ID: 1092275886

View in Genome Browser
Species Human (GRCh38)
Location 12:7060728-7060750
Sequence CAGAACCAGGACAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 571}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092275886 Original CRISPR CAGAACCAGGACAGGGAGGC TGG Intronic
900123379 1:1059026-1059048 CAGAACCAGGAGAGGCAGTTTGG + Intergenic
900401894 1:2476122-2476144 CAGACCCAGGTCAGGGCTGCGGG - Intronic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
901101929 1:6725758-6725780 CAGAACCAGGGCAGGAAGCCCGG - Intergenic
901347686 1:8561034-8561056 CAGAACCAAGCCAGGGATACTGG + Intronic
901464750 1:9413884-9413906 CAGGACCAGGGCCAGGAGGCTGG + Intergenic
901787480 1:11634326-11634348 CCAAACCTGGAGAGGGAGGCAGG + Intergenic
901795340 1:11676432-11676454 CAGAACCAGGACACCAAGCCAGG + Intronic
903686428 1:25135537-25135559 CTATACCAGGACATGGAGGCTGG + Intergenic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
903950896 1:26995208-26995230 CATAACCAGGACAGGATGTCTGG + Intronic
904029211 1:27523533-27523555 CAGAACCAGGACTGGAATCCAGG + Intergenic
904163153 1:28536064-28536086 CAGAGCCAGGACAGGAACGCAGG - Intronic
904960452 1:34328537-34328559 CTGAAGCAGAACAGGGAGGTGGG - Intergenic
905227368 1:36488059-36488081 GAGAACAAAGACATGGAGGCTGG + Intergenic
905410619 1:37765585-37765607 CAGACCTAGGGCAGGGAGACAGG - Intergenic
905868976 1:41392084-41392106 CACACCCAGGACAGGCAGCCAGG - Intergenic
906104854 1:43285602-43285624 CAGAACCTGGACAGGTGGGCGGG + Intronic
906700442 1:47853531-47853553 CAGAACCAGGAAAGTCACGCAGG + Intronic
908007312 1:59740074-59740096 CTGAAGGAGGACAGGGAGGGAGG - Intronic
909131140 1:71738660-71738682 CAGAGCCAGGACACACAGGCAGG - Intronic
909529863 1:76670425-76670447 CTGACCCAGGACAGGGGTGCTGG - Intergenic
909549661 1:76883645-76883667 TAGTACCATGACAGGCAGGCAGG + Intronic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912586625 1:110772437-110772459 GAGAAGCAGGACAGGGTGGAGGG - Intergenic
912702454 1:111888387-111888409 GAGAACAAAGACAGTGAGGCCGG + Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913611536 1:120514104-120514126 CTGCAGCAGGACATGGAGGCTGG - Intergenic
913983255 1:143542703-143542725 CTGCACCAGGACTCGGAGGCTGG + Intergenic
914196799 1:145451941-145451963 GAGAAACAGAAGAGGGAGGCGGG + Intergenic
914327524 1:146634911-146634933 CAGAACCATGAGTGGGAGGAAGG + Intergenic
914579656 1:149008135-149008157 CTGCAGCAGGACATGGAGGCTGG + Intronic
914852665 1:151326774-151326796 CAGAAGCAGCACAGGAAGACAGG + Intronic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915874918 1:159602260-159602282 CAGGAGCAAGACAGTGAGGCGGG - Intergenic
916192915 1:162196636-162196658 CAGAAACAGGAAAGAGATGCTGG + Intronic
916579565 1:166095418-166095440 AGGAACCAGGACAGGCAGACAGG + Intronic
916819795 1:168387121-168387143 AAAAACCAGGACAGGGAACCAGG - Intergenic
917336126 1:173926086-173926108 GAGAAACAGCAAAGGGAGGCTGG + Intergenic
919830243 1:201535835-201535857 CAGAACCAAGGCATGGAGTCAGG + Intergenic
920649624 1:207827046-207827068 AGGAAACAGGACAGGGAGGCCGG - Intergenic
920675564 1:208036135-208036157 CAGCACTAGGACTGGGAGGGGGG + Intronic
920704207 1:208240017-208240039 CAGAACCAGAGCAGGGAAGGCGG + Intronic
920704424 1:208241473-208241495 CTGGAGCAGGACAGGGGGGCTGG - Intronic
921897940 1:220420633-220420655 CAGAATCAGTACAGGTAGGATGG + Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922621727 1:226994131-226994153 CAGTAGCAGGACAGGGATTCAGG - Exonic
922676926 1:227559070-227559092 CTGAGCCAGAACAGGGCGGCAGG - Intergenic
922764912 1:228151689-228151711 CACAGGCAGGACAGTGAGGCCGG + Intronic
922875233 1:228935280-228935302 CAGAACCTGCCCAGGGAGGCAGG - Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
924145517 1:241070675-241070697 CAGAGACAGTGCAGGGAGGCTGG + Intronic
924264079 1:242263132-242263154 CAGAAAAAGGCCAGGCAGGCTGG - Intronic
924453980 1:244203390-244203412 CAGAAGCAGGACTGGCAGCCGGG - Intergenic
1063073842 10:2694902-2694924 CAGAAACAGGACAGGGAAACAGG + Intergenic
1064464217 10:15563058-15563080 CAGAACCAAGAGAGAGAGGGTGG - Intronic
1064615520 10:17151407-17151429 CAGAACCAGGACAGAGGGTTTGG + Intronic
1065437261 10:25716329-25716351 CAGAAGGAAGAAAGGGAGGCAGG + Intergenic
1066299094 10:34081149-34081171 CAAGACCAGAACACGGAGGCGGG - Intergenic
1066720719 10:38335332-38335354 CAGAAAAAGGCCAGGCAGGCTGG + Intergenic
1067107264 10:43374564-43374586 CAGAACCAGAACCAGGAGACAGG - Intronic
