ID: 1092275684

View in Genome Browser
Species Human (GRCh38)
Location 12:7059333-7059355
Sequence CCCGTAAGGTCTCGGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092275684_1092275689 16 Left 1092275684 12:7059333-7059355 CCTGTCTTCCGAGACCTTACGGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1092275689 12:7059372-7059394 TTTTAACATGCACATTTATTAGG 0: 1
1: 0
2: 6
3: 51
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092275684 Original CRISPR CCCGTAAGGTCTCGGAAGAC AGG (reversed) Intronic
901716102 1:11155777-11155799 CCTGTAAGCTCTGGGAAGGCAGG + Intronic
909453020 1:75819531-75819553 GCTGTAAGGTCTGTGAAGACAGG + Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915915860 1:159940534-159940556 CTCTTAAGCTCTCGGAAGGCAGG + Intronic
1070668865 10:78364139-78364161 CCCGCAGGGTCTCTGAAGGCTGG - Intergenic
1070919817 10:80177472-80177494 CCCAGAAGGTCTCAGGAGACTGG - Intronic
1089684240 11:120137005-120137027 CCCCTAAGGTCTCAGGAGACAGG - Intronic
1092275684 12:7059333-7059355 CCCGTAAGGTCTCGGAAGACAGG - Intronic
1092888125 12:12943211-12943233 CCTGTAAGCTCTGTGAAGACAGG + Intronic
1097282468 12:57853166-57853188 CCCGGGAGGTCTCGGGAGAAGGG - Intergenic
1103346250 12:120252300-120252322 CCCGTAAGCTCTTTGAAGACAGG - Intronic
1110661061 13:78059835-78059857 CCCGTAACATCTAGGAAGGCTGG + Intergenic
1115417555 14:33153928-33153950 CCCGTAAGAACTGGGAAAACAGG - Intronic
1119424627 14:74527634-74527656 CCTGTAAGGCCTCGGGTGACAGG + Intronic
1120399401 14:84009594-84009616 CATGTAAGGTCTGGGAAGATGGG - Intergenic
1130596916 15:85255160-85255182 CACGGAAGGCCTCGGAAGCCGGG - Intergenic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1141364849 16:83433159-83433181 CCAGTAAGTTCCAGGAAGACGGG - Intronic
1142765059 17:2060001-2060023 CCCCTAGAGTCTCAGAAGACTGG - Exonic
1144650023 17:17001598-17001620 CACATAAGGTCTTGGGAGACAGG + Intergenic
1156354275 18:36328271-36328293 CCAGGAAGGACTCTGAAGACAGG + Intronic
1161907498 19:7167992-7168014 CCCAAGAGGTCTCGGAAGTCGGG + Exonic
1165935913 19:39388945-39388967 ACCTTAAAGTCTGGGAAGACAGG + Exonic
932550027 2:72759512-72759534 CCCAAAAGGTCTCACAAGACTGG - Intronic
935612334 2:105038225-105038247 CAGGTAAGGCCTGGGAAGACTGG + Exonic
942396258 2:175552812-175552834 CCCATACGGGCTGGGAAGACTGG - Intergenic
944136880 2:196409421-196409443 CCTGTAAGATCTCGGGAGTCAGG - Intronic
1183395764 22:37569852-37569874 CTCCTTAGGTATCGGAAGACCGG + Intergenic
952815760 3:37446356-37446378 CCCGTCAGGTCTCTGCAAACCGG + Intergenic
956113181 3:65891685-65891707 GCCCTAAGGTGTTGGAAGACTGG + Intronic
981928743 4:150167776-150167798 CCCATAAGATCTCGGAAGCTGGG + Intronic
991565672 5:68001760-68001782 ATCGTAAGGTCTCTGAAGGCAGG + Intergenic
992161785 5:74011456-74011478 CCCAGAAGGTCTCGGAATTCAGG + Intergenic
999144504 5:149383446-149383468 CCAGTAAGGTCAGGGAAGGCGGG + Intronic
1005621394 6:27623823-27623845 CCAGTAAGGTCTCGGGAGCTGGG - Intergenic
1011788236 6:90869579-90869601 CCCTTACAGTCTCAGAAGACTGG - Intergenic
1019825496 7:3280926-3280948 GCCGTAAGTTCTCTGAGGACAGG + Intergenic
1026573623 7:71553966-71553988 CCAGAAAGGTCCCAGAAGACAGG - Intronic
1193437641 X:81496766-81496788 CCCGTAGGCTCTGGGAATACAGG - Intergenic