ID: 1092273434

View in Genome Browser
Species Human (GRCh38)
Location 12:7041074-7041096
Sequence TACATAGTGGTGGCATCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092273434 Original CRISPR TACATAGTGGTGGCATCCTA GGG Intronic
900944044 1:5819634-5819656 CAGATACAGGTGGCATCCTAGGG - Intergenic
908903770 1:68985209-68985231 TAGGCAGTGGTTGCATCCTATGG + Intergenic
910483670 1:87686047-87686069 TCCATTGTCGTGGCTTCCTACGG - Intergenic
920855840 1:209660924-209660946 GACATCATGGTGGCATCCTCTGG + Intergenic
1063074462 10:2700740-2700762 TAGATAGACGTGGCATGCTAAGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069588419 10:69626754-69626776 CAAATAAGGGTGGCATCCTAGGG + Intergenic
1074459201 10:113621544-113621566 TTCCTAGTGGTGGCCTGCTAGGG - Intronic
1077354833 11:2110689-2110711 GTCATAGAGGTGGAATCCTACGG - Intergenic
1082855054 11:57798543-57798565 GAAATTGTGGTGGCATCCTTGGG + Intronic
1086907410 11:92433550-92433572 TACATAGTGGGTGCAGCCCACGG - Intronic
1087190273 11:95247086-95247108 TATATAGTAATGGCCTCCTAAGG + Intergenic
1092273434 12:7041074-7041096 TACATAGTGGTGGCATCCTAGGG + Intronic
1102740348 12:115201423-115201445 TGCATAGTAGTAGCATCTTAGGG - Intergenic
1106554229 13:30796379-30796401 GACCTAGTGGTGGCACCCAAAGG + Intergenic
1107841837 13:44466167-44466189 CACATAGGGCTGGCATCCAAGGG + Intronic
1115745375 14:36431254-36431276 TACATAGTTTTGGTATCTTAGGG + Intergenic
1116658165 14:47675770-47675792 AACGTAGTGGTGGCATCCAGAGG + Intergenic
1125276299 15:37995690-37995712 CATATAGTGCTGGGATCCTAAGG - Intergenic
1129848392 15:78778447-78778469 GCCATAGTGGTGGCCACCTAAGG - Intronic
1139464766 16:67148596-67148618 TTAATAGTGGTGGCATCTCAGGG + Exonic
1147119229 17:38326006-38326028 TACAAAGTGTTGGCAACGTAGGG - Exonic
1148513382 17:48192773-48192795 TCCTTAGTGGTGGCATTCTTGGG - Intronic
1151256570 17:72881636-72881658 TTCATAGAGCTGGCATCCCATGG + Intronic
1157529079 18:48407235-48407257 AACAGAGTTCTGGCATCCTATGG + Intronic
1158723018 18:59942676-59942698 TACTTTGTGGTAGCAGCCTAGGG + Intergenic
1161556540 19:4945839-4945861 TATATCTTGGTGGCATCCTCAGG + Exonic
927422441 2:22947653-22947675 AGCATAGAGGTGGCAACCTATGG + Intergenic
935568739 2:104636673-104636695 TACAAAGAGGAGGCATCCTTTGG + Intergenic
942678761 2:178455022-178455044 GACGTGGTGGTGGCATCCAACGG + Intronic
944284655 2:197935408-197935430 TACATATTAATAGCATCCTATGG - Intronic
946531006 2:220570345-220570367 AACAGAGTGATGGAATCCTAAGG + Intergenic
948336059 2:237208038-237208060 TACATATTGGTTGCATGCAATGG - Intergenic
1170422906 20:16210232-16210254 TACAAAGTGGTGACTTCCTAAGG - Intergenic
1175192597 20:57221669-57221691 GACATAGTGGTGTGTTCCTATGG + Intronic
960585343 3:119316062-119316084 TACATAGAGCTTGCATCCTAGGG - Intronic
970667368 4:18353482-18353504 TTCATAGTGGTGGCAGCCACAGG - Intergenic
974976502 4:68900578-68900600 TGCATAGTGGTGGCATTAAATGG + Intergenic
974989643 4:69069935-69069957 TACATAGTGGTGACATTAAATGG - Intronic
979962057 4:127033022-127033044 TTTCTTGTGGTGGCATCCTATGG - Intergenic
980830603 4:138126303-138126325 TACATTGTGTTCACATCCTAGGG + Intergenic
981071822 4:140548710-140548732 AACATAGTACTTGCATCCTAGGG + Intronic
982111813 4:152063545-152063567 TACACAGTGGTGACATTCTTTGG - Intergenic
988510566 5:31861168-31861190 TGCACAGTGGCTGCATCCTAAGG - Intronic
988713662 5:33803474-33803496 TATTTGTTGGTGGCATCCTAAGG - Intronic
1007164917 6:39822278-39822300 TACAAAGAGGTGGCCTCCCATGG + Intronic
1012661564 6:101902242-101902264 TACATATTAGTGGTATCCTAGGG - Intronic
1017960753 6:159218603-159218625 TACAGAGTGGTCGCATGTTAAGG + Intronic
1021903651 7:25312256-25312278 AACAGTGTGGTGACATCCTATGG - Intergenic
1029299047 7:99564091-99564113 TACACAGTGGTGGCATCCTGGGG - Intronic
1041322512 8:56628421-56628443 TGCTTAGTGATGGCATCCTGAGG - Intergenic
1044051481 8:87511270-87511292 TACATAGTGCTGGCAACTAAGGG - Intronic
1057693133 9:97304665-97304687 TACATGGTAGTATCATCCTATGG - Intergenic
1186409904 X:9337645-9337667 CAAATAGTGGTGGCTTCCGATGG + Intergenic
1193051821 X:77110171-77110193 TATATAGTGCTGGCATTTTATGG + Intergenic
1196372058 X:114990276-114990298 TATATAGTGGTGGAATTCTGAGG - Intergenic