ID: 1092273962

View in Genome Browser
Species Human (GRCh38)
Location 12:7045212-7045234
Sequence AAGAATAGCCTAACATAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092273962_1092273966 28 Left 1092273962 12:7045212-7045234 CCCGGCTATGTTAGGCTATTCTT 0: 1
1: 0
2: 1
3: 17
4: 174
Right 1092273966 12:7045263-7045285 GGATAATTTATAAAGAAAAGAGG 0: 374
1: 4785
2: 10303
3: 8877
4: 5607
1092273962_1092273964 7 Left 1092273962 12:7045212-7045234 CCCGGCTATGTTAGGCTATTCTT 0: 1
1: 0
2: 1
3: 17
4: 174
Right 1092273964 12:7045242-7045264 TCTAAAATAATGCCTGAGACTGG 0: 1
1: 0
2: 14
3: 474
4: 4322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092273962 Original CRISPR AAGAATAGCCTAACATAGCC GGG (reversed) Intronic
901353189 1:8617181-8617203 AAGAATACAAAAACATAGCCGGG + Intronic
903842590 1:26254554-26254576 AAGAATAACTTCACATATCCAGG + Intronic
905551263 1:38841838-38841860 AAAAATAAACTAACATAGGCTGG + Intronic
906498372 1:46321847-46321869 AAGAAATGCCTAAGATGGCCGGG + Intergenic
906956387 1:50378508-50378530 AAGAACAGCCTCCCATTGCCAGG + Intergenic
911304789 1:96220313-96220335 AAGAAAAGACTAATAGAGCCAGG - Intergenic
912621575 1:111164915-111164937 AAAAATAACCTAATATAGGCCGG - Intronic
913380177 1:118202052-118202074 AAGAATGAACTAACACAGCCTGG - Intergenic
919083504 1:192892898-192892920 AAGAATAGTGTGACATACCCAGG - Intergenic
920900511 1:210106046-210106068 AAGAATGGCCTAACACAGCAGGG + Intronic
924010548 1:239660585-239660607 AATAATAGATTAACATGGCCAGG + Intronic
924287671 1:242504994-242505016 AAGATTAGCATAAATTAGCCAGG + Intronic
924806286 1:247364400-247364422 AGAAATAGGCTAAGATAGCCGGG + Intergenic
1063506985 10:6608505-6608527 AAGGATCACCTAACACAGCCTGG + Intergenic
1064300459 10:14118514-14118536 GAGAACAGCCGAATATAGCCAGG - Intronic
1068978731 10:63038167-63038189 AAGAATAACCTTACCTGGCCAGG - Intergenic
1069334985 10:67338080-67338102 AAGAATAGCCTAACACAATCTGG - Intronic
1070869290 10:79735597-79735619 AAGAATTATCTAACATAACCTGG - Intergenic
1071636209 10:87257789-87257811 AAGAATTATCTAACATAACCTGG - Intergenic
1071659032 10:87480154-87480176 AAGAATTATCTAACATAACCTGG + Intergenic
1072843490 10:98801872-98801894 CAGAATAGCCGAACCTACCCTGG + Intronic
1073113305 10:101075775-101075797 AAGAAGAGCCTAACAGAGGTGGG + Intergenic
1073358482 10:102876571-102876593 AAGAATAGTATAACTTTGCCAGG - Intronic
1073471116 10:103722949-103722971 ACTAATAGCCTGAAATAGCCTGG - Intronic
1074746694 10:116541612-116541634 AAGGCTAGACTAACACAGCCTGG + Intergenic
1075366137 10:121891635-121891657 AAGAATTGCTTAGAATAGCCAGG + Intronic
1080165671 11:29233222-29233244 AAGAATGGCCTAACACAGCCTGG + Intergenic
1082805569 11:57447419-57447441 AAGAACAGCCTAATACATCCAGG - Intergenic
1085028614 11:73256074-73256096 AAAAATAGAATAAAATAGCCAGG - Intergenic
1085905333 11:80753789-80753811 AATAAAATCCTAATATAGCCAGG - Intergenic
