ID: 1092265634

View in Genome Browser
Species Human (GRCh38)
Location 12:6978321-6978343
Sequence GCTCCCCACCAGCAGCTCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092265623_1092265634 22 Left 1092265623 12:6978276-6978298 CCCTCCAATCTGGGAAGACAGTG 0: 1
1: 0
2: 0
3: 10
4: 220
Right 1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG 0: 1
1: 0
2: 1
3: 25
4: 242
1092265620_1092265634 28 Left 1092265620 12:6978270-6978292 CCCCTGCCCTCCAATCTGGGAAG 0: 1
1: 1
2: 39
3: 902
4: 15933
Right 1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG 0: 1
1: 0
2: 1
3: 25
4: 242
1092265626_1092265634 18 Left 1092265626 12:6978280-6978302 CCAATCTGGGAAGACAGTGGAAG 0: 1
1: 0
2: 1
3: 12
4: 211
Right 1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG 0: 1
1: 0
2: 1
3: 25
4: 242
1092265621_1092265634 27 Left 1092265621 12:6978271-6978293 CCCTGCCCTCCAATCTGGGAAGA 0: 1
1: 0
2: 2
3: 22
4: 267
Right 1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG 0: 1
1: 0
2: 1
3: 25
4: 242
1092265624_1092265634 21 Left 1092265624 12:6978277-6978299 CCTCCAATCTGGGAAGACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG 0: 1
1: 0
2: 1
3: 25
4: 242
1092265622_1092265634 26 Left 1092265622 12:6978272-6978294 CCTGCCCTCCAATCTGGGAAGAC 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG 0: 1
1: 0
2: 1
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092265634 Original CRISPR GCTCCCCACCAGCAGCTCAC CGG Exonic
900919606 1:5662110-5662132 TCACCCCACCAGAAGCTCAGTGG + Intergenic
900919617 1:5662146-5662168 TCACCCCACCAGGAGCTTACTGG + Intergenic
901502306 1:9660512-9660534 GCTTCCCAATAGCAGCTCAATGG - Intronic
901633923 1:10660958-10660980 GCTCCCACCCAGCTGCCCACTGG - Intronic
902755615 1:18547488-18547510 CCACCTCCCCAGCAGCTCACAGG + Intergenic
905802769 1:40855968-40855990 GCTCCACCTGAGCAGCTCACGGG + Intergenic
906711848 1:47936352-47936374 ACTCCCAACTAGGAGCTCACAGG + Intronic
908789159 1:67764273-67764295 GTCCCCCAGCTGCAGCTCACTGG - Intronic
913451457 1:118995425-118995447 CTTCCCCAGCAGCAGCTCAAGGG - Intergenic
916168583 1:161984269-161984291 TCTCCCCACCTGCAGGTCGCTGG - Exonic
920074632 1:203327334-203327356 AATCCCCACGAGCAGCTGACTGG + Intergenic
920312747 1:205058222-205058244 GCCCCCCACCAGCTGGTGACGGG - Exonic
1063424471 10:5940662-5940684 CCCCCCCACCACCAGCTCAGTGG + Intronic
1063982372 10:11464493-11464515 GCTCACCACTAGCAAGTCACAGG + Intronic
1067615370 10:47756674-47756696 GCTGACCACCACCACCTCACTGG + Intergenic
1067804988 10:49386148-49386170 GGTGCCAACCTGCAGCTCACGGG - Intronic
1069068793 10:63973693-63973715 GCTCCTCACAGGCAACTCACTGG + Intergenic
1069958064 10:72063608-72063630 GCTCCCCAGCTGAAGCTCCCAGG + Intronic
1070280248 10:75043495-75043517 GAACCCCACCAGCAGCACGCTGG + Intronic
1070849400 10:79551545-79551567 GCTCCCCACCAGCAGAAGGCAGG + Intergenic
1071504237 10:86223050-86223072 GCTCCCCAGAAGCAGGTCAGTGG - Intronic
