ID: 1092275610

View in Genome Browser
Species Human (GRCh38)
Location 12:7058802-7058824
Sequence GTCCTGTGACCCCCACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 3, 1: 19, 2: 42, 3: 91, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092275610 Original CRISPR GTCCTGTGACCCCCACCCAG AGG Intronic
900294675 1:1942956-1942978 GACCTCTGACCACTACCCAGAGG + Intronic
900340150 1:2184706-2184728 CTCCAGGGACCCGCACCCAGTGG - Intronic
900424597 1:2570392-2570414 GTCCTGTGACAGCCGCCCAGGGG - Intergenic
900592914 1:3467850-3467872 GGCATGTGACCCGCACCCTGAGG + Intronic
902121027 1:14165870-14165892 GTCCTGTGACTGCCACACAAGGG + Intergenic
902402670 1:16166637-16166659 CTGCTGTGCCCCCCACCAAGAGG - Intergenic
903632947 1:24790688-24790710 CTCCTCTGACCCCATCCCAGGGG + Intronic
903708926 1:25307306-25307328 GTCCTGTGGCCCCTAGACAGTGG + Intronic
903718193 1:25385112-25385134 GTCCTGTGGCCCCTAGACAGTGG - Intronic
906321502 1:44820301-44820323 CTCCTGGGACCCGCACCCCGTGG + Intronic
906700427 1:47853434-47853456 GTTCAGTGACCACCACCCTGTGG - Intronic
908667166 1:66506300-66506322 GTCCTGTGTTTCCCACCCAGAGG + Intergenic
909659817 1:78069329-78069351 GTCCTGTCAGGCCCACCCATAGG + Intronic
910136602 1:83979319-83979341 GTCCTGTGGCCTCCACCCGGAGG - Intronic
910388027 1:86705276-86705298 CTCCTGTGGCCTCCACCCCGGGG + Intronic
912179895 1:107207213-107207235 GAGCTGTGACCTCCACCCTGAGG + Intronic
912415262 1:109504130-109504152 GTACAGTGAACCCCACCCACAGG + Intergenic
912694020 1:111827355-111827377 GTCCTGTGACCCCCAGCACTTGG + Intronic
913066274 1:115258471-115258493 CTCCCATGGCCCCCACCCAGAGG + Intergenic
915064356 1:153212401-153212423 CTCCTGTGTCACCCACACAGGGG - Intergenic
915081458 1:153355499-153355521 GTCCAGTGTCCCCAACCCTGAGG + Intergenic
916450824 1:164918717-164918739 GTGGTGAGACCCCCAACCAGTGG - Intergenic
917880438 1:179330267-179330289 GTCCTGTGACCCCCACCCAGAGG - Intronic
919540850 1:198843447-198843469 GTCCTGTGGCCCCCACCCAGAGG - Intergenic
920628299 1:207625753-207625775 GTCCTGTGGCCCCCAACCAGAGG - Intronic
920638437 1:207727942-207727964 GTCCTGTGGCCCCCAACCAGAGG - Intronic
922107061 1:222521736-222521758 GTCCTGTGGCCCCGATCCAGAGG + Intergenic
922350200 1:224729024-224729046 GTTTTCTGACCCCCTCCCAGGGG - Intronic
923250826 1:232178381-232178403 GTTCTGTGGCCCCCATCCAGAGG + Intergenic
923876451 1:238054320-238054342 GTCCTGTGGCCCCCACTTAGAGG + Intergenic
923908181 1:238409318-238409340 TTCCTGTGGCTCCCACCCGGAGG + Intergenic
924105458 1:240644839-240644861 GTCCTGTGGCCCCTATCCAGAGG - Intergenic
924666875 1:246082431-246082453 GTCCCATGGCCCCCGCCCAGAGG + Intronic
924695749 1:246397878-246397900 GTCTTGTGCCCCCACCCCAGAGG - Intronic
1065725061 10:28661226-28661248 GTCCTGTGGCCATCAACCAGAGG - Intergenic
1067103494 10:43350041-43350063 CTCATCTGGCCCCCACCCAGTGG + Intergenic
1067706189 10:48608020-48608042 TTCCTGTGTCCCACCCCCAGTGG + Intronic
1067937268 10:50623283-50623305 GTCCGGAGACCCCCACCCAGGGG - Intronic
1068771457 10:60826199-60826221 GCCCTGTGGCTCCCACCCAGAGG + Intergenic
1069727361 10:70589334-70589356 CTCCTGTGGTCCCCACCCAGAGG - Intergenic
1069935025 10:71909421-71909443 GTCCTGTGGCCCCCACCCAGAGG - Intergenic
1070510524 10:77156823-77156845 GTCCTGTGGTCCCCACCCAGAGG + Intronic
1070858373 10:79628260-79628282 GTCATCAGACCCCCATCCAGCGG - Intergenic
1071082282 10:81826620-81826642 GTCCTGTGGCCCCCACGCAGAGG + Intergenic
1071430626 10:85603646-85603668 GTCCTGTGCCCACCTCACAGCGG - Intronic
1071880136 10:89888517-89888539 GTCCTGTGACCCCCTTCCAGAGG + Intergenic
1073748513 10:106497363-106497385 GTCTTGTGGCCTCCATCCAGAGG + Intergenic