1090219415 11:125004691-125004713 AAGCCTAGCCTAACATGGCACGG - Intronic
1090452791 11:126821393-126821415 AAGAATATCCAAAAATGGCCAGG - Intronic
1091130907 11:133146606-133146628 AAAATTAGCCTAGCATGGCCAGG - Intronic
1092273962 12:7045212-7045234 AAGAATAGCCTAACATAGCCGGG - Intronic
1099798428 12:87427022-87427044 AATAATAGACTATCATAGACTGG + Intergenic
1102163699 12:110789328-110789350 AAGAATAGACTAATATGGCTGGG + Intergenic
1102968765 12:117149293-117149315 AAGAAAATCCAAACATGGCCAGG - Intronic
1104572678 12:129938813-129938835 AAGAATCGCCTAACACAGATGGG - Intergenic
1105582314 13:21710449-21710471 AAGAATGACCTAACACAGTCAGG - Intergenic
1107203981 13:37759222-37759244 ATGAATAGCCTAACTTTGCTTGG - Intronic
1108611923 13:52092588-52092610 AAGAAGGGACTAACATGGCCAGG + Intronic
1109204109 13:59462521-59462543 AAAAATAGCATAAAATTGCCAGG - Intergenic
1109591539 13:64490601-64490623 AATAATAATCTAACATATCCCGG + Intergenic
1114756800 14:25269173-25269195 AAGATTGCCCTAAGATAGCCAGG + Intergenic
1117032800 14:51691888-51691910 AAAAATATAGTAACATAGCCAGG - Intronic
1118272166 14:64353540-64353562 TAGAATTGCCTATCATAGCCGGG - Intergenic
1120722867 14:87906666-87906688 AAGAACAGTGTAACAAAGCCAGG - Intronic
1122460990 14:101895132-101895154 TAAAATAGGCTATCATAGCCAGG + Intronic
1122850132 14:104523529-104523551 AAGAATGGCCTAATACAGCTGGG - Intronic
1125589833 15:40847198-40847220 AAGAATGGCCTAGAATGGCCTGG - Intronic
1126850180 15:52791676-52791698 GAGAATAGCCTCTCAGAGCCGGG + Intergenic
1131207114 15:90459615-90459637 AAAAATTGCTTAACATTGCCAGG + Intronic
1131929887 15:97429910-97429932 AAGAATTGCCTAATATAGGCAGG + Intergenic
1132119068 15:99160716-99160738 AAGAAAAGCTTAACAGAGGCCGG + Intronic
1132157597 15:99507255-99507277 AAGAGTAGCCTAAGAAAACCTGG + Intergenic
1133095948 16:3445569-3445591 AAGAATAGCATTAAATAGGCGGG - Intronic
1135638236 16:24097330-24097352 AAGAAAAGCCTAAGATAGGCTGG - Intronic
1135875110 16:26191613-26191635 AAGATGAGCGTAACATATCCAGG + Intergenic
1135941908 16:26829214-26829236 AAGAATATCAAAACATAACCAGG + Intergenic
1136046784 16:27621563-27621585 AAAAATGGCCTAACGTAGCTTGG - Intronic
1138118301 16:54377868-54377890 AAGAATAGACTAACACAGAAGGG + Intergenic
1138912143 16:61413685-61413707 AAGAGTAGCCAAATATAGACAGG - Intergenic
1139364289 16:66424248-66424270 AAGAACGGCTTAACACAGCCAGG - Intergenic
1140884740 16:79233133-79233155 AAGAATGGCCTATCAAGGCCGGG - Intergenic
1143877289 17:10001655-10001677 AGGAAGAGCTTAACATAACCAGG + Intronic
1146146492 17:30422919-30422941 ATGAATATCCTAACATTACCCGG + Exonic
1146984951 17:37206959-37206981 AAGAATAATCTATCTTAGCCTGG + Intronic
1147394426 17:40130612-40130634 CAGAACAGCCAAACAAAGCCTGG - Intronic
1149016836 17:51917431-51917453 AAGAACAGCTTAACATACACAGG - Intronic
1153861321 18:9211244-9211266 AATAATAGCATAACATACCTAGG + Intronic
