ID: 1092268102

View in Genome Browser
Species Human (GRCh38)
Location 12:6998985-6999007
Sequence CTTGGCACTTGGCAGTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092268096_1092268102 10 Left 1092268096 12:6998952-6998974 CCTGATTTCCATTCTACTATTCT 0: 1
1: 0
2: 1
3: 31
4: 341
Right 1092268102 12:6998985-6999007 CTTGGCACTTGGCAGTGACCTGG 0: 1
1: 0
2: 1
3: 22
4: 190
1092268095_1092268102 18 Left 1092268095 12:6998944-6998966 CCACATCACCTGATTTCCATTCT 0: 1
1: 0
2: 1
3: 23
4: 316
Right 1092268102 12:6998985-6999007 CTTGGCACTTGGCAGTGACCTGG 0: 1
1: 0
2: 1
3: 22
4: 190
1092268097_1092268102 2 Left 1092268097 12:6998960-6998982 CCATTCTACTATTCTTGCCACAT 0: 1
1: 0
2: 0
3: 22
4: 317
Right 1092268102 12:6998985-6999007 CTTGGCACTTGGCAGTGACCTGG 0: 1
1: 0
2: 1
3: 22
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092268102 Original CRISPR CTTGGCACTTGGCAGTGACC TGG Intronic