1074701810 10:116098958-116098980 GCCCTATGACCCACAGCCAGTGG + Intronic
1076105769 10:127822634-127822656 GTCCTGTGGACCCTACCCAGAGG + Intergenic
1076312970 10:129521364-129521386 GGCCAGTGACTCCCACCAAGAGG - Intronic
1076343728 10:129766679-129766701 GTCCTGTGCCCACCAAGCAGGGG - Intronic
1076406494 10:130215535-130215557 GTCCTGTGACCCCAGCCCACGGG - Intergenic
1076798972 10:132811958-132811980 CTCCTGTCAACCCCACACAGTGG + Intronic
1076872830 10:133202019-133202041 GTCCTGGTGCCCCCACCCCGTGG + Intronic
1077193952 11:1270007-1270029 GTCCTGTGGTCCCCACTGAGAGG + Intergenic
1080416028 11:32070620-32070642 GTGGTGTGACCAGCACCCAGAGG - Intronic
1081151967 11:39644111-39644133 ATCCTGTGCCCCTCACCCAGAGG + Intergenic
1081321738 11:41699970-41699992 GTCCTGTGGCCCCCACCCATAGG - Intergenic
1081774962 11:45670603-45670625 GTCCTGAGACACCCAGCCACAGG + Intergenic
1082036040 11:47646046-47646068 GTCCTGTGGCCTCCATCCAGAGG - Intergenic
1083084374 11:60127378-60127400 ATCCTGTGGTCCCCACCCAGAGG - Intergenic
1083756323 11:64793570-64793592 GCCCTGCCACCTCCACCCAGTGG + Intronic
1086312815 11:85554888-85554910 GTCCCATGGCCCCCACCCAGAGG + Intronic
1086350380 11:85937876-85937898 CTCTTGTGGCCCCCACCCAGAGG - Intergenic
1086407586 11:86511907-86511929 GTCCTGTGGCCCCTACCTGGAGG + Intronic
1086845909 11:91749393-91749415 ATTCTGTGGCCTCCACCCAGAGG + Intergenic
1086893782 11:92289038-92289060 GTCCTCTGACCCCCAGCCAATGG - Intergenic
1087902096 11:103652223-103652245 GTCCTGTGGCCCATACTCAGAGG + Intergenic
1088101608 11:106161997-106162019 GTCCTGTGGCCCCCACCCAGAGG - Intergenic
1088800658 11:113303894-113303916 GTCCAGGGACCCCCTCCCAAGGG - Intergenic
1089178225 11:116563430-116563452 GGGCTCTGACCCCCACCCTGGGG + Intergenic
1090440015 11:126717609-126717631 GGCCAGTCACCCCCACCTAGTGG + Intronic
1092270861 12:7022215-7022237 GTCCTATGGACCCCACCCAGAGG + Intronic
1092275610 12:7058802-7058824 GTCCTGTGACCCCCACCCAGAGG + Intronic
1095454013 12:42363360-42363382 GCCCTGTAACACCCACCCAGTGG - Intronic
1095626585 12:44321583-44321605 ATCTGGTGACTCCCACCCAGAGG + Intronic
1096520426 12:52181727-52181749 GTCCTGTCCTCCCCACCCAACGG - Intronic
1097540497 12:60936556-60936578 CTCCTGTGACCTTGACCCAGTGG + Intergenic
1098289559 12:68944924-68944946 GTCCTGTGGCCCCCACCCAGAGG - Intronic
1098291919 12:68964681-68964703 GTCCCATGGCCCCCACCCAGAGG + Intronic
1100033091 12:90217074-90217096 GTCCTGTGGCCCCCACTCAGAGG + Intergenic
1100284202 12:93149392-93149414 GTCCTGTGGCCCTCACGCAGAGG - Intergenic
1100773375 12:97948503-97948525 GTCCTGTGGCCCCCACCCAGAGG - Intergenic
1100856734 12:98764046-98764068 GCCCTGTCACACCCATCCAGAGG + Intronic
1102487746 12:113269581-113269603 GGCTTGAGACCCCCACTCAGCGG - Intronic
1102571518 12:113829831-113829853 GTCCTGTGAGGCCACCCCAGAGG + Intronic
1103541555 12:121669682-121669704 CTCCTGGGGCCCCCTCCCAGGGG + Intronic
1104786875 12:131455729-131455751 GTCCTGTGCCCCCACCCCATGGG - Intergenic
1104944180 12:132408301-132408323 GTGCTGGGACCCCCACACAGGGG - Intergenic
1104987243 12:132603970-132603992 GTCCTGGGTCCCCCTCCCCGCGG + Intronic
1105021838 12:132821958-132821980 CTCCTGTGACCAGCACACAGAGG + Intronic
1106636385 13:31533246-31533268 GTCCTGTGGCCCCCACCCAGAGG + Intergenic
1107426292 13:40296332-40296354 GTCCTGCGGCCCCCACCCAGAGG - Intergenic
1108315787 13:49235880-49235902 GTCCTGTGGCGCACACCCAGAGG - Intergenic
1110380803 13:74848383-74848405 GTTCTGTGGCCCCAACCCAGAGG + Intergenic
1111126413 13:83914530-83914552 GTCCTGTGGCCCCCACCCAGAGG + Intergenic
1112674636 13:101685967-101685989 CTCCAATGACCCCAACCCAGTGG - Intronic