1155423474 18:25681142-25681164 ACGAATAGCCTACCATTGACTGG - Intergenic
1159314985 18:66761247-66761269 TAGAATAGCCTACAAGAGCCCGG + Intergenic
1160759272 19:774764-774786 AGAAATATCCTAACATGGCCAGG - Intergenic
1161997708 19:7724045-7724067 AAGAATGGCCTAACACAGCTGGG - Intergenic
1162801642 19:13114369-13114391 AAAATTAGCCTGGCATAGCCAGG + Intronic
1164170418 19:22720075-22720097 AAAAAAATCCAAACATAGCCAGG + Intergenic
1165403365 19:35615722-35615744 AAGAAAAGCCTATCATAGAAGGG + Intronic
925417574 2:3681783-3681805 AAGAATCGCCTTGCACAGCCAGG - Intronic
930260550 2:49141235-49141257 AAGAACAGCCTAACACAGATGGG - Intronic
930956573 2:57210053-57210075 AAGAATAGATTAACAGAGGCAGG - Intergenic
931727509 2:65125707-65125729 AAGAAATGCTTAACATGGCCAGG - Intronic
935078876 2:99772454-99772476 GAGAAGAGCTGAACATAGCCAGG - Intronic
936014729 2:108949275-108949297 AAAAATAGCCTATGTTAGCCAGG - Intronic
936813085 2:116426006-116426028 CAGAATAGGCTGACATATCCTGG + Intergenic
938781139 2:134585992-134586014 AAGAAGAGCCCAACAAAGTCTGG + Intronic
939679946 2:145118111-145118133 AAGAATAGCATAACAGAGGGAGG + Intergenic
942592398 2:177560099-177560121 AAGAATGGTCTAACACACCCAGG - Intergenic
942635865 2:178004835-178004857 GATAATAACCTGACATAGCCAGG - Intronic
943275579 2:185863376-185863398 AAGAATAGCCTAACACATCAGGG + Intergenic
946352725 2:219165835-219165857 AAGAATATCCTTACTTAGGCGGG + Intronic
946798152 2:223378796-223378818 AACAAGAGCCTGGCATAGCCTGG + Intergenic
946913987 2:224496680-224496702 AAAAATAGCATAGCATAGCATGG + Intronic
1170988573 20:21281098-21281120 AACAGTAGCCTAACATGGCCAGG - Intergenic
1171481259 20:25457475-25457497 AAGAATACACTAACACAGCGAGG - Intronic
1177168924 21:17634077-17634099 CAGAATAGCCTCACATACACTGG + Intergenic
1180079417 21:45480037-45480059 AAGACAAGCCTATCATACCCTGG - Intronic
1182882202 22:33743264-33743286 AAGAATGGCTTAATATACCCAGG + Intronic
1182917577 22:34049233-34049255 AAGAATGGCCTAACACAACTGGG - Intergenic
949892728 3:8745384-8745406 AAGAATAGCCTAATACAGGTAGG + Intronic
950836896 3:15929081-15929103 AAGAATGGCCTAATACAACCTGG - Intergenic
951244609 3:20325974-20325996 AAGAAAAGCCAAAAAAAGCCTGG + Intergenic
953628136 3:44587728-44587750 AAGAATAGCCTAACACAAAGGGG - Intronic
954098358 3:48349498-48349520 AAGAACAGCCTGACTGAGCCAGG - Intergenic
954929347 3:54267670-54267692 AAGAAAAGCTTAAAACAGCCAGG - Intronic
955318925 3:57960527-57960549 AAGAATGGCCTAGCAAAGCCTGG - Intergenic
956732859 3:72213057-72213079 AAGAATAGACTAACACACCCTGG - Intergenic
959706869 3:109346271-109346293 CAGAACAGCCTTCCATAGCCAGG - Intergenic
960927045 3:122804420-122804442 GAGAATAGCCTAATATAGTTTGG - Intronic
962176906 3:133164699-133164721 AAGAGGCCCCTAACATAGCCAGG - Intronic
964137270 3:153358810-153358832 AGGAATAACCTATCATAGCATGG + Intergenic
965280497 3:166745879-166745901 AAAAATAGCCTGAGAAAGCCAGG - Intergenic
