ID: 1092269539

View in Genome Browser
Species Human (GRCh38)
Location 12:7012319-7012341
Sequence CATGCTCCTCCCAATCTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092269534_1092269539 5 Left 1092269534 12:7012291-7012313 CCAAGGGCATTTATCTTTTCCAG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 1092269539 12:7012319-7012341 CATGCTCCTCCCAATCTCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092269539 Original CRISPR CATGCTCCTCCCAATCTCAG CGG Intronic
901134697 1:6985295-6985317 CCAGCTCCTCCCATTCACAGTGG - Intronic
903547614 1:24136574-24136596 CTTGCTGCTCCCACTCTCTGGGG - Intronic
907820599 1:57964062-57964084 CTTGCTCCTCCCCTTCACAGGGG - Intronic
908025996 1:59952153-59952175 CATGCTCCTCCCTAGCACAAAGG - Intergenic
912470095 1:109900946-109900968 CATCTTCCTCAGAATCTCAGTGG - Intergenic
913325357 1:117623491-117623513 CATGCTCTCCCCAATCACGGTGG - Exonic
915075666 1:153306564-153306586 CTTGCTCCTCCCCACCTCACAGG - Intronic
916562578 1:165945953-165945975 CATGCTCCCACCAATAACAGTGG - Intergenic
916725994 1:167524978-167525000 CACAATCCTCCCAAACTCAGTGG - Intergenic
916960497 1:169883469-169883491 CACTCTCCTCCCAATCTGATTGG - Intronic
917031163 1:170693409-170693431 CCTGCACATACCAATCTCAGAGG + Intronic
918049043 1:180958612-180958634 CATGATCCTCCCCATCTATGTGG - Intergenic
918285587 1:183051550-183051572 CAAGCTACTCCAAAGCTCAGTGG - Intronic
918550936 1:185741120-185741142 CATGCTGCTTCCATTCACAGTGG - Intronic
919933033 1:202234063-202234085 CAGGCTCCACCCAATGCCAGAGG - Intronic
920032964 1:203048416-203048438 CAGCCTCCTCCCACTCTCTGTGG - Intronic
923051659 1:230394644-230394666 CACGCTCCTCCCAATCCCCAAGG + Intronic
923051691 1:230394757-230394779 CACGCTCCTCCCAATCCCCAAGG + Intronic
923248146 1:232153955-232153977 CATGCTCCCCTCTATCTCTGGGG - Intergenic
924712597 1:246542728-246542750 AATGCTCCTGGTAATCTCAGTGG - Intronic
1063769587 10:9182608-9182630 CATGCTCATCCCCATCTCTAAGG - Intergenic
1065301682 10:24327962-24327984 CATGCTTCACCCTATCCCAGAGG + Intronic
1067140119 10:43649348-43649370 CATGCTCCTCCCAGTATCTCAGG - Intergenic
1067771646 10:49130928-49130950 CATCCTTCTCCCTGTCTCAGGGG - Intergenic
1069172845 10:65254789-65254811 CCTGCTTCTCCCTATCACAGAGG + Intergenic
1070330194 10:75410765-75410787 CATGCTACTCCCCACCTCAAGGG + Intergenic
1070700913 10:78601214-78601236 CATGATCCTCCCTGTCCCAGGGG - Intergenic
1070746467 10:78936728-78936750 CTTGCTGCTCCAGATCTCAGAGG - Intergenic
1070932289 10:80270020-80270042 CATGATGCTCCCAATCTCCCAGG - Intergenic
1071078606 10:81783696-81783718 ACTCCACCTCCCAATCTCAGGGG - Intergenic
1073559604 10:104485636-104485658 CATGATCCCCCCAGTCTGAGGGG + Intergenic
1074421104 10:113309510-113309532 CATGCTCTTCCCAGTCCCAGAGG + Intergenic
1077556582 11:3228906-3228928 CCTGCTCCTCCCCACATCAGGGG + Intronic
1079040870 11:17058389-17058411 GATGCTACTCCCAATGTCACAGG - Intergenic
1079290070 11:19180058-19180080 AAATATCCTCCCAATCTCAGTGG + Intergenic
1080649827 11:34213113-34213135 CTGGCTCCTCCAATTCTCAGAGG + Intronic