1067231697 10:44416680-44416702 CAGAACCTTGCCAGGGAGCCAGG - Intergenic
1067386211 10:45819584-45819606 CAGAACCAACACAGGAAGCCAGG + Intergenic
1067742801 10:48908758-48908780 CAGAACCAGGACACTGACACTGG + Intronic
1067877046 10:50016468-50016490 CAGAACCAACACAGGAAGCCAGG - Intergenic
1067954204 10:50774488-50774510 CAGAACCAGGACAAGAATTCAGG - Intronic
1069700746 10:70423422-70423444 CAGCCCCAGGACAGGTAGGTGGG - Exonic
1070276290 10:75010651-75010673 CAGAACCAGGTTTGGGAGACAGG - Intronic
1070324318 10:75378076-75378098 CAGCACCAGGCAGGGGAGGCCGG + Intergenic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070505110 10:77106322-77106344 CAGAGCCAGAACAGAGTGGCAGG + Intronic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070774458 10:79101680-79101702 GTGAACCAGGGCAGGGAGGGAGG + Intronic
1070963089 10:80512580-80512602 CAGAAAAAGGACAGGGAAGAGGG - Intronic
1072487119 10:95866174-95866196 CAGATCCAGGGCAGCGACGCCGG + Exonic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072727163 10:97821839-97821861 CAGGAGCAGGAAAGGGGGGCAGG + Intergenic
1072738592 10:97896099-97896121 CAGCACCGGGGCAGGAAGGCTGG + Intronic
1072758235 10:98035332-98035354 CAGCCCCAGGAAAGGGATGCTGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1074471227 10:113728551-113728573 TCAAACCAGGACAGGTAGGCAGG + Intronic
1074969461 10:118523863-118523885 CAGCACCAGGACGGGAAGGTTGG - Intergenic
1075389123 10:122079639-122079661 GAGGAGCAGGACAGAGAGGCTGG + Intronic
1075397170 10:122135812-122135834 CAGAGCCACGACAAGAAGGCAGG - Intronic
1075914611 10:126156760-126156782 CAGGCCCAGGACAGGGTGGAAGG + Intronic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076558644 10:131346612-131346634 CAGAACCCGGTCTGGGAGGCTGG - Intergenic
1076785468 10:132747546-132747568 CGGAACCTGCACAGGAAGGCCGG + Intronic
1077019155 11:409859-409881 CAGAGCCATGCCAGGTAGGCAGG - Exonic
1077034305 11:487489-487511 CAGAACCGGGGCGGGGAGGCCGG - Intronic
1077132097 11:978168-978190 CAGGGCCTGGTCAGGGAGGCAGG + Intronic
1077384493 11:2262628-2262650 CAGAACAGGGACCCGGAGGCAGG + Intergenic
1077418626 11:2437707-2437729 CAGACCCAGTACAGTGGGGCTGG - Intergenic
1077444581 11:2585048-2585070 CTGGCCCAGGACAGGCAGGCTGG + Intronic
1077614180 11:3663275-3663297 CAGAGCCAGGACAAGAAGCCAGG + Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077905448 11:6529308-6529330 CAGAGCCAAAACAGAGAGGCCGG - Intronic
1077942951 11:6863101-6863123 CAAAACCAGGACTGGGAGCATGG + Intergenic
1078240774 11:9529413-9529435 CAGGACCAGCACTGGGAGGCTGG - Intergenic
1079093405 11:17495878-17495900 CCCAGCCACGACAGGGAGGCAGG + Intronic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1080831488 11:35897260-35897282 CAGAACCATGGCAGGCTGGCAGG + Intergenic
1082076389 11:47979412-47979434 GAGAAACAGGAATGGGAGGCTGG - Intergenic
1082233670 11:49798263-49798285 CACCTCCCGGACAGGGAGGCTGG + Intergenic
1082879586 11:58024857-58024879 CAGAGTCAGGGCAGGGAGCCAGG + Intronic
1083220678 11:61250268-61250290 CAGACCCAGGACTTGGACGCAGG - Intronic
1083366853 11:62146603-62146625 CAGGCCCAGGCCAGAGAGGCAGG - Intronic
1083379648 11:62254891-62254913 CAGAACCAGGATATGAAGTCAGG - Intergenic
1083842820 11:65314676-65314698 CAGAACCAGGACAGGACTCCAGG + Intergenic
1083962283 11:66021080-66021102 CAGCACCAGGATACAGAGGCAGG + Exonic
1084084730 11:66849797-66849819 CAGATCCAGGGGAGGGAGGGAGG + Exonic
1084431864 11:69115753-69115775 CGGTGCCAGGACAGGGAGGGCGG + Intergenic
1084519418 11:69654539-69654561 TAGAACCAGGGCAGGGTGGCAGG + Intronic
1084568995 11:69948504-69948526 AAGACCCAGGACCTGGAGGCCGG - Intergenic
1084618234 11:70250875-70250897 CAGAACAAGGACAGGGTGCAAGG - Intergenic
1085024979 11:73231108-73231130 CAAAACCAGGGCGAGGAGGCCGG - Intronic
1085112083 11:73897494-73897516 CACATCCCGGACAGGGTGGCAGG + Intronic
1085121519 11:73970371-73970393 CAAAGCCAGGACAGGGACTCAGG - Intergenic
1085396940 11:76211165-76211187 CAGGACTAGGACACGAAGGCAGG - Intergenic
1085506966 11:77066481-77066503 CAGAACCAGGACTTGGTGGGCGG - Intergenic
1085807771 11:79652000-79652022 TGGAGACAGGACAGGGAGGCAGG + Intergenic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086854559 11:91850710-91850732 GAGAAGCAGGGCAGGCAGGCAGG + Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088797288 11:113274450-113274472 CAGTTCCAGGAAAGGGAGTCGGG - Intronic
1089317961 11:117605043-117605065 CAGAACCAGACCAGGGAGCAGGG - Intronic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1090188298 11:124752146-124752168 CAGGAGCAGGACAGGACGGCCGG - Exonic