966400018 3:179538359-179538381 AAGAATGGCCTAACAGACACAGG - Intergenic
967160229 3:186729953-186729975 AATAATAAACAAACATAGCCAGG - Intronic
967161349 3:186741287-186741309 AATAATACCATAAAATAGCCAGG - Intronic
970198620 4:13578199-13578221 AAGAGTAGTCTAACCCAGCCGGG - Intronic
971504702 4:27353640-27353662 AAAAATAGCATAGCATGGCCAGG - Intergenic
972599558 4:40560157-40560179 AGGAATTTCCTAACATGGCCAGG + Intronic
973053634 4:45627326-45627348 AAGAATAGCATAATCTGGCCCGG - Intergenic
973981606 4:56312890-56312912 AAGATTAGCAAAACATAGCCAGG - Intronic
974628283 4:64452095-64452117 AAGAATTGCCTAATATAGGTGGG - Intergenic
974686425 4:65237226-65237248 AAGAAGAGCCTATTAGAGCCAGG + Intergenic
974942049 4:68481622-68481644 AAGAACAGCCTAATACAGACAGG - Intronic
975188897 4:71436876-71436898 AAGAGCAGCCACACATAGCCTGG - Intronic
975249117 4:72156790-72156812 AAGATTATCCAAACATACCCTGG - Intergenic
976015425 4:80546899-80546921 AAGAATGGTCTAACATAGATAGG + Intronic
976407902 4:84680182-84680204 AAGAATATCCAAAAATAGCTGGG - Intronic
976523577 4:86059278-86059300 TAAAATAGCTTAATATAGCCAGG + Intronic
977033160 4:91914110-91914132 ACAAATAGCCTAACATAGAAGGG + Intergenic
977320154 4:95503758-95503780 AAGAAAAGCATAAAATAGCATGG + Intronic
977692986 4:99937019-99937041 AAGAAAAGAATAACATCGCCAGG + Intronic
978037431 4:104012859-104012881 AAGAATAGTAGAACATAGCTTGG + Intergenic
979056840 4:116006133-116006155 AAGAATTGGCTTACATACCCTGG - Intergenic
979715324 4:123830579-123830601 AAGAGTATCCTACCACAGCCAGG - Intergenic
981123765 4:141082535-141082557 AAACATAGCCTAATATAGCAGGG + Intronic
982997263 4:162365572-162365594 AAGAAGGGCCTAACACAGCAAGG - Intergenic
984155588 4:176192573-176192595 AAGAATAGCCTGATAGAGCTTGG + Intronic
986725124 5:10589914-10589936 AAGAAAAGCATAACATACACAGG - Intronic
990020986 5:51127542-51127564 AAGAATACCCCAAAATGGCCAGG + Intergenic
990384407 5:55245646-55245668 AAGAATAGCTTAATATAAGCTGG + Intergenic
991429631 5:66530770-66530792 GAGAATAGACTAATATAGCAAGG - Intergenic
992134956 5:73735332-73735354 AAGAATTTCCTAAGATAGGCAGG + Intronic
994193197 5:96892155-96892177 AAGAATATCTTAACATTGACAGG - Intronic
997246772 5:132356394-132356416 AAGAATGGCCTAACACACACTGG + Intergenic
1000603064 5:163297965-163297987 AAGAAGAGCCTAACAGAGTTAGG + Intergenic
1000827901 5:166069308-166069330 AAGAATATACTTACATAGACGGG - Intergenic
1000965568 5:167652057-167652079 AAGAAGAGCATAAGATAGCAAGG - Intronic
1007356734 6:41324680-41324702 AAGTTTATCCTATCATAGCCTGG - Intergenic
1007455563 6:41974602-41974624 AACAACAGCCCAACTTAGCCGGG + Intronic
1009598177 6:65763400-65763422 AAGCATGGCCTAATATAACCAGG + Intergenic
1010766592 6:79782295-79782317 AAGAATGGCCTAACACAGATAGG + Intergenic
1012848512 6:104419777-104419799 TAGAATAACTTAACCTAGCCTGG - Intergenic
1014233069 6:118925498-118925520 AACAGTAGGTTAACATAGCCTGG - Intronic
