ID: 1092274277

View in Genome Browser
Species Human (GRCh38)
Location 12:7047416-7047438
Sequence GCGATGCCCTGAGCCAGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092274273_1092274277 28 Left 1092274273 12:7047365-7047387 CCACTGAAGATTTTGAGAATACT 0: 1
1: 0
2: 1
3: 60
4: 2958
Right 1092274277 12:7047416-7047438 GCGATGCCCTGAGCCAGCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092274277 Original CRISPR GCGATGCCCTGAGCCAGCGT GGG Intronic
900381167 1:2384841-2384863 GCGATTCCCTGATCCCGTGTGGG - Intronic
900590166 1:3455917-3455939 GCGATGCCCACAGCCAGCAGAGG + Intronic
902102649 1:14004945-14004967 CCGATGCCCTGTGCCACCATGGG + Intergenic
902618072 1:17634762-17634784 GCAATGCCCTGGGCCAGCCCTGG + Intronic
904937133 1:34139327-34139349 GTGATGCCCTGTGCCACCATGGG + Intronic
904944522 1:34189606-34189628 GCCTTGGCCTGAGCCAGGGTGGG + Intronic
908722449 1:67140005-67140027 GTGATGCCCTGTGCCACCGTGGG + Intronic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
918200732 1:182264163-182264185 GCAATGCCCTGAGCCACCTCAGG + Intergenic
919510486 1:198457307-198457329 GTGATGCCCTGAGCCACCTCAGG - Intergenic
924612926 1:245588751-245588773 ACAATGCCCTGAGCCAGCGAGGG - Intronic
1063157181 10:3390732-3390754 TGGATGCCCTGAGCAAGCGAGGG - Intergenic
1065838704 10:29682089-29682111 GCAAAGCCCAGAGCCAGCATGGG - Intronic
1066393325 10:34996351-34996373 GCCATCTCCTGAGCCAGAGTAGG + Intergenic
1074887506 10:117705576-117705598 GTGATGCCCTGTGCCACCTTGGG + Intergenic
1076052871 10:127349222-127349244 GCAGTGCCCAGAGCCAGCATCGG - Intronic
1076899207 10:133328832-133328854 GTGAGGGCCTGGGCCAGCGTGGG - Intronic
1077057834 11:604159-604181 GGGGTGCCCTGAGCCTGGGTTGG + Intronic
1077310875 11:1888585-1888607 GGGGAGCCCTCAGCCAGCGTGGG - Intronic
1079351035 11:19692181-19692203 GTGAGGCCCTCAGCCAGTGTGGG - Intronic
1079996144 11:27297057-27297079 GTGATGCCCTGTGCCACCCTGGG - Intergenic
1086907776 11:92436705-92436727 TCGATGCCCTGTGCCAGCTTTGG + Intronic
1088218078 11:107536238-107536260 GCAATGCCCTGAACCAGAATAGG - Intronic
1089035562 11:115386546-115386568 GTGATGCCCTGAGCCGTCCTGGG - Intronic
1090047410 11:123348170-123348192 GTGATGCCCTGTGCCACCTTAGG + Intergenic
1092274277 12:7047416-7047438 GCGATGCCCTGAGCCAGCGTGGG + Intronic
1093457919 12:19382733-19382755 GTGATGCCCTGAGCCTCCCTGGG - Intergenic
1095186354 12:39204789-39204811 GAAATGCCCTTAGCCTGCGTAGG - Intergenic
1096121455 12:49091832-49091854 GCGATGCCCGGTGCCAGGGAAGG - Intronic
1099262498 12:80400655-80400677 GCGATGCCCTCTCCCTGCGTTGG - Intergenic
1103336626 12:120194766-120194788 GCGAGGCCGGGAGCCAGCGGGGG + Intergenic
1105793963 13:23832252-23832274 GTGAGGCCCTGAGCCACCTTGGG + Intronic
1111931425 13:94516735-94516757 GTGATGCCCTGTGCCACCTTGGG + Intergenic
1113451545 13:110413605-110413627 GCAGTGCACTGTGCCAGCGTGGG + Intronic
1120169308 14:81233117-81233139 GCAGTGCCATGAGCCAGAGTAGG + Intergenic
1122778491 14:104133692-104133714 GCCCTGCCCTGAGCCGGGGTCGG + Intergenic