1090394188 11:126408032-126408054 CAGATCCAGGGCAGCGAGCCTGG + Intronic
1090767589 11:129890071-129890093 TAGATCAAGGACAGGGAGGGAGG + Intronic
1091626162 12:2122529-2122551 GAGAGCAAGGACCGGGAGGCCGG - Intronic
1091681991 12:2533777-2533799 CAGAACCGGGACAGGGACGCAGG - Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1094253528 12:28395042-28395064 CAGAACCAGGGCTGGGATTCAGG + Intronic
1095581633 12:43806451-43806473 GAGAACTAGGATAGCGAGGCCGG - Intergenic
1095964626 12:47858566-47858588 CTGCCCCAGCACAGGGAGGCAGG - Intronic
1096463551 12:51836170-51836192 TAGAACCAGGGGAGGGAGGATGG + Intergenic
1096586549 12:52626298-52626320 TAGAACCAGGACTGGAAGCCAGG + Intergenic
1096925083 12:55135377-55135399 CAGAAGCAGGACTGGTGGGCTGG - Intergenic
1097194339 12:57235451-57235473 CAGTAGCGGGACAGGGTGGCCGG + Exonic
1097387688 12:58969283-58969305 CAGAACCAGGCTAGACAGGCTGG - Intergenic
1097602165 12:61706736-61706758 CAAAACAAGGACAGGAAGGAAGG + Intergenic
1097685269 12:62685024-62685046 CAGAGCCAGGAAGGGGTGGCGGG - Intronic
1099695631 12:86015103-86015125 CAGAAGTAGGACACAGAGGCCGG - Intronic
1100923472 12:99516576-99516598 CAGGACCCTGTCAGGGAGGCAGG + Intronic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101838545 12:108311787-108311809 CTGACCCAGGACAGGGCTGCAGG + Intronic
1102244213 12:111344744-111344766 CAGGACCTGAGCAGGGAGGCAGG + Intronic
1103189050 12:118984863-118984885 TAGAACCAGGACAGGAATCCAGG - Intronic
1103825093 12:123731674-123731696 TAGAACCAGGAAAAAGAGGCTGG - Intronic
1104090704 12:125514743-125514765 CAGGACCAGGGAAGGGAGGGAGG - Intronic
1104294797 12:127502230-127502252 AAGAGCCAGGACAGGGAGACAGG - Intergenic
1104569102 12:129909459-129909481 CAGGCCCAGCCCAGGGAGGCCGG + Intergenic
1104842452 12:131831557-131831579 CAAAACCAAGACAGGCAGGAGGG + Intronic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1106231602 13:27825222-27825244 GAGGTTCAGGACAGGGAGGCAGG + Intergenic
1107100125 13:36581439-36581461 CAGAACCATCTCAAGGAGGCCGG + Intergenic
1107768282 13:43761120-43761142 GAGAATGAGGACAGGAAGGCAGG - Intronic
1108287710 13:48925102-48925124 CAGAACACAGACAGGCAGGCTGG + Intergenic
1108288701 13:48935544-48935566 CAGAATGATGACAGGGTGGCAGG - Intergenic
1109215477 13:59584746-59584768 CAGAATTAGTACAGGGATGCAGG + Intergenic
1110461402 13:75749576-75749598 CAGCAGCAGGTCAGGGAGGGAGG - Intronic
1111139294 13:84093287-84093309 CAGAACCAGGGAAGGGAAGAGGG + Intergenic
1111577755 13:90180410-90180432 CAGCAACAGGACAGCGAGGTGGG - Intergenic
1112578124 13:100655473-100655495 CAGTAACAGGACTGGGAGGGAGG - Intronic
1112688485 13:101861341-101861363 CAGAAGCAGGACAGGGTGGGTGG - Intronic
1113565161 13:111315505-111315527 CAGCACCTGGCCAGGGAGGCAGG + Intergenic
1114495167 14:23127110-23127132 CAGGACCAAGGCAGGGAGGTAGG + Exonic
1115644460 14:35358465-35358487 CAGCACCAGGAAAGAGATGCTGG + Intergenic
1117426419 14:55602984-55603006 CAGACCCAGGACAGGAAAGGAGG - Intronic
1118920996 14:70149878-70149900 CAGCCCCAGGACAGGGAAGAAGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119746289 14:77046558-77046580 CAGAACCACGACAGTGCTGCTGG - Intergenic
1119784788 14:77304741-77304763 CAGATCCAGTACAGTGAGGTAGG + Exonic
1120465628 14:84853755-84853777 CATAACCAGGACAGGAATTCTGG + Intergenic
1120836276 14:89040874-89040896 CAGTCCCGGGCCAGGGAGGCAGG + Intergenic
1121125533 14:91404303-91404325 CCGCCCCAGGACAGGAAGGCAGG - Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121436236 14:93922004-93922026 GAGAAACAGCACAGGGTGGCTGG + Intronic
1121473043 14:94171474-94171496 CAGAGCCAGGACAGGGACTCAGG + Intronic
1121552791 14:94814983-94815005 CAGAACCTGGAGAGAGAGACAGG - Intergenic
1121637184 14:95461822-95461844 CAGAGCAGGGACTGGGAGGCTGG + Intronic
1121728028 14:96167096-96167118 CAGAGACTGAACAGGGAGGCAGG - Intergenic
1121764442 14:96473787-96473809 CAAAACCAGGGCAGGGAAGGAGG - Intronic
1122112939 14:99514532-99514554 CATAGCCTGGACAGGGTGGCAGG + Exonic
1122153721 14:99738133-99738155 CTGACCCAGGACAGAGGGGCAGG + Intronic
1122613443 14:103001172-103001194 CTGAGCCAGGGCGGGGAGGCTGG - Intronic
1123059006 14:105586025-105586047 CAGAAGCAGGCCAGTGAGACAGG - Intergenic
1123083336 14:105706256-105706278 CAGAAGCAGGCCAGTGAGACAGG - Intergenic
1123419654 15:20121269-20121291 CAGAACCAGTCCATGGAGGATGG + Intergenic
1123446210 15:20332267-20332289 CAGAACCAGTCCATGGAGGATGG - Intergenic