1113956455 13:114102115-114102137 GTCCTGTGACTCACAACCAAAGG - Intronic
1115820799 14:37210667-37210689 GTCCTGTGGCCCCCACTGAGAGG - Intronic
1117077729 14:52121632-52121654 GTCCTGTGGCCCCCATCCAGAGG + Intergenic
1119174710 14:72560529-72560551 GTTCTGTGGCACACACCCAGCGG - Intronic
1120259078 14:82159780-82159802 GTTTGGTAACCCCCACCCAGAGG + Intergenic
1121583393 14:95046883-95046905 GGCCTGTGTCCCCCACCGACAGG + Intergenic
1121816721 14:96934345-96934367 GTCCTGTGAGCCTCACTCACTGG + Intergenic
1122799495 14:104222579-104222601 GTCCTGCCAGCCCCACCAAGAGG - Intergenic
1123056904 14:105575041-105575063 GTCCTGTGGGTCCCACCTAGGGG + Intergenic
1123081306 14:105696744-105696766 GTCCTGTGGGTCCCACCTAGGGG - Intergenic
1123703248 15:22931453-22931475 GTCTTCTGACAGCCACCCAGAGG + Intronic
1123989870 15:25675484-25675506 GCCCTGAGATCCCCACCCAGAGG - Intergenic
1125516276 15:40323160-40323182 GGCCTGGGAGACCCACCCAGGGG + Intergenic
1127042013 15:54987674-54987696 GTCCTGTGGCCCCTACCCAGAGG - Intergenic
1127233262 15:57019610-57019632 GTCCTGTGGCCTCCACCCAGAGG - Intronic
1127388910 15:58489536-58489558 GTCTTGGGGCCCCCACCCAGAGG - Intronic
1127844672 15:62858708-62858730 GTCCTGTCAGCCCCACTCAGAGG - Intergenic
1128479296 15:68023414-68023436 GTCCTGCGGCCCCCACCCAGAGG - Intergenic
1129255092 15:74329931-74329953 GTCCTGTGATACCAACTCAGGGG - Intronic
1129723853 15:77891792-77891814 GACCTGGGACCCTCACTCAGTGG - Intergenic
1129752872 15:78077838-78077860 GTCCTGCGACCAGCACCCCGCGG + Intronic
1129779234 15:78259110-78259132 ATCCTGTCTCCCCCACACAGAGG - Intergenic
1131177933 15:90221486-90221508 GTCCTCTTGCCACCACCCAGAGG + Intronic
1131341693 15:91608565-91608587 GCCCTGTGGCTCCCACCCTGGGG - Intergenic
1132028173 15:98420280-98420302 TTCCTGAGGCCCCCACCCAGAGG + Intergenic
1132602585 16:780229-780251 GACCTGTGACCCCCACCATGGGG + Intronic
1132988536 16:2780698-2780720 GTCCTGTGAGCCCCCACCTGTGG + Intergenic
1133302067 16:4788401-4788423 TTGCTGTGACCCCCACCTGGAGG + Exonic
1133945189 16:10342048-10342070 GTCCTGTGGCCCTCAGCCAGAGG + Intronic
1134593582 16:15476794-15476816 ATCCTGTATCCCCCACCCAGTGG - Intronic
1135356339 16:21772162-21772184 GTCCTGTGGCCCCTACCCAGAGG - Intergenic
1135454830 16:22588306-22588328 GTCCTGTGGCCCCTACCCAGAGG - Intergenic
1135602514 16:23795559-23795581 GTCCCGTGACCTCCACCCAGAGG + Intergenic
1137723992 16:50644936-50644958 GTGGTGTGACCACCCCCCAGTGG + Intergenic
1137814561 16:51386194-51386216 GTCTTGTGGTCCCCAACCAGAGG + Intergenic
1138353888 16:56362531-56362553 GTCCTGAGCACCACACCCAGTGG - Exonic
1138386406 16:56638464-56638486 GTCCCGTGGTCCGCACCCAGGGG + Intergenic
1138600280 16:58049921-58049943 GACCTGTGACCCCATCCCACAGG - Intergenic
1139105559 16:63823028-63823050 GTCCTAGGGCCCCCACCCAGAGG + Intergenic
1139106348 16:63831276-63831298 GTCCTATGACCTTCACCCTGAGG + Intergenic
1140134107 16:72189931-72189953 GTCCCATGACACTCACCCAGAGG - Intergenic
1141161888 16:81634771-81634793 CGCCGGTGACTCCCACCCAGAGG + Intronic
1141173099 16:81703673-81703695 GTGCTGTGACTCACACCCTGAGG - Intronic
1141766939 16:86064910-86064932 GTCCTGTGGGCCCCACGCTGAGG + Intergenic
1142320198 16:89377196-89377218 GTCCTATGACCCCGATCTAGAGG - Intronic
1142468092 17:147341-147363 GGCCTGTGGCCCCCACACTGGGG - Exonic
1142668829 17:1478008-1478030 GTCCTGGCACCCTCTCCCAGGGG + Intronic
1142852603 17:2711515-2711537 GTCCGGCGCCCCCCGCCCAGCGG + Intronic
1143088351 17:4433731-4433753 CTCCTGGCACCCCCACCCTGGGG - Exonic
1144238656 17:13287728-13287750 GTCCTGTGATTCCCACACAGAGG - Intergenic
1144256778 17:13476199-13476221 GTTCTGTGGTCCCCACCCAGAGG + Intergenic