1122882610 14:104696848-104696870 TCTGGGCCCTGAGCCAGCGTTGG - Intronic
1130557574 15:84933584-84933606 GTGATGCCCTGTGCCAACTTGGG - Intronic
1134067688 16:11239741-11239763 GGGATGCCCTGTGCCACCTTGGG - Intergenic
1135424841 16:22327272-22327294 CCGATCCCCTGAGACAGCCTAGG - Intronic
1136748472 16:32612951-32612973 GAGATGCTATGAGCCAGTGTCGG + Intergenic
1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG + Intergenic
1137285458 16:47012593-47012615 GTGATGCCCTGCGCCACCTTGGG - Intergenic
1137389368 16:48068649-48068671 GAGATGTCCTGAGCCAGTGCTGG - Intergenic
1141117741 16:81324916-81324938 GGGATGCCCTGGGCCAGGTTTGG + Intronic
1203050606 16_KI270728v1_random:872156-872178 GAGATGCTATGAGCCAGTGTCGG + Intergenic
1143688467 17:8539070-8539092 GTGATGCCCTGTGCCACCTTAGG + Intronic
1151959574 17:77398532-77398554 GGGATGGCGTGAGCCAGGGTGGG + Intronic
1152537932 17:80961166-80961188 GCCCAGCCCTGAGCCAGCCTGGG + Intronic
1152661292 17:81543492-81543514 GCTGTGCCCAGAGCCAGCTTGGG - Intronic
1152862264 17:82703260-82703282 GCTGTGCCCTGCTCCAGCGTGGG - Intergenic
1158040193 18:53084167-53084189 GTGATGCCCTGAGCCACCTCGGG - Intronic
1160868404 19:1266315-1266337 GCGGGGCCCAGAGCCAGGGTGGG - Intronic
1162812539 19:13172863-13172885 GGGGGGCCCTGAGCCAGTGTGGG + Intergenic
1164607875 19:29613032-29613054 GCGAAGCCCTGAGGCAGGGCAGG - Intronic
1167503835 19:49861327-49861349 GAGAAGCCTTCAGCCAGCGTTGG + Exonic
1168347798 19:55659359-55659381 GGGATCCCCTGGGCCAGCCTGGG + Intronic
1168491393 19:56813666-56813688 CCCATGCCCTCAGCCAGTGTGGG + Exonic
935026953 2:99286113-99286135 GTGAGGCCCTGAGCCACCCTGGG + Intronic
939046546 2:137256988-137257010 GTGATGCCCTGTGCCACCTTGGG - Intronic
939552558 2:143633918-143633940 GAGATGGCCTGAGTCAGAGTTGG - Intronic
940982645 2:160020666-160020688 GTGATGCCCTGTGCCACCATGGG + Intronic
942177587 2:173349335-173349357 GGGATCCCCTGAACCAGAGTAGG + Intergenic
946467501 2:219925067-219925089 GCCATGCTCTGAGCCAACATGGG + Intergenic
946908357 2:224437326-224437348 GCGATGCCCTGTGCCAACTCCGG + Intergenic
948652728 2:239458597-239458619 GGGATGCCCTGAGCCACGTTGGG - Intergenic
1168963344 20:1883588-1883610 GCCCTGCCCGGAGCCAGGGTGGG + Intergenic
1169395067 20:5221812-5221834 GTGATGCCCTGAGCCACCTCAGG + Intergenic
1171471720 20:25377505-25377527 GTGATGCCCTGAGCCACCTTGGG - Intronic
1172183935 20:33019927-33019949 GCCATGCCAAGAGCCAGGGTGGG - Intronic
1173707571 20:45123893-45123915 GCCATACCCTGAGCCAGGATGGG - Exonic
1175182281 20:57157114-57157136 GCCATGTCCTCAGCCAGAGTGGG - Intergenic
1183669372 22:39263444-39263466 GGGATGCCCTGCGCCATCTTGGG - Intergenic
1184593877 22:45502865-45502887 GCGCGGCCCTGGCCCAGCGTTGG + Intronic
1185420088 22:50730377-50730399 GCCATGCCCAGAGCCGGTGTCGG + Intergenic
954870332 3:53763070-53763092 GCTATGCCCTGAGCCTGTGGTGG + Intronic
956741987 3:72282340-72282362 GTGATGCCCTGAGCCATCCCAGG + Intergenic
957371404 3:79300071-79300093 GAGATGCCCAGAGCGAGCGAGGG - Intronic