1123528877 15:21127805-21127827 CAGAACCAGTCCATGGAGGATGG + Intergenic
1123536216 15:21187189-21187211 CAGAACCAGCACAGAGAGCAGGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1123944518 15:25232609-25232631 CCAAGCCAGTACAGGGAGGCTGG - Intergenic
1125584902 15:40813244-40813266 CCGAACCAGTTCTGGGAGGCAGG + Intronic
1125925120 15:43556812-43556834 CACAACAAAGCCAGGGAGGCAGG + Intronic
1126772494 15:52072017-52072039 CAGAACCAGGCCAGGGGTGGGGG + Intergenic
1126836258 15:52669015-52669037 CTGAGGCAGGACAGTGAGGCAGG - Intronic
1127775975 15:62264559-62264581 CAGGGCCTGGACAGGGAAGCTGG + Intergenic
1128077867 15:64839545-64839567 CAGAACCAGGACAAAGGGGTAGG - Intergenic
1128584181 15:68833411-68833433 CAGAACCTGCACTGTGAGGCTGG - Intronic
1128753889 15:70168236-70168258 CAGAACCAGGCCAGGCACGGTGG + Intergenic
1128944563 15:71811857-71811879 ATGAACCAGGACGGTGAGGCGGG + Exonic
1129117772 15:73374840-73374862 CAGAGCCAGGCCAGAGAGGGAGG + Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129659431 15:77544715-77544737 CAGATCCAGGGCAGGGGTGCTGG - Intergenic
1130383244 15:83390150-83390172 CAGAACCAGAGAAGAGAGGCAGG - Intergenic
1130401393 15:83557868-83557890 AAGACGCAGGACAGGGAGGATGG + Intronic
1130898957 15:88192707-88192729 CAGAAGCAGGACAGTGTGACTGG - Intronic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1132292487 15:100713311-100713333 CTGAACCAGTACAGGAACGCAGG - Intergenic
1132394881 15:101465113-101465135 CAGACCAATGACGGGGAGGCTGG + Intronic
1132548680 16:545287-545309 CAGAACCAGGGCAGAAGGGCAGG + Intronic
1132552484 16:559289-559311 CTGAAACAGCACAGGGAGCCCGG - Intergenic
1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG + Intergenic
1132765282 16:1531410-1531432 CAGAACAGGGACACGGAGGGAGG - Intronic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1133922134 16:10162865-10162887 ATGAACCAGGACAGGGATGGAGG + Intronic
1135287119 16:21203297-21203319 CGGAACCGTCACAGGGAGGCAGG + Intronic
1135676695 16:24421185-24421207 CAGAAGCAAGAGAGCGAGGCTGG - Intergenic
1136144968 16:28311136-28311158 GGGAACCAGGAAAGGGATGCAGG + Intronic
1136403434 16:30030535-30030557 CAGGACTTGGGCAGGGAGGCAGG + Exonic
1136649068 16:31650657-31650679 AAGAAACATGACAGTGAGGCCGG + Intergenic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1136918901 16:34245699-34245721 CACCTCCAGGACAGGGTGGCTGG + Intergenic
1137474890 16:48799124-48799146 CAGAAAGAGGACAGGGATGAGGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138195823 16:55051458-55051480 CAGAAGGAAGACAGGGAGGAGGG + Intergenic
1138479176 16:57290429-57290451 CAGAAAAAGGGCAGGGAGCCAGG + Intergenic
1139371740 16:66473349-66473371 CAGAAGTGGGGCAGGGAGGCCGG - Intronic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1139474940 16:67198463-67198485 CAGAAGCAAGACACTGAGGCTGG - Exonic
1139478886 16:67217334-67217356 CAGAGCCAGGACTAGGAGGAAGG - Intronic
1139549041 16:67663395-67663417 GAGTACCTGGGCAGGGAGGCTGG - Intronic
1140006037 16:71076029-71076051 CAGAACCATGAGTGGGAGGAAGG - Intronic
1141583179 16:85014560-85014582 CAGAACAAGAACAGCGAGGAAGG + Intergenic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1142766048 17:2064906-2064928 GGGAGCCAGGACAGGGAGGTTGG + Intronic
1142809317 17:2387779-2387801 AAGAGCCTGGCCAGGGAGGCTGG + Intronic
1143453380 17:7050324-7050346 CAGAAGGTGGACAGGGAGGGAGG + Intergenic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144222736 17:13114730-13114752 CACAGCCAGGACAGGGAGACGGG - Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1144745599 17:17612124-17612146 AAGCACCAGGACAGGGCAGCAGG - Intergenic
1144849258 17:18235777-18235799 CAGTCCCAGGGCAGGCAGGCTGG - Intronic
1145056013 17:19704412-19704434 CAGAAGCAGCACAGGCAGGCGGG + Intronic
1145921418 17:28612987-28613009 CAGAACCAGGAAAAGAAGGTGGG + Intronic
1146787648 17:35732828-35732850 CATAACCAGTACAGGCAGGTGGG - Intronic
1147422817 17:40331079-40331101 CAGCTCCAGGACAGGGCGGGTGG + Exonic
1147559405 17:41499740-41499762 CACCACCAGGACCTGGAGGCAGG + Intergenic
1147600219 17:41740523-41740545 CAGAGCCTGGACATGGACGCAGG - Intergenic
1147793859 17:43029009-43029031 CAGAACCAGGATATGGGGACTGG - Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148800474 17:50221866-50221888 CAGAACCAGGACCAGGAGATAGG - Intergenic
1149648103 17:58255007-58255029 CAGAGCCAGGAGTGGGAGCCAGG - Intronic
1149648185 17:58255607-58255629 CAGAGCCAGGAGTGGGAGCCAGG + Intronic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1150266907 17:63837856-63837878 CAGAACCTGGGCTGGGAGGAGGG + Intronic