1071630772 10:87216625-87216647 GCTGACCACCACCACCTCACTGG + Intergenic
1073806898 10:107108103-107108125 GCTCACAACCAACAGCTCAGAGG - Intronic
1075654077 10:124149890-124149912 CCTCCCCACCACCTGCTCCCAGG + Intergenic
1076250778 10:128982393-128982415 GCCCCCCACCTCCAGGTCACAGG - Intergenic
1076261221 10:129068633-129068655 GTTCCCTGCCACCAGCTCACTGG + Intergenic
1076678478 10:132159960-132159982 GACCCCCACCAGCATCACACAGG - Intronic
1076678663 10:132160640-132160662 GACCCCCACCAGCATCACACAGG - Intronic
1076678720 10:132160825-132160847 GACCCCCACCAGCATCACACAGG - Intronic
1076777243 10:132704626-132704648 GATCCACACCAGCAGCACCCAGG - Intronic
1077239396 11:1502708-1502730 GCTCCCCAGGAGCAGCACTCTGG - Intergenic
1077419990 11:2445525-2445547 GCTCCCCCACACCAGCTCTCAGG - Intronic
1077458511 11:2695709-2695731 CGTCCCCACCTGCAGCACACAGG + Intronic
1082261948 11:50083268-50083290 GATCCCCCCCAGCAACTCCCTGG + Intergenic
1083184823 11:61011392-61011414 TCTGCCCTCCAGCAGCTCACAGG - Intronic
1084043825 11:66557691-66557713 GATCCACTCCAGCAGCTGACAGG - Exonic
1084459892 11:69290888-69290910 GCTGCTCACCAGTTGCTCACAGG + Intergenic
1084491534 11:69481291-69481313 GGTCCCCACCAGAATCTCTCAGG + Intergenic
1084563278 11:69915819-69915841 CCTCCCCACCCCCACCTCACTGG - Intergenic
1084969054 11:72759702-72759724 TCTGCCCACGAGGAGCTCACAGG - Intronic
1085460080 11:76688318-76688340 GCTGCTCACCACCTGCTCACAGG - Intergenic
1087673211 11:101129299-101129321 GCTCCCCACTTGCCGCTCGCTGG - Exonic
1087833997 11:102851668-102851690 GCTCACCAACAGCAGCTCTATGG - Intergenic
1089376543 11:117999061-117999083 GCTCCCCACCTGTTGCTCCCAGG - Exonic
1090251181 11:125252975-125252997 GCTATTCACCAGCAGCTCCCAGG + Intronic
1091277656 11:134363170-134363192 CCTGCCCTCCAGCAGCCCACTGG - Intronic
1091278969 11:134371171-134371193 GCTGCTCACCAGAAGGTCACAGG - Intronic
1091682958 12:2540068-2540090 GCTCCCCAACTGCAGCACACAGG - Intronic
1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG + Exonic
1092722962 12:11459748-11459770 ACTCACCACTACCAGCTCACTGG + Intronic
1092884492 12:12913299-12913321 GCTCCCCAGCACCAATTCACAGG + Exonic
1092946362 12:13457815-13457837 CCTCCCCACCACCAGCCAACTGG - Intergenic
1096712496 12:53467618-53467640 TCTCTCCACCAGCAATTCACAGG + Intronic
1097661570 12:62436165-62436187 GCTCCAAACCTGCAGCTCTCAGG - Intergenic
1097878473 12:64665735-64665757 GCTCCATAACAGCAGCTCAAGGG - Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101030328 12:100651893-100651915 CCTCTCCTCCAGCGGCTCACTGG + Intergenic
1101059284 12:100954300-100954322 GCACCACAGCAGCAGGTCACAGG + Intronic
1102457383 12:113079092-113079114 GGCACCCAACAGCAGCTCACTGG - Intronic
1105293814 13:19071512-19071534 GCTGCCCAGAAGCAGCTCAGAGG + Intergenic
1110342152 13:74404072-74404094 TCTGCCCACAAGGAGCTCACAGG + Intergenic
1113216464 13:108046374-108046396 GCTGCCCACAATCTGCTCACAGG - Intergenic