961242996 3:125428521-125428543 GCAGTCCCCTGAGCCAGAGTAGG - Intergenic
961517333 3:127446095-127446117 GCAAGGCCCTGAGGCAGGGTGGG + Intergenic
962753358 3:138450766-138450788 GCCAGGTCCTGAGCCAGCTTTGG - Intronic
966900711 3:184482057-184482079 GAGATGCCCTGTGCCACCTTGGG - Intronic
969201569 4:5610617-5610639 GCAATGCCCTGAGCCTGTCTTGG - Intronic
969330604 4:6471925-6471947 GCGCTGCCCTGTGCCGGCGCTGG + Intronic
970264172 4:14262889-14262911 GCAATGCCTGCAGCCAGCGTTGG - Intergenic
979755792 4:124338904-124338926 GAGACGCCCAGAGCCAGCGAGGG - Intergenic
997978526 5:138454427-138454449 GCTGTGCCCAGAGCCAGTGTGGG + Intergenic
1000701115 5:164451670-164451692 GCAATGCCCGCAGCCGGCGTTGG - Intergenic
1001990342 5:176111340-176111362 GAGATGCTATGAGCCAGTGTCGG + Intronic
1002226529 5:177726800-177726822 GAGATGCTATGAGCCAGTGTCGG - Intronic
1002267318 5:178044413-178044435 GAGATGCTATGAGCCAGTGTCGG + Intronic
1003137881 6:3446866-3446888 GAGATGCCCTTAGCCAGCTGAGG - Intronic
1003381042 6:5624938-5624960 TCGATGTCCAGAGCCAGCATGGG + Intronic
1005301613 6:24476519-24476541 GCGATTCCGTGAGCCAGTTTAGG - Intronic
1007305671 6:40902332-40902354 GCCAAGCCCTGAGCCAGGCTTGG + Intergenic
1011707811 6:90020476-90020498 GTGATGCCCTGTGCCACCTTGGG + Intronic
1018429647 6:163713216-163713238 GGGAAGCCCTGAGCCAGAGCTGG - Intergenic
1018846091 6:167557426-167557448 GCGATGCCCTGTGCCACCTCAGG + Intergenic
1018914978 6:168127606-168127628 GTGTAGCCCAGAGCCAGCGTTGG - Intergenic
1019379298 7:712669-712691 GCGATGGCCTGAACCTGCGCCGG - Intronic
1019502431 7:1370966-1370988 GAGATGCCCAGAGACAACGTAGG - Intergenic
1021557933 7:21940595-21940617 GCGAGCACCTGAGCCAGCGGTGG + Intronic
1022510878 7:30934125-30934147 CTGCTGCCCTGAGCTAGCGTTGG + Intergenic
1029425412 7:100491079-100491101 GGGATGCCCTGAGCCAGGTGAGG + Exonic
1036772596 8:11589425-11589447 GCGCTGCTCTGAGCCAGTGCGGG - Intergenic
1037575855 8:20201884-20201906 GTGATGCCCTGAACCACCCTGGG - Intronic
1044163873 8:88955782-88955804 CTGATGCCCTGAGCCACCTTGGG + Intergenic
1045888345 8:107125974-107125996 GCAATGCCCACAGCCAGCATTGG + Intergenic
1048328299 8:133455180-133455202 GCGAGGCCCTGAGACAGGCTAGG + Exonic
1049528882 8:143143365-143143387 GCGGTGCCCAGAGCCAGAGAAGG + Intergenic
1051245693 9:15108739-15108761 GTGATGCCCTGTGCCATCTTGGG + Intergenic
1053792257 9:41695103-41695125 GCCATGCTCAGAGGCAGCGTAGG + Intergenic
1054152903 9:61619660-61619682 GCCATGCTCAGAGGCAGCGTAGG - Intergenic
1054180668 9:61907123-61907145 GCCATGCTCAGAGGCAGCGTAGG + Intergenic
1054656923 9:67674019-67674041 GCCATGCTCAGAGGCAGCGTAGG - Intergenic
1057442013 9:95090060-95090082 GCTATGCCCTGAGGCTGCGTGGG + Intergenic
1058713186 9:107698679-107698701 GCTATGCCCTCAGCCAGCCAAGG - Intergenic
1186368172 X:8917891-8917913 GCAATGCCCTGTGCCAGCTCAGG + Intergenic
1187216183 X:17279143-17279165 GTGATGCCCAGAGCCAGTTTTGG + Intergenic
1191733511 X:64364144-64364166 GCTATGCCCTGCCCCAGAGTTGG - Intronic
1192319349 X:70077060-70077082 GGGATGCCCTGGGCCAGCTTGGG + Intergenic