1146262574 17:31431680-31431702 GTCCTCTTACCCTCACCCTGGGG - Intronic
1146359386 17:32161282-32161304 ATCCTGTGGCCCCCAATCAGCGG - Intronic
1146534444 17:33637993-33638015 GTCCTGTGGCCCCCACCCAGAGG - Intronic
1146596362 17:34172559-34172581 GTCCTGTGGCCCCCACCCAGAGG - Intronic
1147439131 17:40436722-40436744 GTCCTGTTTCCCCAACCCTGAGG - Intergenic
1147925289 17:43942007-43942029 ATTCTGTGTCCCCCACCCTGTGG - Intronic
1148896362 17:50841378-50841400 TTCCTGTGACCAGCACACAGCGG - Exonic
1151000560 17:70370506-70370528 GTCCTGTGGTTCCCACCCAGAGG - Intergenic
1151147368 17:72053612-72053634 GTCCTCCGCCCCCCACCCCGTGG + Intergenic
1151834173 17:76572556-76572578 GCCCTGTGGCCCCCACTGAGGGG + Intronic
1152780899 17:82227082-82227104 GTCCTGGGGCCCACACCCAGGGG + Intergenic
1152894175 17:82901253-82901275 GTGCTGTGACCGCCGCCCTGAGG + Intronic
1155921079 18:31603536-31603558 GTCCTGTGGCCCTCACCCAGAGG + Intergenic
1155925922 18:31655133-31655155 GTCCTGTGACCTCCGCAAAGTGG - Intronic
1156866608 18:41895688-41895710 TTCCTGTGGCCCCTACCCAGAGG + Intergenic
1157637098 18:49169378-49169400 GTGCTGTTTCCCCCACCCACAGG - Intronic
1157935309 18:51865442-51865464 TTCCTGTGACATCCACACAGTGG + Intergenic
1161077776 19:2294635-2294657 GTCATCTGCCCCCCACCCAGAGG - Intronic
1161494587 19:4580493-4580515 GGCACGTGACCCCCACCCCGGGG + Intergenic
1162786110 19:13036081-13036103 GCCCTGAGATCCCCACCAAGGGG + Intronic
1163654190 19:18536239-18536261 GTCCTGAAAGCCCCACCTAGGGG + Intronic
1163767917 19:19173549-19173571 GTTCTGTGTCCCCCAGCCTGGGG + Intronic
1163799719 19:19357041-19357063 GTCTTGTCACCCTCACTCAGTGG + Exonic
1164088534 19:21927297-21927319 GTCCTGAATCTCCCACCCAGAGG + Intergenic
1164518828 19:28961164-28961186 GTCCTATGGCCCCTACCCAGAGG + Intergenic
1164923805 19:32110066-32110088 CTTCTGTGACCCACAACCAGAGG - Intergenic
1165192408 19:34076164-34076186 GTCCTGTGGTCCCCATTCAGAGG + Intergenic
1165368778 19:35388896-35388918 GTCCTGTGGATCCCACCCAGAGG + Intergenic
1165368865 19:35389570-35389592 GTTCTGTGGTTCCCACCCAGAGG - Intergenic
1165857319 19:38887524-38887546 GTCCTGTGATCCCCACACTTTGG - Intronic
1166075887 19:40413525-40413547 GTCCCGTGGCCCCCACCCCTTGG - Intergenic
1166282228 19:41801710-41801732 GTCTTGTGGCCCCCACTCAGAGG - Intronic
1166315316 19:41986035-41986057 GCCCAGTGACCCCCAGGCAGAGG - Intronic
1166346597 19:42170141-42170163 GTTGTGTGACCCCCCTCCAGAGG + Intronic
1166423763 19:42657763-42657785 GTCATGTGGCCTCCACTCAGAGG - Intronic
1166438370 19:42788941-42788963 GTCATGTGGCCCCCACTCAGAGG + Intronic
1166452423 19:42913784-42913806 GTCATGTGGCCCCTACCTAGAGG + Intronic
1166473397 19:43099677-43099699 GTCATGTGGCCCCCACTCAGAGG + Intronic
1166487341 19:43224791-43224813 GTCATGTGGCCCCCACTCAGAGG + Intronic
1166495574 19:43300880-43300902 GTCATGTGGCCCCCAGTCAGAGG + Intergenic
1167142964 19:47664907-47664929 GTCCGCTGCCCCCCACCCAGTGG - Intronic
1167731419 19:51259530-51259552 GGCCAGTGAGCACCACCCAGTGG + Intronic
1168116059 19:54221913-54221935 GCCCCGTGACCCCCAGCCACAGG - Exonic
1168118858 19:54240913-54240935 GCCCTGTGAGCCCCTCCCACGGG - Exonic
1168129887 19:54311499-54311521 GCCCTGTGACCCCCAGCCACAGG - Exonic
1168169295 19:54575448-54575470 GCCCTGTGAGCCCCTCCCACGGG + Exonic
1168185503 19:54697407-54697429 GCCCCGTGACCCCCAGCCACAGG + Intronic
1168225692 19:54993334-54993356 GTCCTGTGTCCCTCAGCTAGTGG + Intronic
925055808 2:856516-856538 GCCCTGTGCCCCTCACCCTGGGG + Intergenic
929125436 2:38519219-38519241 GTCCTGGGACCCCCAGCCTCAGG + Intergenic
929171927 2:38940907-38940929 GTCCTGTGGCCCTCACCCAGAGG - Intronic