1114619479 14:24086694-24086716 GCCCCCAACCAGCAGCTGTCAGG + Intronic
1116898667 14:50341159-50341181 GTCCCCCACCAGCAGCTCAGGGG + Exonic
1117253538 14:53956571-53956593 GCTCGCCAGCAGCAGCTCCTGGG + Exonic
1119665330 14:76481224-76481246 GCCCCCCACCAGCAGATCGAAGG - Intronic
1121581904 14:95037976-95037998 GCTCCCCACCCTCAGTTCTCAGG - Intergenic
1121814751 14:96920675-96920697 GCTTGCCCCCAGCAGCTCCCAGG + Intronic
1122812558 14:104296283-104296305 GTTCACCACCTGCAGCTCAGGGG - Intergenic
1122817059 14:104319086-104319108 GCTCCCCACTAGCAGCTCCAGGG + Intergenic
1122823890 14:104360352-104360374 GGCCCCAACCACCAGCTCACAGG - Intergenic
1123034387 14:105466055-105466077 GCCCTCCACCAGCAGCTCCGGGG + Intronic
1125300794 15:38252348-38252370 AGTGCCCACCAGCAGCTCAGCGG - Exonic
1125499324 15:40228948-40228970 GCTGCCCACCAGCCACTTACAGG + Intergenic
1125608918 15:40957904-40957926 CCTCCCCACCATCAGCTCCCAGG - Intergenic
1127534644 15:59878828-59878850 CCTCCCCACCAGCAGCCCTTTGG + Intergenic
1128333442 15:66771118-66771140 GCCCTCCACCTGCAGCTCACCGG - Intronic
1129231464 15:74199425-74199447 GCTCCCCACCTCCAGCTCCAAGG + Intronic
1129258988 15:74352590-74352612 GCTCGCCCCAAGCAGCTCCCAGG - Intronic
1130049324 15:80470290-80470312 GGTCCCCACATGCAGCGCACTGG + Exonic
1130576992 15:85101884-85101906 ACTGCCCACCAGGACCTCACAGG - Intronic
1130750370 15:86705126-86705148 GCCCCCCACCAGCCACTGACAGG - Intronic
1132107007 15:99070363-99070385 TCTCCCCCCAAGAAGCTCACTGG + Intergenic
1132562100 16:600272-600294 CCTCCCCACCAGGAGGACACAGG - Intronic
1132906543 16:2285436-2285458 GCTCACCAGCAGCAGCAGACTGG + Exonic
1132911324 16:2314023-2314045 CATTCCCACCAGCAGCACACAGG - Intronic
1132923173 16:2410809-2410831 ACTCACCACCAGCAGCAGACTGG - Intergenic
1133070818 16:3245708-3245730 CATTCCCACCAGCAGCACACAGG - Intronic
1135587118 16:23679682-23679704 GCTCCACCCCAGAAGCTCCCAGG - Intronic
1136019354 16:27430133-27430155 CCTCCCCACCCGCAGACCACGGG - Intronic
1136776881 16:32876698-32876720 GGACCCCACCAGGAGCTCTCAGG + Intergenic
1136893736 16:33984815-33984837 GGACCCCACCAGGAGCTCTCAGG - Intergenic
1137556673 16:49474654-49474676 GATTCCCACCTGGAGCTCACAGG - Intergenic
1137659924 16:50196246-50196268 GCTGCCAACCAGCAGATCACAGG - Intronic
1138102914 16:54268862-54268884 ATTCCCCAGCCGCAGCTCACTGG + Intronic
1138678922 16:58671289-58671311 GCTCCCCACCTCTAGCTCACAGG + Intronic
1139596290 16:67960203-67960225 ACTCCCCGCCACCAGCTCCCTGG + Intronic
1140015087 16:71174802-71174824 GCTCACCCCCATCAGCTCACAGG - Intronic
1141987991 16:87592421-87592443 CCTTCCCACCAGCAGCATACAGG - Intergenic
1142009199 16:87705179-87705201 GCGCCGCGCCAGCAGCTCCCGGG + Intronic
1142218497 16:88841511-88841533 GCTCCCCAGGGGCATCTCACAGG - Intronic
1142350512 16:89577199-89577221 GCTCCCCAGCACCAGCTGAGTGG - Intronic
1203079297 16_KI270728v1_random:1138807-1138829 GGACCCCACCAGGAGCTCTCAGG + Intergenic
