ACCATCCAAGTCATCATCTGGGG - Intronic
1115014594 14:28594579-28594601 GACAGGCAAGTCTTCATTTTAGG - Intergenic
1116756870 14:48958960-48958982 GACACCCAAATCTACATTTGTGG + Intergenic
1117464879 14:55982946-55982968 GTCACTCAAGTCTTCATCTGGGG + Intergenic
1122013208 14:98770673-98770695 GCCAGCCATGTCTTCACCTCTGG - Intergenic
1128336872 15:66792368-66792390 ACCAACCAATTCTTCATCTGTGG - Intergenic
1135468743 16:22710503-22710525 TCCAGCCAAGTTGTCATTTGGGG - Intergenic
1135808339 16:25564839-25564861 GCCAGCCCATTCATCATGTGGGG + Intergenic
1141652896 16:85403033-85403055 CCCAGCCAAGCCTTCAGCTGGGG - Intergenic
1142209986 16:88804228-88804250 GCCAGCCAAGTCCCCAGTGGTGG - Intronic
1142564881 17:833715-833737 GACAGGGAGGTCTTCATTTGGGG - Intronic
1144149474 17:12429538-12429560 GCCACCCAAGTTTTCTTTTCTGG + Intergenic
1144663985 17:17089848-17089870 GCCAGCCCCGTCCTCAGTTGGGG + Intronic
1149304937 17:55338579-55338601 GCCAGATAAGTCTTCATTGTTGG + Intergenic
1153123919 18:1766240-1766262 GATAGCTAAGGCTTCATTTGTGG + Intergenic
1155300944 18:24428023-24428045 GCAAGCAAAGTGTCCATTTGGGG - Exonic
1156594182 18:38527082-38527104 GCCAGCCAATTATTGATGTGAGG - Intergenic
1158932290 18:62333798-62333820 GCGTGCCCAGTCTGCATTTGTGG + Intronic
1162779043 19:12997033-12997055 GCCAGCCAGGCCTGCATGTGGGG + Intronic
1163637692 19:18445055-18445077 CCCAGCTAAGTCTTCAGCTGTGG - Intronic
1167002438 19:46753926-46753948 GCCAGCCAAATCTTCAGTCTCGG + Intronic
1167677289 19:50895190-50895212 GCCAGCAAAGTCCTCATTGGTGG - Intergenic
1167899503 19:52608756-52608778 GCATGCCATGTGTTCATTTGGGG + Intronic
925556370 2:5135089-5135111 GCCAGCTAATTCTTCAGATGGGG - Intergenic
925785692 2:7429986-7430008 GCCAACCAAGGCTTCAGGTGTGG + Intergenic
930188747 2:48436473-48436495 GCCACAGAAGTCTTCATTTGGGG + Intergenic
930378782 2:50600618-50600640 CCCAGCCAAGTCTTGCTTTTTGG + Intronic
931755272 2:65368317-65368339 GCCAAGGAAGTCTTCAGTTGAGG - Intronic
936765919 2:115848450-115848472 GCCTCCCGAGTCTTCACTTGGGG - Intergenic
938642506 2:133295727-133295749 GCCAGACAATTCTTCATTGTAGG - Intronic
940019563 2:149142515-149142537 GCCAGCCAAGTATTAAATTAGGG + Intronic
942175295 2:173327799-173327821 TCAAGCCAAGTCTTTGTTTGGGG + Intergenic
943627750 2:190218115-190218137 GCCTGCCAAGTCTTACCTTGTGG + Intronic
944617562 2:201477629-201477651 GCCAGCCATATCCTCATTTCTGG + Exonic
946213664 2:218167039-218167061 CCCACCCATGTCTACATTTGGGG + Intergenic
948238951 2:236412666-236412688 GCCAGGCAAGTCATCCTTTGTGG + Intronic
1168911948 20:1455343-1455365 GACAGCCAAGGCTTCCTTTAAGG + Intronic
1169453440 20:5731774-5731796 GCCAGCCAGGTCTTCAAGTCAGG - Intergenic
1170790196 20:19502068-19502090 GCCAGTCTAGTTTTCTTTTGAGG - Intronic
1170958736 20:21005545-21005567 TCCAGCCAACTCTTAAATTGTGG - Intergenic
1182142117 22:27968476-27968498 GCCAGCCAACACTTTATTTGAGG + Intergenic
1182220607 22:28755783-28755805 GCCAGATAATTCTTCGTTTGGGG + Intronic
1182517853 22:30869144-30869166 GCCAGCCCAGCCTGCATCTGGGG - Intronic
1184889181 22:47369094-47369116 GCCAGCCAGGCCCTCATTTCAGG - Intergenic
949230622 3:1745762-1745784 GCCAGGGAAGACTTCATTTAGGG + Intergenic
949829115 3:8196019-8196041 TGCAGCCATGTCTTCATTAGGGG + Intergenic
950457294 3:13100252-13100274 GCCAGCCAATTCTTCTGTTTTGG - Intergenic
951584225 3:24198741-24198763 GCTATCTAAGTCTTCATTTTGGG - Intronic
954111239 3:48434559-48434581 GCCAGCAAATACTTCCTTTGTGG - Intronic
954933780 3:54308108-54308130 CCCAGCCAAGTTTTAATCTGAGG + Intronic
956321428 3:68000878-68000900 GCCAGAAGAGTCTTCATTTCTGG + Intergenic
956827962 3:73016429-73016451 GCCAGACAATTCTTCATTGCTGG - Intronic