1081682983 11:45021900-45021922 CATTCTGCTCACATTCTCAGGGG + Intergenic
1086197406 11:84157388-84157410 CCTGCTACTCCCTATCTGAGAGG + Intronic
1087306541 11:96496174-96496196 TATGGTGCTCCCAATTTCAGTGG + Intronic
1088187394 11:107186764-107186786 CATGCTGCTCCAAATAACAGAGG + Intergenic
1088351240 11:108890720-108890742 CATGCTCCCCCAATTCTCTGTGG - Intronic
1091240369 11:134047881-134047903 CCTGCTCCTCCCATTCTACGGGG - Intergenic
1092269539 12:7012319-7012341 CATGCTCCTCCCAATCTCAGCGG + Intronic
1092422307 12:8342054-8342076 CATGTCACTCCAAATCTCAGTGG - Intergenic
1092431948 12:8417281-8417303 CATGTTACTCCCAATATCACAGG + Intergenic
1093985375 12:25525611-25525633 CATTCTCTTCCCAATGTCAAAGG - Intronic
1095659226 12:44709579-44709601 ATTGCTGCTCCAAATCTCAGTGG - Intronic
1101329524 12:103746184-103746206 CAGGCTTCTCCCTAGCTCAGTGG + Intronic
1101902338 12:108799984-108800006 AATTCTCCTGCAAATCTCAGTGG + Intronic
1101963957 12:109269324-109269346 CTTCCTCCTCCCCATCCCAGAGG - Intergenic
1103731256 12:123029136-123029158 GAGGCTGCTGCCAATCTCAGAGG - Intronic
1103970107 12:124665317-124665339 GATTCGACTCCCAATCTCAGGGG + Intergenic
1103972954 12:124683485-124683507 CATGCTGCTCCCGACCCCAGAGG - Intergenic
1104324982 12:127787150-127787172 CCTGCTCCTGCCAAGATCAGAGG - Intergenic
1105889792 13:24674396-24674418 CATGCTGCTCTCATTCTCAAGGG + Intergenic
1106157449 13:27171651-27171673 CATCTTCCACCCAATCACAGCGG + Exonic
1107345523 13:39456239-39456261 TATGCTCTTCCAAATTTCAGAGG + Intronic
1111353724 13:87069127-87069149 CATACACTTCCCCATCTCAGTGG - Intergenic
1111931028 13:94513550-94513572 CATTCCCCACCAAATCTCAGAGG - Intergenic
1112729724 13:102347422-102347444 CATCCACCTCACCATCTCAGGGG - Intronic
1116601027 14:46922797-46922819 CATGCTGCTGCCAGTCTCAGAGG - Intronic
1118004021 14:61549091-61549113 CATGCTCTCCCTAATCCCAGGGG - Intronic
1121580804 14:95028129-95028151 CATGCTCCTCCCAGGCTATGAGG + Intergenic
1124353420 15:28977375-28977397 TGTGCTCCTCCCAAATTCAGAGG - Intronic
1125308102 15:38345625-38345647 CTTGCTCCTCCAAATCCCATGGG + Intronic
1125603552 15:40928090-40928112 CCGGCTTCTCCCAGTCTCAGGGG - Intergenic
1126466366 15:48964763-48964785 CATCCTCCTCCCAAGCTCCCTGG + Intergenic
1126705049 15:51398664-51398686 CATCCCCCTCCCCAACTCAGTGG + Intronic
1127543864 15:59970846-59970868 CAAGATCCTCCCAATCTGAAAGG + Intergenic
1127931411 15:63599866-63599888 CAGGCTCCTCACAACCCCAGTGG + Intronic
1128750104 15:70142712-70142734 CAAGCTCCTCCAAATCGCGGGGG + Intergenic
1131907508 15:97159221-97159243 CATTCTCCTCCCTACCTCCGAGG - Intergenic
1135169745 16:20173344-20173366 AATGATCCTCCCACTGTCAGAGG + Intergenic
1135802682 16:25512799-25512821 CACGCTCCTCCAAATCTTAGAGG + Intergenic
1138489243 16:57366582-57366604 CAAACACCTCCAAATCTCAGTGG + Intergenic
1140516967 16:75550245-75550267 CATGCTTCCTCCAAGCTCAGAGG - Intronic
1141395316 16:83699322-83699344 GATGCTGCTCCCACACTCAGTGG - Intronic
1147445385 17:40472154-40472176 CATAGTCCTCCCAAGCTCAGAGG + Intergenic