930111402 2:47681863-47681885 GTCCTGTGGCCCCCACCCAGAGG - Intergenic
930164384 2:48189942-48189964 GTGCTGTGGCCCTCACCCAGAGG - Intergenic
930983061 2:57551277-57551299 GTCCTGTGGCCCCCACCCAGAGG + Intergenic
933812955 2:86044469-86044491 CTCCAGTGTCCCCCAGCCAGGGG + Intronic
934844963 2:97656722-97656744 CTGCTGTGCCACCCACCCAGGGG + Exonic
934871573 2:97871598-97871620 GTCCTGTGGCCCCCACCCAAAGG + Intronic
935156182 2:100485517-100485539 GTCTTGTGTCCCCCACCCAGAGG - Intergenic
935802417 2:106712044-106712066 GTCCTGTGGCTCCAGCCCAGAGG - Intergenic
936045838 2:109187118-109187140 GTCCTGTGTCCCTCACCCTGTGG - Intronic
937295668 2:120808397-120808419 CTCCTGTGACCTCTCCCCAGTGG + Intronic
939042613 2:137208748-137208770 GTTCTGTGTCCTCTACCCAGGGG - Intronic
939131864 2:138244554-138244576 GTCCTGTGGGCCCCACCCAGAGG - Intergenic
941991128 2:171558726-171558748 GTCCTGTGGCCCTCCTCCAGAGG - Intergenic
942145082 2:173018883-173018905 GTCATGTGAGGCTCACCCAGAGG + Intronic
943443101 2:187950038-187950060 GTCCTGTGGCCCGCACCTGGAGG - Intergenic
943686357 2:190822772-190822794 CTCCTGTGACTCCCATTCAGAGG + Intergenic
946095122 2:217267932-217267954 GTCCTATGGCCTCCACCCAGAGG + Intergenic
946707433 2:222472379-222472401 GTCCTGTTGCCCCCACTCAGAGG - Intronic
947137245 2:226987611-226987633 GACCTCTGACTCCCACACAGAGG - Intronic
948389680 2:237602983-237603005 GGACTGAGCCCCCCACCCAGTGG + Intergenic
1170391666 20:15881439-15881461 GTCCTGTGGCCCGTATCCAGAGG - Intronic
1170774977 20:19367262-19367284 CTCCTGTGACCACTATCCAGAGG - Intronic
1171382684 20:24745510-24745532 GTCCTGTGTATCCCACCCACAGG - Intergenic
1173202306 20:40962950-40962972 GTCCAGTTGCCCCAACCCAGAGG + Intergenic
1173915628 20:46706662-46706684 GTCCTGTGGCTCCCATCTAGAGG - Intergenic
1174093305 20:48067150-48067172 CACATGTGACCCCCACCCAGGGG - Intergenic
1174444609 20:50582237-50582259 GACCTCTGACCCCCAGGCAGAGG - Intronic
1174840451 20:53896381-53896403 ATCCTGTATCCCCGACCCAGGGG + Intergenic
1175070723 20:56331693-56331715 GTCCTGTGGTCCCTACCTAGAGG + Intergenic
1175525483 20:59630726-59630748 GTGAAGGGACCCCCACCCAGTGG - Intronic
1175903908 20:62370656-62370678 GTTCTGTGTCCTCCTCCCAGAGG - Intergenic
1176177859 20:63737183-63737205 GGCCTGTGGCGCACACCCAGGGG + Intronic
1176181583 20:63752057-63752079 GTCCTGGAACGCCCACCCCGAGG - Intronic
1179494625 21:41763960-41763982 GCCCTGTGACCCCCACAATGAGG + Intronic
1180155150 21:45974012-45974034 GTCCTGCGGCCCCCAGACAGCGG - Intergenic
1180564839 22:16654276-16654298 GTCCTGTGCCCCCCACCTCCTGG + Intergenic
1180793822 22:18592207-18592229 CTGCTGTTCCCCCCACCCAGTGG + Intergenic
1180833981 22:18920647-18920669 GTCCTGGGCCCCCCTCCCACAGG + Intronic
1181052740 22:20245504-20245526 GTCCTCTGACCCCATCCCAGGGG + Intronic
1181065839 22:20305592-20305614 GTCCTGGGCCCCCCTCCCACAGG - Intergenic
1181227918 22:21403113-21403135 CTGCTGTTCCCCCCACCCAGTGG - Intergenic
1181250735 22:21531726-21531748 CTGCTGTTCCCCCCACCCAGTGG + Intergenic
1181560586 22:23697372-23697394 GGCCTGACACCCCCACCCACAGG - Intronic
1182087211 22:27569414-27569436 GTCCTGTGATCCCCAGCCCCAGG + Intergenic
1182304069 22:29355970-29355992 GTCAGGTGAGCCCCAGCCAGGGG + Intronic
1183228068 22:36563694-36563716 TTCCTGGGGCACCCACCCAGGGG + Intergenic
1183523753 22:38311564-38311586 GCCCTTTGACCTCCAGCCAGTGG + Intronic
1183716654 22:39537144-39537166 CACCTTTGACCCCCACCCGGGGG - Intergenic
1184565441 22:45289004-45289026 TTCCTGTGAGCCCCACCCACAGG - Intronic
1184848142 22:47101703-47101725 GTCCTGTGACCCCTTCACATTGG - Intronic
1185215921 22:49599994-49600016 GTCCACTCACCCCCGCCCAGTGG + Intronic