1151318378 17:73337792-73337814 CAATTCCAGCACAGGGAGGCAGG + Exonic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151487550 17:74410733-74410755 CATAACGGGGACAGGGTGGCTGG + Intergenic
1151830727 17:76548501-76548523 CAGAACTAGGCCACCGAGGCTGG - Intronic
1152302965 17:79506216-79506238 CAGAGCCAGAAAAGGGAGGAGGG + Intronic
1152749565 17:82056430-82056452 CAGGACCAGGACAGGAGGCCAGG - Intronic
1152929278 17:83101676-83101698 CGGGACCAGGACATGGAGGCCGG + Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1154483318 18:14856789-14856811 CACAACCCAGACAGGGTGGCCGG + Intergenic
1154483738 18:14858409-14858431 CACAACCCAGACAGGGTGGCCGG + Intergenic
1154484159 18:14860029-14860051 CACAACCCAGACAGGGTGGCCGG + Intergenic
1155388482 18:25307551-25307573 ATGAACCAGGAAAGGAAGGCAGG - Intronic
1155498631 18:26465838-26465860 CAGAGGCAGGACTGGGAGGATGG - Intronic
1155721154 18:29013314-29013336 CAGAAGCAGAACAGGGAGAAAGG - Intergenic
1156812666 18:41271789-41271811 CAGAAGCAAGAGAGGGAGGTGGG - Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1158387529 18:57012358-57012380 CAGCACCAGGATAGGAAGGGAGG + Intronic
1158615600 18:58983633-58983655 CAGACCCAGGACAGCCAAGCAGG - Intronic
1158652837 18:59303075-59303097 CATAACCAGGACAGTGAGAGTGG - Intronic
1158660023 18:59378689-59378711 CAGAACCAGCACGGGGAGAAGGG + Intergenic
1158849590 18:61482093-61482115 CAGCACCAGGACAGGGAAGCTGG + Intronic
1159586535 18:70288669-70288691 AAAAACCAGGACAGGGACTCTGG + Intergenic
1159673278 18:71250011-71250033 AAGAAACAGGATAGGGAAGCAGG - Intergenic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161623140 19:5309808-5309830 CAGATCCAGGCCAGGGATGATGG - Intronic
1161709114 19:5837937-5837959 CAGAGCCCGGACTGGGAGGGAGG + Intronic
1162385210 19:10356891-10356913 TAGAACCAGGACTGGGACCCAGG + Intronic
1162906783 19:13828753-13828775 CAGAACCAGAACAGCGAAGTGGG - Intronic
1163160069 19:15458908-15458930 TAAAACAAGGCCAGGGAGGCTGG - Intronic
1163300487 19:16442651-16442673 CAGACCCAGGCCAGGGAAACTGG - Intronic
1163682341 19:18690345-18690367 CAAAGCCAGGACTGGGGGGCGGG - Intronic
1164298538 19:23937494-23937516 CACATCCCGGACAGGGTGGCAGG + Intronic
1164515558 19:28932459-28932481 TAGAACCAGGAGATGGAGGGGGG - Intergenic
1164587363 19:29484401-29484423 CAGATCCAGGAGAGGCCGGCTGG - Intergenic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1165062840 19:33213128-33213150 CAGCACCGGTCCAGGGAGGCAGG + Intronic
1165258355 19:34593480-34593502 CAGAGCCAGGCCAGGAACGCGGG + Exonic
1166147833 19:40849622-40849644 AGGAATCAGGACAGGGACGCTGG + Intronic
1166198794 19:41222996-41223018 CATAGACAGGACAGAGAGGCCGG + Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166416087 19:42595786-42595808 GAGATCCAGGAGAGGGAGCCTGG + Intronic
1166846354 19:45730905-45730927 GAGAACCCGGAAGGGGAGGCTGG - Intergenic
1166864864 19:45829691-45829713 CAGAATCAGGACAGAGAACCAGG + Intronic
1167045506 19:47046667-47046689 CGGAACCAGGAGAGGAAGGCTGG + Exonic
1167278827 19:48554450-48554472 AAGAACCAGGGCAGAGAGTCAGG - Intronic
1167423997 19:49420363-49420385 CAGAGCCAGGGCAGGGTGGGAGG + Intergenic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167786782 19:51643928-51643950 CGGAACCAGCTCAGTGAGGCAGG + Exonic
925034262 2:673802-673824 GAGAAGCAGGACAGCCAGGCAGG + Intronic
925060249 2:885381-885403 CAGCCCCAGGACATGGAGCCTGG + Intergenic
925683590 2:6448564-6448586 CAGAAAGTGGACAGTGAGGCAGG + Intergenic
926053771 2:9761706-9761728 CAGAGGCAGGAAAGGGAGGGCGG - Intergenic
926098228 2:10096648-10096670 CATCACCAGAACAGGGTGGCCGG - Intergenic
926136580 2:10340827-10340849 CAGTAACAGGACAGGGATTCAGG - Intronic
926230970 2:11003544-11003566 CAGAACCTGGAGAGGCAGGAAGG + Intergenic
926345625 2:11942535-11942557 CAGGAGCAGGTCTGGGAGGCAGG - Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927508569 2:23630144-23630166 CAGCACCAGGAGTGGGAGCCAGG + Intronic
927998871 2:27506167-27506189 GAGACCCTGGAGAGGGAGGCAGG - Intronic
928046903 2:27943416-27943438 CAGAAGCAGGAAAGGAAGGCAGG - Intronic
928170707 2:29001264-29001286 CAGAACCAGCACCGGAAGCCAGG + Intronic
929043849 2:37772112-37772134 CAGCTTCAGGACAGAGAGGCTGG - Intergenic
929832606 2:45359024-45359046 CAGGTACAGGCCAGGGAGGCAGG - Intergenic