1148195647 17:45710803-45710825 CATCCCCCTGCCCATCTCAGGGG - Intergenic
1150218604 17:63483657-63483679 CATGCTCCTCCAGACCTCAAAGG + Intergenic
1151132297 17:71909550-71909572 CCTGCTCCTCCCAACCTCACAGG + Intergenic
1153097636 18:1426616-1426638 CATGCCCATCCCCAACTCAGAGG + Intergenic
1155393929 18:25366649-25366671 CATGCTCCTCCCCAGGTGAGGGG - Intergenic
1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG + Intergenic
1158128247 18:54125351-54125373 CATACACCCCCAAATCTCAGTGG - Intergenic
1160136675 18:76277686-76277708 AATGCTCCTCCCAAGATGAGTGG + Intergenic
1161492355 19:4568979-4569001 CCTGCTCAGCCCAATCTCACTGG + Intergenic
1161752386 19:6107531-6107553 CATGCACCTCCCAGGCTCAAGGG - Intronic
1162800751 19:13109351-13109373 CAGGCTCCTCCCGACCCCAGGGG + Intronic
1164840484 19:31389191-31389213 CATGCTCCTCCAGCTCCCAGAGG + Intergenic
1168421628 19:56207844-56207866 CATGCTCCTTCCAGCGTCAGGGG + Intronic
1168426876 19:56246005-56246027 CATGCTCCTTCCAGTGTCAGGGG + Intronic
925192492 2:1896398-1896420 CATGCTCTTCACAATAGCAGAGG + Intronic
927138916 2:20116406-20116428 CATCCTCCTCCCAGGCTGAGGGG + Intergenic
927378811 2:22453265-22453287 CAAACAACTCCCAATCTCAGTGG + Intergenic
928141285 2:28731557-28731579 CATGCCCCTCAATATCTCAGAGG + Intergenic
931835253 2:66092363-66092385 CATGCTTCTCCCAAGGTTAGAGG + Intergenic
931910580 2:66895457-66895479 CAGGCACCTCCAAATCTAAGAGG + Intergenic
938391540 2:130910569-130910591 CATGCTTCTCCTAATCACAGAGG + Intronic
939956523 2:148531986-148532008 CATTTTCCTCCTAAGCTCAGTGG + Intergenic
944483282 2:200178661-200178683 CATGCTCCTCTCAATCTGAAAGG + Intergenic
947304967 2:228735511-228735533 CATGCTTCTCTCCATCTCTGTGG - Intergenic
947863458 2:233379393-233379415 CGGGCTCCTCCCAATCTGAGAGG - Intronic
948093353 2:235314298-235314320 CATGCCCCCCACAATCACAGTGG + Intergenic
1170599734 20:17832020-17832042 AGTGCTCCTTCCAATCTCTGGGG - Intergenic
1170652668 20:18257046-18257068 CCTGTTGCTCCCAACCTCAGGGG - Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171237227 20:23536801-23536823 CATGCTCCCCATAGTCTCAGAGG + Intergenic
1171427672 20:25058534-25058556 CCGGCTCCTCCCCATCCCAGAGG - Intronic
1173038357 20:39434656-39434678 CATTAACCTCCCAATTTCAGTGG - Intergenic
1174454906 20:50642034-50642056 CCGGCTCCTCCCCATCCCAGGGG + Intronic
1174471896 20:50767696-50767718 CCGGCTCCTCCCCATCCCAGGGG - Intergenic
1174548379 20:51343571-51343593 CATTCTCCACCCAATAGCAGAGG - Intergenic
1174970589 20:55271003-55271025 CATGGTCCTCTCTCTCTCAGGGG + Intergenic
1175951763 20:62587465-62587487 CATGCTCCTCTTTATCTCAGGGG - Intergenic
1176215042 20:63944019-63944041 CAGGCTCCTCTCTTTCTCAGGGG - Intronic
1176383922 21:6127628-6127650 CAGACTCCTCCCAAGATCAGAGG - Intergenic
1178013998 21:28321281-28321303 CATTGTTCTCTCAATCTCAGTGG + Intergenic
1178780023 21:35593934-35593956 ACTGCTCCTCCCAACCTCACCGG + Intronic
1179739552 21:43410610-43410632 CAGACTCCTCCCAAGATCAGAGG + Intergenic
1182963586 22:34500994-34501016 CATGCTTCTCCCAATAACAATGG - Intergenic