1203284067 22_KI270734v1_random:145945-145967 GTCCTGGGCCCCCCTCCCACAGG + Intergenic
950028210 3:9834917-9834939 GACCTGTGACTCACACCCAGTGG + Exonic
950626495 3:14251256-14251278 GTTCTGTGGCCCCCACCCAGAGG - Intergenic
952160822 3:30691452-30691474 GTGCTGGGACCACGACCCAGAGG + Exonic
952253296 3:31674670-31674692 GCCATGTGACCCCCACACAGGGG + Intronic
952619626 3:35322163-35322185 GTCCTGTGGCCCCCATCCATAGG - Intergenic
952851579 3:37734029-37734051 GTCCTATAACCCCTACCCAGGGG - Intronic
952851817 3:37735657-37735679 GTCCTGTGACCCCTACCCAAGGG + Intronic
954493523 3:50930681-50930703 GGCCTGTGATCCACTCCCAGAGG - Intronic
954823748 3:53353164-53353186 GTCCTGTGGCCCCCACTCAGAGG - Intergenic
955385294 3:58474518-58474540 GTCCTGTGTCCCCCTCCCCTGGG - Intergenic
955864985 3:63372577-63372599 GTGCTGTGGGCCCAACCCAGGGG - Intronic
956135656 3:66096023-66096045 GTCCTGTGGTCCCCACCCAGAGG - Intergenic
956369039 3:68538081-68538103 GTCCTGTGGCCCCCACCTGGAGG - Intronic
956458153 3:69444037-69444059 GACCTGTGGCCCCCACCCAGAGG + Intronic
956869315 3:73401136-73401158 GTGCTGAGAGCCCCATCCAGAGG - Intronic
961489544 3:127244929-127244951 GTCCTCTGGTCCCCACCCACTGG - Intergenic
963971197 3:151431049-151431071 GTCCTATGACACCCGCCCAGGGG - Intronic
965078255 3:164004447-164004469 GGCCTGGGCCCGCCACCCAGTGG + Intergenic
965200642 3:165653750-165653772 GTTCTGTGTCCCTCACTCAGAGG + Intergenic
968046270 3:195625331-195625353 GTGCAGACACCCCCACCCAGAGG + Intergenic
968126940 3:196166922-196166944 GTCCTGTGGCCCCCACACAGAGG - Intergenic
968308382 3:197664760-197664782 GTGCAGACACCCCCACCCAGAGG - Intergenic
968454429 4:689692-689714 GGCCTGTGGGCCCCACCCTGGGG + Intergenic
968653445 4:1768936-1768958 GTCCCCTGCCCCCCACCCACAGG + Intergenic
968807991 4:2787580-2787602 GTCCTGGGTCCTCCACCCACAGG + Intergenic
970234015 4:13940253-13940275 GTCCTGGGAACCCCACCTTGAGG - Intergenic
973348366 4:49081675-49081697 ATCCAGTGACCCCCAACCTGGGG + Intergenic
973942927 4:55928373-55928395 GTCTTGTGGCCCCCACTCAGAGG + Intergenic
975313035 4:72924928-72924950 CTCCTGTGACCACCACCCCTAGG + Intergenic
975410880 4:74047975-74047997 GTAATGTAAGCCCCACCCAGGGG - Intergenic
975581575 4:75911583-75911605 GTCCTGTGGCCCTCACCCAAAGG - Intergenic
976124237 4:81816426-81816448 GTCTTGTGACTCCCACCCCTAGG - Intronic
976260392 4:83139747-83139769 GTACTGTGGCCTCCACCCAAAGG - Intergenic
976322088 4:83727596-83727618 GTCCTGTGGCCCCCTCCCAGAGG - Intergenic
977572230 4:98640683-98640705 TTCCTTTGTCCCCCACCCATTGG - Intronic
977679896 4:99786905-99786927 GTCCTGTGGCCCCTACCCAGAGG + Intergenic
979458577 4:120953782-120953804 GTCCTGTGGCCCCCACCCAGAGG + Intergenic
980829151 4:138108715-138108737 GTCATGTGGCTCCCACCCAGAGG + Intergenic
981536918 4:145809728-145809750 GTCCTGTGGCCCCCATCCAGAGG + Intronic
984059816 4:174977915-174977937 CTCCTGTGACACCCTCCCAGAGG + Exonic
985100370 4:186452382-186452404 GTCCTGTGACCCCCACCTGGAGG - Intronic
985588223 5:751609-751631 GACCTGTCACCTCCACCCTGCGG - Intronic
985602893 5:844068-844090 GACCTGTCACCTCCACCCTGCGG - Intronic
985747039 5:1653544-1653566 GTGCAGACACCCCCACCCAGAGG - Intergenic
985778322 5:1856938-1856960 GCTCAGGGACCCCCACCCAGAGG + Intergenic
986198802 5:5562193-5562215 GTCCTGTCATTCCTACCCAGTGG + Intergenic
986992465 5:13570070-13570092 GTGCTGTGAGCCCTACCCACTGG - Intergenic
987456565 5:18154509-18154531 GTCCAGTGGCCCCTACCCAGAGG - Intergenic
988680175 5:33477184-33477206 GTCCTGTGGCCCTCACCCAAAGG + Intergenic
988684927 5:33516916-33516938 GTCCTGTGGCCCCCACCCAGAGG + Intergenic
988875332 5:35438988-35439010 GTCCTGTGGCCTCTACTCAGAGG - Intergenic