930956659 2:57211075-57211097 GATAACCAGCACAGGGGGGCAGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931926441 2:67078087-67078109 CAAAACCAACACAGGGAGGAAGG - Intergenic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932329495 2:70889616-70889638 CAGAGCCAGGCCGGCGAGGCGGG + Intergenic
933035706 2:77394826-77394848 CAGAACCAGGCCAGGGTTGGTGG + Intronic
933181827 2:79235812-79235834 CAGAAGCAGGACAGCTGGGCTGG + Intronic
933957258 2:87381499-87381521 CAGAACCAGTCCATGGAGGATGG - Intergenic
934045817 2:88171662-88171684 CAGAACCAGGGTCGGGGGGCAGG - Exonic
934241376 2:90273391-90273413 CAGAACCAGTCCATGGAGGATGG - Intergenic
934271798 2:91543295-91543317 CAGAACCAGTCCATGGAGGATGG + Intergenic
936147786 2:109992906-109992928 CAGAACCAGTCCATGGAGGATGG + Intergenic
936196905 2:110378541-110378563 CAGAACCAGTCCATGGAGGATGG - Intergenic
937504354 2:122519883-122519905 AAGAAACAGGTCAGGCAGGCAGG + Intergenic
937912419 2:127082001-127082023 CAGACAGAGGACAGGCAGGCGGG + Intronic
939162830 2:138609566-138609588 CAGCACCTGCACAGGTAGGCAGG + Intergenic
941970645 2:171347272-171347294 TAGAAGCAGGAAAGGCAGGCAGG - Intronic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943676568 2:190721556-190721578 CAGCTCCAGGACAGGAAGGAGGG - Intergenic
943705736 2:191032414-191032436 TACAACCAGGAAAGGTAGGCTGG + Intronic
944860675 2:203812978-203813000 GAGAGCCAGGACAGTGAGGAAGG - Intergenic
947706617 2:232281638-232281660 CAGAACCACAAAAGGGAGGGGGG + Intronic
948594371 2:239069996-239070018 GAGGACCAGGACAGAGAGGACGG - Intronic
948741972 2:240054118-240054140 CTGAACAAGGACAGGGTGGATGG - Intergenic
948838196 2:240636397-240636419 CAGAACCAGCTCAGGGAGCCAGG + Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
948989490 2:241545618-241545640 CAGAAGGAGGACAGAGAGGGAGG + Intergenic
949060686 2:241955323-241955345 AACAAGCAGGACAGAGAGGCAGG + Intergenic
1169214316 20:3784712-3784734 AAGAACCACGCCAGGCAGGCGGG - Exonic
1170153511 20:13249332-13249354 CAGAACTAGGGGTGGGAGGCAGG - Intronic
1170893532 20:20395318-20395340 CAGCTGCAGGACAGGTAGGCGGG + Intronic
1170893674 20:20396082-20396104 CAGACCCAGGACAGAAAGGCAGG + Intronic
1172359281 20:34301171-34301193 CAGAACCAGAACTGGCAGCCAGG + Intronic
1172379204 20:34474758-34474780 CACCTCCAGGACAGGGCGGCTGG + Intronic
1172393652 20:34583686-34583708 CGGAACAAGGACAGGGAAGGTGG + Intronic
1172501846 20:35433270-35433292 CTGACCCAGGGCAGGGAGGTGGG - Intronic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172874335 20:38155160-38155182 CAGAACCAGGACACAGTGCCTGG + Intronic
1173530650 20:43766865-43766887 ATGAACAAAGACAGGGAGGCTGG - Intergenic
1173622952 20:44450500-44450522 AAGAACCATCACAGGGAGGCAGG - Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174519597 20:51119318-51119340 CAGAAGCAGGACCGGGAGCCAGG + Intergenic
1174872852 20:54199589-54199611 CAAAACAAGGTCAGGGAGGGAGG + Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175163036 20:57022812-57022834 AAGAGCCAGGAGAGGGAGACAGG - Intergenic
1175723844 20:61303549-61303571 CAGCAGCAGGACAGGGATCCAGG + Intronic
1176098941 20:63356294-63356316 CAGGGCCAGGACAGGGCAGCAGG + Intronic
1176099400 20:63358153-63358175 CAGCTCCAGGACACTGAGGCTGG + Intronic
1176797357 21:13380050-13380072 CACAACCCAGACAGGGTGGCCGG - Intergenic
1176866494 21:14057423-14057445 CAGGGCCAGGACAGGCAGGATGG + Intergenic
1177087100 21:16719201-16719223 GAGAGCTAGGACATGGAGGCAGG + Intergenic
1179334546 21:40438081-40438103 CAGACCCAGGACCAGGAGTCTGG + Intronic
1179819824 21:43930293-43930315 CAGGCCCAGGACAGGGAACCGGG - Intronic
1179953284 21:44723765-44723787 CAGAACTAGGGAAGGGAGGCGGG + Intergenic
1179965621 21:44802950-44802972 CTGAACCAGGCCAGGGCAGCTGG - Intergenic
1180027784 21:45178211-45178233 CACAGCCAAGCCAGGGAGGCAGG - Intronic
1180229471 21:46418378-46418400 CAGAACCAGGCAAAGGATGCAGG - Intronic
1180552247 22:16550022-16550044 CAGAACCAGTCCATGGAGGATGG - Intergenic
1180667905 22:17529315-17529337 CAGAGCAAGCACAGGAAGGCTGG + Intronic
1180799430 22:18624895-18624917 CAGACCCAGGACAGGCAGGAGGG - Intergenic
1181030778 22:20148065-20148087 CAGGACCTGGGCAGGGAGGGTGG + Intergenic
1181222288 22:21370371-21370393 CAGACCCAGGACAGGCAGGAGGG + Intergenic
1181351784 22:22264037-22264059 CAGAACCAGTCCATGGAGGATGG + Intergenic
1181512543 22:23395319-23395341 CAGGACCTGGGCAGGGAGGGTGG - Intergenic
1181638047 22:24183364-24183386 CGGACCCAGGACAGGCAGGAGGG + Intronic
1181638992 22:24187122-24187144 CAGCCCCAGGACAGGGTGGTCGG - Intronic
1182916696 22:34039730-34039752 CGGAACCAGGACACAGAGGATGG - Intergenic