962906264 3:139805879-139805901 GCCACCCAAGTGTTCATCAGTGG + Intergenic
964835061 3:160929218-160929240 ACCACCCAAGTTTTCATTTTGGG - Intronic
965959382 3:174410506-174410528 GCCAGGAAAGTCTGCATTTTGGG - Intergenic
967277863 3:187794364-187794386 TTGAGCCAAGTCTTCAATTGTGG - Intergenic
970673675 4:18423666-18423688 GCCAGCCTAGTCTTGATTGGAGG + Intergenic
975607437 4:76169246-76169268 GCTAACCATGTCTTCATTTTTGG - Intronic
977494957 4:97763648-97763670 GCCAGAAATGTCTTCATTAGGGG - Intronic
983601444 4:169534129-169534151 TCCAGCCAAATTATCATTTGAGG + Intronic
984895771 4:184538129-184538151 CCAAGCCAAGTCTTCCTGTGCGG - Intergenic
986594526 5:9407624-9407646 ACCAGCCAAGTGTTCACCTGTGG + Intronic
989003453 5:36784228-36784250 CCCTGCCCAGTCCTCATTTGGGG + Intergenic
989474046 5:41853989-41854011 TCCATCCAAATCTTCATTTTGGG - Intronic
992410848 5:76503913-76503935 GCCAGACAGATATTCATTTGTGG + Intronic
992665141 5:79000958-79000980 GCAAGCAAAGTGTCCATTTGGGG + Intronic
994374005 5:98997586-98997608 CCCGGCCAAGTCTCCATTTTTGG - Intergenic
995985317 5:118163931-118163953 CACAGCTAAGTGTTCATTTGGGG + Intergenic
1001217609 5:169870342-169870364 TCCAGCCAAGTCATGACTTGGGG - Intronic
1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG + Intergenic
1016550529 6:145274681-145274703 CCCAGCTAATTCTTCATTTCTGG - Intergenic
1018404954 6:163470259-163470281 CCCAGCCTAGTCTTCGCTTGGGG + Intronic
1018556920 6:165059832-165059854 GCCTGTCAAGTCTTGCTTTGCGG - Intergenic
1018997476 6:168720984-168721006 GACAGCCCAGTCTTCATGTCAGG - Intergenic
1019313709 7:375060-375082 GACAGCCAGGTCCTCACTTGGGG + Intergenic
1021485792 7:21167004-21167026 GTCAGCTAAGCCTTCATGTGGGG - Intergenic
1026253253 7:68689281-68689303 GTGGGCCAAGTCTTCATTTGCGG - Intergenic
1029680666 7:102106851-102106873 GCCAGCTAAGCCCTCCTTTGGGG + Intronic
1030088713 7:105838843-105838865 TCCAGCCAACTCTTCAGATGAGG - Intronic
1034261157 7:149756630-149756652 GGCAACCAAGTGTTCATTGGTGG + Intergenic
1034362525 7:150513236-150513258 GCCAGCCATATCCTCATTTCTGG - Intergenic
1034374099 7:150628088-150628110 GCCAGCCAGGTCTTCCTTCCGGG + Exonic
1035796601 8:2362894-2362916 GCCAGCCTTGCCGTCATTTGAGG - Intergenic
1037456243 8:19067355-19067377 CTCATCCAAGGCTTCATTTGAGG + Intronic
1037733805 8:21550751-21550773 TCCAGCCATGTCTAAATTTGGGG - Intergenic
1038970844 8:32633298-32633320 GACAGCCTAGTCTGCTTTTGTGG + Intronic
1041337680 8:56806130-56806152 GACTGCCAAGTCTTTGTTTGTGG - Intergenic
1041528495 8:58836127-58836149 GCGAGCTATGTCTTCATATGTGG + Intronic
1043918707 8:85955516-85955538 GCCAACTAATTTTTCATTTGAGG - Intergenic
1046720921 8:117618159-117618181 GCCAGCCACTTCTTTATCTGTGG - Intergenic
1055584184 9:77740027-77740049 GCCAGGAAAATCTACATTTGGGG + Intronic
1056962902 9:91142283-91142305 GCCAGACAAGTCTTCATCTGGGG - Intergenic
1057154064 9:92824644-92824666 GCCAGGCATGTTTACATTTGTGG + Intergenic
1060160986 9:121363754-121363776 GTCAGCCAACTATTTATTTGAGG + Intronic
1186596780 X:10990416-10990438 GCAAACCAAGTCTTCACATGAGG + Intergenic
1186834984 X:13428764-13428786 GCCAGCAAGCTCTTCCTTTGGGG + Intergenic
1190961579 X:55254889-55254911 GCCATCCATGTCTTCTTTTGTGG - Intronic
1193049440 X:77084875-77084897 GCCTGCCAAGTCTTACTTTGTGG + Intergenic
1193906028 X:87245137-87245159 TCCAGCCATGTCTTCTTTTCTGG - Intergenic
1198020262 X:132650572-132650594 GGCAGCCAAGTTTGCCTTTGGGG + Intronic
1199762864 X:150918525-150918547 TCCAGCCTAGTCTCCCTTTGAGG + Intergenic
1200354270 X:155531711-155531733 GCCAGCCAAGTATTGATCAGAGG - Intronic
1201790125 Y:17830573-17830595 GGCATCAAAGTCTTCTTTTGTGG - Intergenic
1201811429 Y:18075416-18075438 GGCATCAAAGTCTTCTTTTGTGG + Intergenic