989618349 5:43359859-43359881 GTCCCATGGCCCCCACCTAGAGG + Intergenic
992042504 5:72848892-72848914 GGCCTGCCACCCCCACCCACGGG - Intronic
993039038 5:82791184-82791206 GTCCTGTGGCCCCCACTGAGAGG + Intergenic
993352605 5:86868461-86868483 GTCCTGCGGCCCCCATCCAGAGG - Intergenic
994214587 5:97123370-97123392 CTCCTGTGTTTCCCACCCAGTGG + Intronic
996787393 5:127255119-127255141 GTCCTGCAGCCCCCACCCAGAGG - Intergenic
997828586 5:137129598-137129620 GTCCTGTGGCCCCTACCCAGAGG - Intronic
998628370 5:143871424-143871446 ACCCTGTGGCCCCCACCCAGAGG + Intergenic
1000608938 5:163354468-163354490 GTCTTGTGACTCCCACCCAGAGG - Intergenic
1001284128 5:170410152-170410174 CTCCTGAGTCCCCCACTCAGGGG + Intronic
1001284141 5:170410196-170410218 CTCCTGGGTCCCCCACTCAGGGG + Intronic
1002080844 5:176736522-176736544 GTCCTCCCACCCCCACCCATGGG - Intergenic
1004604723 6:17183314-17183336 GTCCCGTGGCCCCCATCTAGAGG + Intergenic
1007210063 6:40186267-40186289 GTCCTGTGGCCCCTACCCAGGGG - Intergenic
1008221904 6:48864321-48864343 GTCCTGTGGCCCTCACCCAGAGG - Intergenic
1008487422 6:52051232-52051254 GTCCTGTTATCCCCACCTATGGG - Intronic
1010201289 6:73284400-73284422 GTCCTGTGGTCCCCACCCAGAGG + Intronic
1011798311 6:90982226-90982248 GCCCTGTGTGCACCACCCAGTGG + Intergenic
1012248385 6:96952889-96952911 GGCCTATGGCCCCCACCCAGAGG + Intronic
1012803935 6:103870735-103870757 GTCCTCTAACAGCCACCCAGAGG - Intergenic
1013085358 6:106852277-106852299 GTTCTGTGGCCCTCACCCAGAGG + Intergenic
1013512966 6:110860228-110860250 GCACAGGGACCCCCACCCAGGGG + Intronic
1013769649 6:113613564-113613586 GTTCTGTGGCCCCCACACAGAGG - Intergenic
1015173134 6:130276913-130276935 GTCCTGTGGCCCCCACCCTGAGG - Intronic
1015494334 6:133865095-133865117 GTGCTGTGAGCCCAAGCCAGGGG + Intergenic
1016894888 6:149041848-149041870 GTCCTGTGGCCCACTCCCCGAGG + Intronic
1017131562 6:151112468-151112490 GTACTGTCATCCCCACTCAGGGG - Intergenic
1019515819 7:1439852-1439874 GTCCCGGGGCCCCCACCCAAGGG + Intronic
1019646440 7:2131884-2131906 GTCCTGTGAGCCCCCCACAAGGG + Intronic
1019853663 7:3583769-3583791 GTCCTGTGAATGCCACCGAGAGG + Intronic
1020719409 7:11722506-11722528 GTCCTGTGGCCCCCACCCAGAGG + Intronic
1021421022 7:20444687-20444709 GTCCTGTGACCACCACCCAGAGG + Intergenic
1022491677 7:30825371-30825393 GTCATGGGACTTCCACCCAGAGG - Intronic
1023176838 7:37443835-37443857 GTCCTGGGAGCCACACCCTGTGG + Intronic
1023393866 7:39734386-39734408 GTCCTGTGACTCCCAGTCAGAGG + Intergenic
1023537854 7:41232329-41232351 ATCCTGTGGTCCCCACCCAGAGG + Intergenic
1024014909 7:45304893-45304915 CTCCTCTGACCCCCAGCCCGTGG - Intergenic
1024041517 7:45559723-45559745 GTCCTGTGACCCCCACCCAGAGG + Intergenic
1024064136 7:45718776-45718798 CTCCTGATGCCCCCACCCAGGGG - Exonic
1024720737 7:52135285-52135307 GTCCTGTGGCCCCCATCCAGAGG - Intergenic
1025215757 7:57054726-57054748 GTCCTGTGGTCCCCACCCAAAGG + Intergenic
1025626505 7:63227133-63227155 GTCCTGTGGTCCCCACCCAAAGG + Intergenic
1025655620 7:63515976-63515998 GTCCTGTGGTCCCCACCCAAAGG - Intergenic
1026190274 7:68119383-68119405 GTCCTGTGGTCCCCACCCAAAGG + Intergenic
1027735937 7:81932944-81932966 GTCCTGTGGCCCCTGCCGAGTGG - Intergenic
1028835206 7:95366987-95367009 GTTCTGTGAGCCTCACCCACTGG - Intronic
1029445947 7:100612838-100612860 GCCCCGGGACCCCCGCCCAGGGG - Exonic
1029547176 7:101216655-101216677 CTGCTGGGACCCCCTCCCAGGGG + Intronic
1033668036 7:143462093-143462115 GTCCTGTGGCCCCTATCCAGAGG - Intergenic
1034413707 7:150954371-150954393 GTCCTGACACCTCCGCCCAGAGG - Intronic
1034477098 7:151291604-151291626 ATCCCATGACCCCCACCCAGGGG + Intergenic