1183667356 22:39253532-39253554 CAGAACTCGGGCAGGGAGGACGG - Intergenic
1183686209 22:39362677-39362699 CAGGACAAGGGCAGGAAGGCTGG + Intronic
1183967100 22:41448311-41448333 CTCCACCGGGACAGGGAGGCGGG + Intergenic
1184030790 22:41893171-41893193 CAGAGCCAGCGCAGGGAGTCAGG - Exonic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184917172 22:47577728-47577750 CAAAAACAGGAAAGGGAGGGAGG + Intergenic
1184924223 22:47626039-47626061 CTGAGACAGGACAGGGAGGTAGG - Intergenic
1185101849 22:48844790-48844812 CAGAAGGAGGACAGAGAGGGAGG - Intronic
1185385008 22:50527561-50527583 CAGAAGCAGGCCATGGAGTCAGG + Intronic
949229350 3:1732211-1732233 CAGAACCAAGACAGAGAGAAGGG - Intergenic
949581328 3:5391426-5391448 GAGAACCAGCACAGAGAGGAAGG + Intergenic
949938524 3:9136115-9136137 GGGAACCAGCACAGAGAGGCTGG - Intronic
950443304 3:13022324-13022346 CAGGACCAGGGCACAGAGGCTGG - Intronic
950448978 3:13055054-13055076 CAGAGCCAGGACAGGAAGGCCGG - Intronic
950479997 3:13238208-13238230 CAGGACCAGGAGAGGAAAGCAGG - Intergenic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950721848 3:14888790-14888812 CAGAACAAAGACACAGAGGCTGG + Intronic
951766184 3:26202279-26202301 CAGAACCTGGACTGGCAGTCAGG + Intergenic
951974165 3:28484757-28484779 CAGAAGGAAGACAGGAAGGCAGG - Intronic
952330749 3:32362502-32362524 GAGAGCCAGGAATGGGAGGCAGG + Intronic
953108801 3:39912075-39912097 TGGGACCAGGCCAGGGAGGCTGG - Intronic
953823417 3:46229877-46229899 GAGAAGCAGGACAGAGAGGGAGG + Intronic
954116664 3:48470389-48470411 CAGCCCCAGGGCAGGGAGGCTGG + Intronic
954258040 3:49419748-49419770 CAGAACCAGGGCAGAGATGTGGG - Exonic
954628439 3:52035500-52035522 CATCACCAGGACAGGGTGGTGGG + Intergenic
954872504 3:53778398-53778420 CAAAACCAGCACAGGCAGCCAGG - Intronic
954894781 3:53966047-53966069 CAGAACCAGGTCCAGGGGGCTGG - Intergenic
955362791 3:58289830-58289852 CACCACCCGGACAGGGCGGCTGG + Intronic
955376100 3:58398475-58398497 CAGACCTAGGGCAGGCAGGCAGG + Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
957000311 3:74876704-74876726 CAGAATCAGAACATGGAGACTGG - Intergenic
957939908 3:86991192-86991214 CTGTGCGAGGACAGGGAGGCGGG + Intergenic
959619771 3:108387220-108387242 AACCACCAGGACAAGGAGGCAGG - Intronic
959904058 3:111691422-111691444 CAGAACCAGCACTGGGATTCAGG + Intronic
960338337 3:116445530-116445552 GAGAAACAGGAAAGGGAGGAGGG - Exonic
962204654 3:133424919-133424941 CAGAACCAGGCCAGGCATGGTGG - Intronic
963312050 3:143720412-143720434 CAGAACTAGGACTATGAGGCTGG + Intronic
963749977 3:149167110-149167132 CAGAACATGGACACTGAGGCCGG - Exonic
965376432 3:167930060-167930082 CAGAGACAGGTCAGGGAGACGGG + Intergenic
965823726 3:172710234-172710256 AAGAAAGAGGACTGGGAGGCTGG - Intronic
966403494 3:179570775-179570797 CAGTAGCAGGAAAGGTAGGCAGG + Intronic
966762305 3:183428758-183428780 CAGGACCCGGAGCGGGAGGCTGG + Intronic
967012171 3:185446054-185446076 CAAAACCAGGGCATGGAGGATGG + Intronic
967085733 3:186093519-186093541 CAGAACCAGCACAGGGTATCTGG + Intronic
967221937 3:187254786-187254808 AAGAACCAGGACTGAGAGGTGGG - Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968610683 4:1555592-1555614 AAGGACAGGGACAGGGAGGCCGG - Intergenic
968733129 4:2281083-2281105 GCCAACCAGGGCAGGGAGGCAGG - Intronic
968875928 4:3267963-3267985 GAGAAGCAAGACAGGGATGCAGG + Intronic
968896939 4:3409821-3409843 AAGAACCAGGACGGGAAGACAGG - Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969429660 4:7146752-7146774 CAGAACCAGAACAGGGAGTAGGG - Intergenic
969602279 4:8183337-8183359 CAGCACCAGGAAACCGAGGCAGG - Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
969707709 4:8820814-8820836 CAGAGCCAGGACAGGCAGCCCGG + Intergenic
970434712 4:16022200-16022222 AAAAGCCAGGACAGGAAGGCAGG + Intronic
970656166 4:18232545-18232567 CAGAACTGGGACTGGGAGCCAGG + Intergenic
970792616 4:19876535-19876557 CAGAAGCAAGACAGAGAAGCAGG + Intergenic
975654664 4:76629579-76629601 CGGATCCAGGACAGAGATGCTGG + Intronic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
980716819 4:136638563-136638585 CTGAAGCAGGATAGGGAGGTGGG - Intergenic
980773492 4:137409384-137409406 AGGAACCAGGAGAGGGAGGGAGG + Intergenic
982091752 4:151885639-151885661 AAGAACGGGGACAGGGAGGGAGG - Intergenic
984257052 4:177401643-177401665 TAGAAACAGGAGAGGGAGGAGGG - Intergenic
984509564 4:180662111-180662133 TAAAATGAGGACAGGGAGGCAGG - Intergenic
984557679 4:181234803-181234825 CAGAGCCAGGACTGGCATGCTGG - Intergenic