1142523555 17:521675-521697 TCTCCCCTCCATCAGCTCGCAGG - Exonic
1142741036 17:1932189-1932211 GCTCCCCCCAACCTGCTCACAGG + Intergenic
1143794315 17:9324417-9324439 ACTGCGCACCAGGAGCTCACAGG - Intronic
1144424699 17:15131043-15131065 TCACACCCCCAGCAGCTCACAGG + Intergenic
1144776756 17:17788683-17788705 GATCCCCAGCAGCAGCTCTGAGG - Intronic
1145235622 17:21206161-21206183 CATTCCCACCAGCAGCGCACAGG + Intronic
1146761995 17:35487197-35487219 GCTCTGCACCAACACCTCACGGG + Intronic
1149428824 17:56580455-56580477 CATTCCCACCAGCAGCACACAGG + Intergenic
1151210432 17:72540368-72540390 GCGCCCCACCAGCCGCGCGCCGG + Intergenic
1151404386 17:73877295-73877317 CCTCTCCACCAGCAGCTCCATGG - Intergenic
1152079132 17:78175655-78175677 CCACCCCAGCAGCAGCTCCCTGG + Intronic
1152512678 17:80801151-80801173 GCTCTCAAGCAGCAGCTCCCAGG - Intronic
1152526848 17:80893168-80893190 GCTCCCCACCCGCAGACCACAGG - Intronic
1152584730 17:81183822-81183844 GTTGCCCTCCAGCTGCTCACTGG + Intergenic
1156519957 18:37713773-37713795 GAGCCCCTCCAGCTGCTCACAGG - Intergenic
1157350417 18:46879441-46879463 ATTCCCCACCAGCAGTGCACAGG - Intronic
1157506503 18:48230332-48230354 GCTCCCAACCAGCTTCCCACTGG - Intronic
1157912022 18:51625293-51625315 GCTCCCCACCCCCACCCCACTGG - Intergenic
1158242932 18:55398044-55398066 TATCCCCACCAGCAGCTTCCTGG - Intronic
1158522766 18:58185241-58185263 GCTCCCTACCAAAAGCTTACAGG - Intronic
1160794479 19:938545-938567 CCGTCCCACCAGCAGCTCCCTGG - Intronic
1161596862 19:5154936-5154958 CCTCCCCACCTGCAGCACACAGG - Intergenic
1162751880 19:12834205-12834227 GCACCCCTCCGGCAGCTCCCTGG - Intronic
1163839055 19:19594657-19594679 GTTCAGCCCCAGCAGCTCACTGG + Intronic
1164611346 19:29634566-29634588 TCTCCCCAGCATCAGCTCCCTGG - Intergenic
1165144962 19:33724919-33724941 GCTGCTCACCAGCAGATCCCTGG + Intronic
1165361099 19:35337559-35337581 GGTCTCCACCAGCAGCACGCAGG - Intronic
1167491946 19:49798205-49798227 GATGCCAGCCAGCAGCTCACAGG - Intronic
1167635870 19:50655259-50655281 CCACCCCACCATCAGCTAACTGG - Intronic
927081599 2:19635962-19635984 CCTCCCCACCAGCTGCTCAGAGG - Intergenic
931300327 2:60973144-60973166 GCTCCCCATCACCATCTCAGGGG + Intronic
932409024 2:71534399-71534421 GATCCAAACCAGCAGCTCACAGG - Intronic
932916470 2:75864692-75864714 GCTCCCACACAGCAACTCACAGG - Intergenic
933030765 2:77326013-77326035 GCTCCCCCAGAGCAGGTCACAGG + Intronic
933703509 2:85273121-85273143 GCTGCCCACCAGCAGCTTCCTGG + Intronic
935341588 2:102064117-102064139 GCTGCCCCCCTCCAGCTCACAGG + Intergenic
936275270 2:111090694-111090716 GCTCCCAACAAGCTGCTAACTGG - Intronic
937852047 2:126644431-126644453 GCTCCCCACCAACACCTCCTGGG + Intergenic
941543267 2:166813840-166813862 GATCCACACCATCAGCTCCCTGG - Intergenic
945828033 2:214748743-214748765 GCTTCCCTAAAGCAGCTCACTGG + Intronic
947991996 2:234495761-234495783 GCCCCCCACCCCCAGCTCAGGGG - Exonic