1182979191 22:34652386-34652408 CATGCTCCTTTCAGTCTGAGGGG - Intergenic
1183601156 22:38841370-38841392 CAGGATCCCCCCAACCTCAGCGG + Intronic
1183731075 22:39618944-39618966 GATGTTCCTCCCACTTTCAGAGG + Intronic
1184480426 22:44743499-44743521 CAAGCATCTCCCAATCACAGGGG - Intronic
1185010195 22:48308644-48308666 AATGATACTCCCAATCTCGGAGG - Intergenic
949940185 3:9148744-9148766 CATGCTCCTCCCCAGTTCTGGGG + Intronic
950089689 3:10286854-10286876 CATGCCCATCCCCATCTCAAAGG + Intronic
950532482 3:13560355-13560377 CATGCTCCTCACACGCTCACTGG - Intronic
950637872 3:14328394-14328416 CATCCTTCTCCCTTTCTCAGAGG + Intergenic
953569414 3:44059230-44059252 CCTTCTCCTTCCAATCTCACTGG - Intergenic
957066103 3:75523654-75523676 CATGTCACTCCAAATCTCAGTGG - Intergenic
957440408 3:80239249-80239271 CATGCTTGTTCCAATCACAGAGG - Intergenic
958792102 3:98663479-98663501 CACCCTCCTCCCCATCTTAGAGG - Intergenic
961404522 3:126668764-126668786 CCAGCTCCTCCCCACCTCAGGGG - Intergenic
961628338 3:128279049-128279071 CATTCTCCTCCCCAACTCAAAGG - Intronic
964628119 3:158778517-158778539 CTTTGGCCTCCCAATCTCAGTGG + Intronic
964915998 3:161842767-161842789 TATGTTCTTCCCATTCTCAGAGG + Intergenic
964928607 3:161987334-161987356 CTTTGTCCTCCCAATCTCATCGG - Intergenic
966854996 3:184187757-184187779 CATGCTTCCCCCACTCACAGAGG - Exonic
971457408 4:26857837-26857859 CCGGCTCCTCCCCATCCCAGAGG - Intronic
973316561 4:48766576-48766598 CATGATCCACCCAGTCACAGGGG + Intronic
976616128 4:87079241-87079263 CAAGAGCCTCCCAGTCTCAGTGG + Intronic
977638755 4:99331178-99331200 CATGCACCTCCCATTCTGAACGG + Intergenic
980020325 4:127701845-127701867 CATTCTCCTCCCACTTTCACTGG - Intronic
981015703 4:139971875-139971897 GCTGATCCTCCCAATCTCATAGG - Intronic
982698553 4:158632388-158632410 CATTCTCCTACCTATCCCAGTGG + Intronic
985633112 5:1023757-1023779 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633146 5:1023880-1023902 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633156 5:1023921-1023943 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633222 5:1024167-1024189 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633330 5:1024577-1024599 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633396 5:1024823-1024845 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633416 5:1024905-1024927 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633478 5:1025151-1025173 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633566 5:1025520-1025542 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985649849 5:1102387-1102409 CAACCTCCTCCCTTTCTCAGTGG + Intronic
985879691 5:2628830-2628852 CATGCTGCTTCCTCTCTCAGTGG + Intergenic
988772769 5:34448832-34448854 CCTGCTCCTCCCCAGGTCAGTGG + Intergenic
989199404 5:38748810-38748832 CATGTTCCACCCAATCTCTCAGG - Intergenic
990180786 5:53157933-53157955 CCTGCTACTGCCAATCTCAGAGG - Intergenic
990275803 5:54194905-54194927 CATGCTCCTTCAAATCCCAAAGG + Intronic