1034510357 7:151529210-151529232 GTCCTGTGAACCACTCCCAATGG + Intergenic
1034939729 7:155222707-155222729 GCCCTGGCCCCCCCACCCAGGGG - Intergenic
1035221107 7:157407031-157407053 GTCCTCGGACACCCGCCCAGGGG + Intronic
1035789381 8:2289844-2289866 GTCCTGTGGCCCCCACCCAGAGG + Intergenic
1035803424 8:2431861-2431883 GTCCTGTGGCCCCCACCCAGAGG - Intergenic
1036910871 8:12755676-12755698 GACCTGCGTCCCCCACCCGGAGG - Intronic
1038085759 8:24194654-24194676 GGCCTGTGACTGCCACCCAGCGG + Intergenic
1038160265 8:25030528-25030550 GTCCCATGGCCCCCACCCAGAGG - Intergenic
1039184928 8:34906190-34906212 GTCCTGTGGCCCCCACCCAGAGG - Intergenic
1039305306 8:36255527-36255549 GCCCTCTGGCCCTCACCCAGAGG + Intergenic
1040107042 8:43547148-43547170 GTCCTGTCCCCGTCACCCAGGGG + Intergenic
1040107829 8:43550232-43550254 GTCCTGTCCCCATCACCCAGGGG + Intergenic
1040110168 8:43563706-43563728 GTCCTGTCCCCATCACCCAGGGG + Intergenic
1040306088 8:46212558-46212580 GGTCTGTGAACACCACCCAGTGG - Intergenic
1043479970 8:80643050-80643072 GTCCTGTCCTCCCCACCCAGAGG - Exonic
1044822924 8:96169486-96169508 GTCATGTGTGCCTCACCCAGTGG - Intergenic
1045248771 8:100466007-100466029 GTCCTGTGACCCACAGGCTGAGG - Intergenic
1045647957 8:104317653-104317675 ATCCTGTGGCCCCCACTCAGAGG - Intergenic
1047691443 8:127358838-127358860 GTCCTGTGGCCCCCTCCTTGAGG + Intergenic
1047806905 8:128370680-128370702 ATCCTGCGACCCCCTCCTAGAGG + Intergenic
1048678196 8:136808800-136808822 TTCCTATGGCCCTCACCCAGTGG - Intergenic
1049221734 8:141431664-141431686 GTCCTTGCACCCCGACCCAGGGG + Exonic
1049328489 8:142037413-142037435 CTCCTGTGTCCCCCCCCCCGAGG - Intergenic
1049522879 8:143103355-143103377 GTCCTGTGGTCCTCACCCAGAGG - Intergenic
1050619408 9:7436954-7436976 GTCCTGTGGTCCCCACCCAGAGG - Intergenic
1051827317 9:21234422-21234444 GTCCTGTGGGCCCAAGCCAGGGG - Intronic
1052729121 9:32264658-32264680 GTACTGTGGCTCCCACCCAGAGG - Intergenic
1052832042 9:33223521-33223543 CTCCTGTGCTCCCCTCCCAGAGG - Intronic
1054764252 9:69029933-69029955 GTCCTGTGGCCCCCACCCTATGG - Intergenic
1054986812 9:71271165-71271187 CTCTTGTGACACCCACTCAGGGG + Intronic
1055037629 9:71835497-71835519 GTCCTGTGTCCCCCACCCAAAGG + Intergenic
1055581948 9:77715218-77715240 TTCCAAAGACCCCCACCCAGAGG - Intergenic
1056094930 9:83243093-83243115 GTTCGGTGGGCCCCACCCAGTGG - Intronic
1057629828 9:96710681-96710703 GTCCTGTGGCCCCCACCCAGAGG + Intergenic
1060528127 9:124331998-124332020 GACCTGTGACTGCCACCGAGGGG - Intronic
1061378369 9:130239533-130239555 GTCCTGGGGCCCCCACCCCCTGG - Intergenic
1062005666 9:134237381-134237403 TCCCTGTGAGCCCCACTCAGGGG - Intergenic
1186807413 X:13153982-13154004 ATCCCGTGGCCCCCACCCAGAGG + Intergenic
1186841581 X:13489639-13489661 GTCCTTTGGCCCCCACCCAGAGG + Intergenic
1187112806 X:16318785-16318807 GTTCTGTGGCCCCCACCTAGAGG + Intergenic
1191224643 X:58030739-58030761 GTGCTGTGAGCCCAAGCCAGGGG + Intergenic
1195140972 X:101959395-101959417 GTCCTGTGGCTCCCACCCAGAGG - Intergenic
1196402151 X:115328203-115328225 TTTCTGGGACCCACACCCAGAGG - Intergenic
1197347705 X:125344816-125344838 ATTCTGTGGCCCCCAACCAGAGG - Intergenic
1197663109 X:129194861-129194883 GCCCTATGGCCCCCTCCCAGAGG - Intergenic
1199608339 X:149593978-149594000 TTCATGTCACCTCCACCCAGAGG + Intronic
1199630781 X:149775382-149775404 TTCATGTCACCTCCACCCAGAGG - Intronic
1199683015 X:150240418-150240440 CTGCTGTGTCCCCCACCCTGGGG - Intergenic
1201734094 Y:17238604-17238626 GTCTTGTGGCCCTCACCCAGAGG + Intergenic
1202265608 Y:23014491-23014513 AGCCTGTGTCCCGCACCCAGAGG + Intergenic
1202418601 Y:24648233-24648255 AGCCTGTGTCCCGCACCCAGAGG + Intergenic