948148193 2:235724234-235724256 GCTCCCGGCCAGGAGCTCGCTGG - Intronic
948154614 2:235771283-235771305 GCTCCCCAGCAGAAGCCCTCTGG - Intronic
948391646 2:237615671-237615693 GCTTCCCACCTGGAGCACACAGG + Intergenic
948633666 2:239319292-239319314 GCTTCCTTCCAGCAGCTAACGGG - Intronic
949032318 2:241802919-241802941 GCACTCCACCAGCTGCCCACAGG - Intronic
1170468278 20:16642987-16643009 CCTCCCCATGAGCAGCTCATCGG - Intergenic
1173869005 20:46330276-46330298 GCTCCCCACCACCTGCAGACTGG + Intergenic
1174267064 20:49339745-49339767 CCTCCCCACCAACACCTCAGAGG + Intergenic
1175284646 20:57829943-57829965 GCTTACCAACAGCAGCTCTCAGG + Intergenic
1175561318 20:59933300-59933322 GCTCCCCATCAGCACCTGCCTGG - Intronic
1175944270 20:62551445-62551467 GCCCCCCACCAGCACCTCAGTGG - Intronic
1176257540 20:64160020-64160042 ACTCCCCACCACCAGATCCCAGG - Intronic
1176429696 21:6568104-6568126 GCTCTCCAACAGCAGCCCATGGG - Intergenic
1177895365 21:26851099-26851121 GCTCTCCACCACTAGCTCCCAGG - Intergenic
1178138450 21:29655009-29655031 GCTCCACACCAGCCACTCATTGG - Intronic
1178617838 21:34148898-34148920 GCTCCCCTTCAGCAGCCCAGCGG - Intergenic
1179626190 21:42650839-42650861 GGTCCCCACCATCAGCTCCCGGG + Intergenic
1179705090 21:43175566-43175588 GCTCTCCAACAGCAGCCCATGGG - Intergenic
1180064659 21:45406147-45406169 GTTCCCCACCACCTGCTAACCGG + Intronic
1180312877 22:11253503-11253525 TCTCTCCCCGAGCAGCTCACCGG - Intergenic
1182025037 22:27111289-27111311 GCTCCCTACCAGCAGCAGACTGG - Intergenic
1184224359 22:43120706-43120728 GCTCCCCACCTTCCGCTCCCTGG + Intronic
1184728837 22:46362199-46362221 CATCCCCACCTGCAGCTCCCGGG + Exonic
1185002739 22:48256223-48256245 GCTTTCCAACAGCAGCTGACTGG + Intergenic
949970292 3:9397832-9397854 GCCCCCCACCCCCACCTCACGGG + Exonic
950329561 3:12145778-12145800 CCTCCCCAGCATCAACTCACTGG + Exonic
950415977 3:12869233-12869255 GCTCCAGAGCAGCAGCTAACAGG - Intronic
950424175 3:12915687-12915709 GATCCCCATCAGCATCTCACGGG + Exonic
950443530 3:13023310-13023332 GGTCTCCACCAGCTGCTCCCAGG + Intronic
950468285 3:13168680-13168702 GCTCCCCAACACCAGCTCTAGGG + Intergenic
953090997 3:39726089-39726111 GGTCCCCACCAGGCCCTCACAGG + Intergenic
954429102 3:50459784-50459806 GCTGCACCCCACCAGCTCACTGG + Intronic
954858553 3:53667638-53667660 GCTGCCCTTCAGCAGCTCACAGG + Intronic
956314046 3:67914556-67914578 GCCCCCCACCGGAAGCTCTCTGG - Intergenic
958879300 3:99651475-99651497 GCTCTCCGCCAGCAGGTCAGCGG + Intronic
960652147 3:119962787-119962809 CCTTCCCACCAGCCCCTCACCGG - Intronic
961420663 3:126800618-126800640 CCTTCCCACCAGCAGATCAGTGG + Intronic
961676211 3:128568411-128568433 GGTCACCACCTGCAACTCACTGG + Intergenic
962129208 3:132654656-132654678 GCTACCCACCACCAGGTCAGTGG + Intronic
962313888 3:134345904-134345926 GCTCCCCAGGAGCAGCTGGCTGG - Intergenic
964269524 3:154940170-154940192 GCTTACCAGAAGCAGCTCACAGG - Intergenic
967503211 3:190223402-190223424 GCTGAGCAGCAGCAGCTCACAGG - Intergenic