990722378 5:58711212-58711234 CTTGCTCATCCCACTCCCAGGGG - Intronic
991772618 5:70053804-70053826 CAACCTCCTCCCAAGCTCAAGGG + Intronic
991851911 5:70929228-70929250 CAACCTCCTCCCAAGCTCAAGGG + Intronic
993686641 5:90945773-90945795 CATGCTCTTCTCAATCTCCTGGG - Intronic
1001375404 5:171251778-171251800 CATCTTCCACCCAATCACAGAGG - Intronic
1004860225 6:19796418-19796440 AATGCTCCTCCCCACCTCACTGG + Intergenic
1004920735 6:20373088-20373110 AATCCTCCTCCCCTTCTCAGAGG + Intergenic
1007113892 6:39329752-39329774 TCTGCTCCTCCCTGTCTCAGCGG - Intergenic
1009842603 6:69095366-69095388 CATGCTCCTCTCCATCTGTGTGG - Intronic
1011832936 6:91395215-91395237 CATTCTCCACCCAATGTTAGTGG + Intergenic
1014101926 6:117520480-117520502 CATCCTCCTCCCTAGCTCAGGGG + Intronic
1015910938 6:138167065-138167087 CATTCTCATTCCCATCTCAGAGG + Intronic
1016092233 6:139993848-139993870 CATTCTCATCCCAGTCTCAGAGG - Intergenic
1018396290 6:163380290-163380312 CATGCTCCTCCCCATCCCAGGGG + Intergenic
1019311384 7:362997-363019 CATTCTCCATCCCATCTCAGGGG - Intergenic
1021068729 7:16210355-16210377 TATGCTCCACCCACACTCAGGGG - Intronic
1030400974 7:109049760-109049782 CAAGCTCCTCCTTATCACAGAGG - Intergenic
1032197411 7:129797413-129797435 CCTCTACCTCCCAATCTCAGAGG + Intergenic
1032929241 7:136647326-136647348 CATGTTGGTCCAAATCTCAGGGG - Intergenic
1033754919 7:144390387-144390409 CATCCTCTTACCAATCTCAGTGG + Intergenic
1037380075 8:18275721-18275743 TATGCTCCTCTGAATGTCAGAGG + Intergenic
1040575166 8:48645697-48645719 CCTGCTCCTCCCAGTCCCAGTGG + Intergenic
1044920554 8:97165459-97165481 CATTCTCCTCCCAACCCCAAAGG + Intergenic
1045561122 8:103264189-103264211 CATGCTCTGCCCATTCTCTGGGG - Intergenic
1046770612 8:118112897-118112919 CAAGCTCCTGCCACTCCCAGTGG + Intergenic
1050162501 9:2732907-2732929 CCCACTCCTCCCAATCTCACTGG + Intronic
1052951003 9:34211613-34211635 CTTTCTCCTCCCCTTCTCAGAGG + Intronic
1053424409 9:38001681-38001703 CAGTCTCCTCCCACTCTAAGAGG - Intronic
1056676051 9:88677775-88677797 CATGGTCCTCACAATCTCCATGG - Intergenic
1056781205 9:89552707-89552729 CATCCCGCTCCTAATCTCAGAGG + Intergenic
1059355350 9:113694950-113694972 CCTGCCCCTGCCAATGTCAGCGG - Intergenic
1061166513 9:128925792-128925814 TATGTTCCTCCCAAATTCAGGGG + Intronic
1061421888 9:130477151-130477173 CATGTTCCTCCCAAGCCTAGAGG - Intronic
1061913621 9:133737982-133738004 CCTCCTCCTCCCAGGCTCAGGGG + Intronic
1062433701 9:136536795-136536817 CATGCTCCTCCCCTGCCCAGGGG + Intronic
1186397852 X:9227894-9227916 CATGCTGCTGCCCTTCTCAGAGG - Intergenic
1186877871 X:13834694-13834716 CCTGCTCCACCCACTCACAGGGG + Intronic
1188504271 X:30864514-30864536 ATTGCTCCTCCCAATCAGAGAGG + Intronic
1189178598 X:38982347-38982369 CCAGCTCCTCCCAATCCCATAGG - Intergenic
1190913188 X:54790450-54790472 CACTCTCCTGCCATTCTCAGTGG + Intronic
1191078244 X:56480098-56480120 AATTCATCTCCCAATCTCAGTGG - Intergenic
1193380075 X:80808565-80808587 CTTTCCCCTCCCAATCTAAGCGG + Exonic
1193529328 X:82637291-82637313 TATTCTGCTCCCAATCTTAGAGG + Intergenic