1015615397 6:135069350-135069372 AAGAAGAGCCAAACATAGACTGG + Intronic
1015951957 6:138562349-138562371 AAAGATACCCTAACATGGCCAGG + Intronic
1018451030 6:163907642-163907664 AAGAATAGGCAAACAAGGCCAGG - Intergenic
1018485066 6:164232729-164232751 AAGTATAATCTAACATACCCTGG - Intergenic
1022953241 7:35358547-35358569 AAGAATGGCCTAGAATTGCCAGG + Intergenic
1022981894 7:35611916-35611938 AAGAACTGCCTAATATAGACAGG + Intergenic
1023072129 7:36446365-36446387 AAGAATGGCCTAACACAGTGGGG - Intronic
1024268876 7:47627289-47627311 AAGTATCGCCAAACACAGCCCGG - Intergenic
1024434215 7:49330118-49330140 AAGAAAAGCCCAAGACAGCCAGG - Intergenic
1024586325 7:50845034-50845056 AAGAACAGCCTATGATGGCCAGG + Intergenic
1029722534 7:102378495-102378517 AAAAAGAACCTAACATGGCCGGG + Intronic
1030454393 7:109754792-109754814 AAGAATAGCCTATGACAGCCTGG - Intergenic
1030648970 7:112096476-112096498 AAGAATGGCCTAAAAAGGCCTGG - Intronic
1033582321 7:142749315-142749337 GAGAGTGGCCAAACATAGCCAGG + Intergenic
1033719164 7:144038716-144038738 CAAAATTGCCTAACATATCCAGG - Intergenic
1034364798 7:150536740-150536762 AAGAATGGCCTAACACAGCTTGG - Intergenic
1036692635 8:10953542-10953564 AAGAATGACCTAACACAGACGGG + Intronic
1036779761 8:11638026-11638048 AAGAATAGATTAAAATAGGCTGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042400627 8:68341884-68341906 AAGAATGGCCTAACACATCAGGG + Intronic
1043815565 8:84796818-84796840 AGGAATAACTTAAAATAGCCTGG + Intronic
1046129403 8:109947569-109947591 AAGAATAGCATAAGAAAGACCGG - Intergenic
1047600561 8:126421995-126422017 AAGAATATTCCAACCTAGCCTGG + Intergenic
1050687381 9:8187203-8187225 AAGAATATTCTAATATAGCCTGG + Intergenic
1053530032 9:38871387-38871409 AAGAATAGATTAACATTACCAGG - Intergenic
1054202258 9:62095814-62095836 AAGAATAGATTAACATTACCAGG - Intergenic
1054636100 9:67492546-67492568 AAGAATAGATTAACATTACCAGG + Intergenic
1057506590 9:95638744-95638766 AACAATAGCCTAAAATATCTTGG + Intergenic
1057641558 9:96827927-96827949 AAGAATACCAAAACAGAGCCTGG + Intronic
1058913539 9:109543112-109543134 AAGAATGGCCTAATACAGGCTGG + Intergenic
1060228963 9:121813203-121813225 CAGGGTAGCCTAACCTAGCCTGG + Intergenic
1186093880 X:6079146-6079168 AAGAATAGACTAATATAGCAGGG + Intronic
1187299716 X:18036332-18036354 AAGAATAGCCCAGCTGAGCCTGG + Intergenic
1187967242 X:24624262-24624284 AAGAATAGCTTAGCTTGGCCGGG - Intronic
1188071103 X:25719469-25719491 AAGTATAGTATAGCATAGCCAGG + Intergenic
1189622039 X:42851827-42851849 AACAAAAGCCAAACATAGCCAGG + Intergenic
1190121201 X:47660465-47660487 AAGAAAAGCTTAACTTGGCCAGG - Intergenic
1192948075 X:75987065-75987087 AAGAATAGCCTAATATACTTAGG - Intergenic
1197517178 X:127447703-127447725 AAAAATAAACGAACATAGCCAGG + Intergenic
1197722990 X:129757508-129757530 CAGAATAGACTAACCTGGCCAGG + Intronic
1198486707 X:137094613-137094635 AAGAAGGGCTTAACATGGCCTGG - Intergenic