968550738 4:1222437-1222459 GCTGCCCCCCAGCAGCTCCAGGG + Intronic
968677965 4:1895713-1895735 GCTCCCCATGAGCAGTTCTCAGG + Intronic
969048666 4:4356909-4356931 CCTGCCTTCCAGCAGCTCACAGG - Intronic
969181858 4:5448279-5448301 GCAGCCCCGCAGCAGCTCACAGG - Intronic
969300693 4:6295262-6295284 CCTCCCCACCTGCAGCTTCCTGG - Intronic
969529996 4:7725328-7725350 GCTCCCCACAAGCTGCACAGTGG + Intronic
969623432 4:8290364-8290386 GCTCCCCTCCACCAGGCCACTGG - Intronic
969686436 4:8677078-8677100 CCTTCCCACCAGCAGTGCACAGG - Intergenic
970561135 4:17283376-17283398 GCTCCACACCAGCATCAAACCGG - Intergenic
980463973 4:133150813-133150835 CCCCCCCAGCAGCAGCGCACCGG + Exonic
981652993 4:147080020-147080042 GCACCTCACCAGCAGCTGACAGG + Intergenic
982966026 4:161909217-161909239 GATCCCCACCAGGAGCTCTGTGG + Intronic
984869600 4:184314514-184314536 GCTCCCCAGAAGCACCTCTCTGG - Intergenic
985707047 5:1407423-1407445 GCCTCCCACCAGCAGGTCCCAGG + Intronic
991930398 5:71748420-71748442 GCTCCCCGCAGGCAGCTCAGAGG - Intergenic
993844407 5:92922686-92922708 ATTCCCCACCAGCAGCTCCTAGG + Intergenic
998021226 5:138772611-138772633 GCTCCCAGCCAGCAACTTACGGG + Intronic
999147385 5:149405426-149405448 GACCCCCTCCAGCAGCACACGGG - Intergenic
999902147 5:156096138-156096160 GCTAGCCACCAGCAGCTCAGGGG + Intronic
1002066236 5:176653144-176653166 GCTCCACGCTAGCAGCTCCCAGG + Intronic
1002633494 5:180595928-180595950 GCTCCCCAGCAGGAGCACCCAGG - Intergenic
1002775956 6:327633-327655 CCACACCACCAGCAGCACACAGG - Intronic
1003429510 6:6026058-6026080 GCTGCTCACCTCCAGCTCACTGG - Intergenic
1004348971 6:14874406-14874428 AGTCCCCCCCAGCAGCTAACTGG + Intergenic
1007577878 6:42937876-42937898 AATCCCCACCAGCCCCTCACTGG - Intronic
1008103690 6:47420432-47420454 CTTCCCCACCACCAGCTCAATGG + Intergenic
1008381861 6:50845929-50845951 CCTCCCCACCTGCAGCCCACCGG - Exonic
1008581634 6:52913527-52913549 GCCCCACACCAGGAGGTCACAGG + Intergenic
1009896191 6:69753470-69753492 TATTCCCACCAGCAGCACACAGG - Intronic
1012593415 6:101011301-101011323 TCTCCCCACCTGCACCTCCCAGG - Intergenic
1013531920 6:111027527-111027549 CCTCCTCACCAGCCGCTTACGGG + Intronic
1015926899 6:138319835-138319857 GTGCTCCACCACCAGCTCACAGG - Exonic
1016489644 6:144583253-144583275 GCCCCCCAGCAGATGCTCACAGG - Intronic
1019326373 7:440313-440335 TCTCCACACCAGAAGCTCTCTGG - Intergenic
1019415682 7:925618-925640 AGTCCCCACCAGCAGCTCCTGGG + Intronic
1019701410 7:2476453-2476475 GCTCCCCACCCCCAGCCCCCCGG - Intronic
1020071478 7:5229816-5229838 CCACCCCACCAGCTCCTCACTGG + Intronic
1020250734 7:6466358-6466380 ACTGCCCACCAGGAGCTCAGAGG + Intronic
1023860968 7:44217558-44217580 GCTCCGCACCAGTGGCTCCCTGG - Exonic
1024232128 7:47370743-47370765 TCCCACCACCAGCAGCTCCCTGG - Intronic
1024985128 7:55187825-55187847 CCTCCCCACCAGCACCCCAAGGG + Intronic
1026601364 7:71780272-71780294 ACTCTCCACCAGGAGCTGACAGG + Exonic
1026975831 7:74497621-74497643 CATCCCTACCAGCAGCACACAGG + Intronic
1029111171 7:98213682-98213704 GCTCCCCAAGAGCAGCTCTGAGG + Intergenic
1031750409 7:125564225-125564247 GCTCTCCACCATCTGCTCATCGG + Intergenic
1032521312 7:132547582-132547604 GCACCCCACCAGGAGATCCCAGG - Intronic
1033533655 7:142291563-142291585 GATACTCACCAGCAGCTCCCAGG + Intergenic
1034285229 7:149879593-149879615 GCTCCCCAGCAGCATCTCCTTGG - Exonic
1034996153 7:155578364-155578386 GACCCCCACCAGCAGCCCTCAGG + Intergenic
1035179689 7:157080277-157080299 GCTGCCCATCAGCGGCTCCCGGG - Intergenic
1035360652 7:158311160-158311182 CGTCCCCAGCAGCAGCTCCCCGG + Intronic
1035375502 7:158404648-158404670 GCTCCCCAGCCTCAGCTCCCCGG + Intronic
1035732159 8:1860715-1860737 TTCCCCCACCAGCTGCTCACGGG + Intronic
1035757984 8:2048425-2048447 TCTCCCCAGATGCAGCTCACTGG - Intronic
1037739699 8:21598481-21598503 GCCCCCCACCCCCACCTCACCGG - Intergenic
1038433613 8:27519431-27519453 GCTCCCCTGCAGCAGCACAAGGG + Intronic
1047899252 8:129402101-129402123 CCTCCCCACCAGCCCCTCACAGG - Intergenic
1048519727 8:135142255-135142277 GTTCCCCGCGTGCAGCTCACAGG - Intergenic
1049056138 8:140239011-140239033 GCTTCCCACCAGGAGCTCACTGG + Intronic
1049424213 8:142530870-142530892 CCTCCCCTTCAGCAGCTCCCGGG + Intronic
1049644200 8:143728778-143728800 GCGCCCCACCCGCTGCCCACGGG - Intronic
1049728569 8:144163536-144163558 AGTCCCTACCAGCACCTCACTGG - Intronic
1051159967 9:14196484-14196506 TCTCCCCAGCAGCAGCACACTGG + Intronic
1052633519 9:31071453-31071475 GCTCTCCACAGGCAGGTCACTGG + Intergenic
1052792780 9:32891361-32891383 GCTTCCCACCCACAGCTCTCTGG + Intergenic
1053069845 9:35094844-35094866 GCTCCCTACCAGCAGGGCCCTGG + Intronic
1053069859 9:35094898-35094920 GCTCCCTACCAGCAGGGCCCTGG + Intronic
1057279518 9:93699785-93699807 GCCCTCAACCAGCAGCTGACAGG - Intergenic
1057724583 9:97559159-97559181 GCTCCCACGGAGCAGCTCACGGG - Intronic
1061700321 9:132410529-132410551 GGTCCCCACCCGCAGCGCCCTGG + Intronic
1062130939 9:134892710-134892732 GCTCCCAACCATCAGCTTATTGG - Intergenic
1062686646 9:137817041-137817063 GCTCCCGACAAGGAGCCCACAGG - Intronic
1185603851 X:1355775-1355797 TCTGCCCACCTGCAGCACACTGG - Intronic
1185664241 X:1751971-1751993 ACTCACCACTAGCAGCTCCCTGG + Intergenic
1185750792 X:2608787-2608809 GCCCCCTTCCAGCTGCTCACGGG - Intergenic
1185759767 X:2681439-2681461 GCTGCCCACAAGTACCTCACAGG + Intergenic
1186192714 X:7082160-7082182 GCTCCAAACAATCAGCTCACAGG + Intronic
1190302247 X:49063849-49063871 GCCTCCCACCAGGAGCTGACTGG + Exonic
1199297343 X:146174161-146174183 GCACCACACCAACAGCCCACAGG + Intergenic
1199551150 X:149062790-149062812 TCTTCCCACCAGCAGTGCACAGG - Intergenic
1199755019 X:150855774-150855796 GATCGCTACCAGCAGCTAACGGG + Intronic
1200118876 X:153781201-153781223 TCACCCCACCCGCAGCTCACAGG + Exonic
1201564554 Y:15352900-15352922 GCTCCAAACAATCAGCTCACAGG + Intergenic