985768815 5:1796216-1796238 CAGAACCAGGCCAGGAATCCTGG - Intergenic
986208923 5:5652031-5652053 CAAAATCAGGCCAGGAAGGCAGG - Intergenic
986413210 5:7502456-7502478 GTGGACCAGGACAGAGAGGCAGG + Intronic
987001822 5:13667586-13667608 CAGAACTAGTCCAGGGAGACAGG + Intergenic
987827842 5:23056565-23056587 CAGACCCAAGGCAGAGAGGCTGG - Intergenic
990264246 5:54058661-54058683 CAGAAGCGGGACAGTGTGGCTGG + Intronic
990592581 5:57281418-57281440 TAGAAGCAGAAGAGGGAGGCAGG + Intergenic
992388517 5:76309270-76309292 CAGAAAGAAGGCAGGGAGGCTGG + Intronic
992441528 5:76801512-76801534 GAGAACTGGGAAAGGGAGGCTGG + Intergenic
992662030 5:78971267-78971289 CTAAGCCAGGACAAGGAGGCAGG - Intronic
992975324 5:82111100-82111122 CAGAAATAGGAAAGGGAGGAAGG - Intronic
993953786 5:94207386-94207408 TAGAACCAGGACAGGGCTGCTGG - Intronic
994083175 5:95731021-95731043 CAGAGCCAGGAAAGGGGGGTGGG - Intronic
997393027 5:133532483-133532505 TAGAACAAGGCCAGGGAGGGAGG + Intronic
998040438 5:138948003-138948025 CTGAACCATGACAAGCAGGCAGG + Intronic
998140408 5:139696875-139696897 CAGGAGCAGAACGGGGAGGCTGG + Intergenic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998239518 5:140427985-140428007 CACATCCCGGACAGGGCGGCAGG + Intronic
998288264 5:140884593-140884615 CAGAACCCAGACAAGGAGGAAGG - Exonic
998877901 5:146618987-146619009 CTGAACCAGGACAAGGGGGTAGG - Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999859793 5:155633365-155633387 CTGAAAGAGGACAGGGAGGGTGG - Intergenic
1000202875 5:159028890-159028912 CAGAAGAAGGCCAGTGAGGCTGG + Intronic
1000999627 5:167993664-167993686 CAGAAACAGGACTGACAGGCTGG + Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001675284 5:173507259-173507281 CAGTACCCAGAGAGGGAGGCTGG + Intergenic
1002302887 5:178267539-178267561 CAGATCCAGGACTTGAAGGCAGG + Intronic
1002461796 5:179377593-179377615 CAGAACCAGAACCTGGACGCAGG + Intergenic
1003298991 6:4859762-4859784 GAAAACCAGCACAGGGAGCCAGG - Intronic
1003319472 6:5038155-5038177 CACATCCCAGACAGGGAGGCGGG + Intergenic
1003422260 6:5969063-5969085 AAGGACCAGCACAGGGAGGGAGG + Intergenic
1004046662 6:12031629-12031651 CAGAACTGGGATAGGGAGACAGG + Intronic
1006052158 6:31353523-31353545 TAGAACCAGGGCAGGGAGAGAGG + Intronic
1006437706 6:34034885-34034907 CAGCACCAGGACTGGGATGTGGG + Intronic
1006679475 6:35787019-35787041 CGGAACCAGGACTGCGAGACTGG + Exonic
1007703952 6:43780103-43780125 CACGACCTGGACTGGGAGGCAGG - Intronic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1010727922 6:79356207-79356229 CATAAACTGGACAGAGAGGCAGG + Intergenic
1010753561 6:79641441-79641463 CATAGCCAGGACAGAGAGGTAGG - Intronic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1014320853 6:119926334-119926356 CAGTTCAAGGACAGGGAGCCTGG - Intergenic
1017129922 6:151099410-151099432 CAGAGCCACTACAGTGAGGCTGG + Intronic
1017441346 6:154466990-154467012 AACAAACAGGACAGGCAGGCAGG + Intronic
1018080159 6:160252575-160252597 AAGAAACAGGACAGGAAGGGTGG + Intronic
1018668392 6:166160540-166160562 CAGAACCAGGATGGGGACCCTGG + Intronic
1018915509 6:168130269-168130291 CAGAGCCAGGACAGGCAGCCAGG + Intergenic
1019420337 7:947895-947917 CAGAGCCAGGGCGGGGAGACGGG - Intronic
1019593001 7:1844963-1844985 CAGAAGGAGGACAGGGGTGCGGG + Intronic
1019656141 7:2197108-2197130 CAGAAGCTGGACAGGTTGGCAGG - Intronic
1019869635 7:3747824-3747846 CAGACCCTGTACAGGGAGGCTGG + Intronic
1020005047 7:4778491-4778513 AAGAAACAGGACATGGAGTCTGG + Intronic
1020488335 7:8747206-8747228 CAGAACCTGGACTGGGATTCAGG + Intronic
1021821335 7:24500579-24500601 CAGAAACAGGACAGATAGCCGGG - Intergenic
1021994483 7:26166491-26166513 CAGAACCAGGATTTGGCGGCAGG - Intronic
1022017473 7:26363907-26363929 CAGAACCAGGACTGGAATTCCGG + Intronic
1023333960 7:39149028-39149050 AAGATCCAGGAGAGGGAGGGAGG + Intronic
1023556624 7:41430118-41430140 GAGAAACAGGAGAGGAAGGCTGG - Intergenic
1024270124 7:47635720-47635742 CAGGGCCAGGACAGGGAAGGAGG + Intergenic
1024399886 7:48912313-48912335 CAGAGCCATGACACAGAGGCTGG - Intergenic
1024626873 7:51215428-51215450 CAGAAACATCACAGGGAGGTTGG + Intronic
1026027951 7:66762292-66762314 TAGAAATAGGACATGGAGGCTGG + Intronic
1026766043 7:73160525-73160547 CAGACCCGGGACAGGGTCGCTGG - Intergenic
1027042518 7:74970221-74970243 CAGACCCGGGACAGGGTCGCTGG - Intronic
1027081125 7:75232136-75232158 CAGACCCGGGACAGGGTCGCTGG + Intergenic
1027409489 7:77900102-77900124 CATAACCAGGAAGGGGAGGAGGG - Intronic
1027604212 7:80280121-80280143 CAGATCAAGGAAAGGGAGGGTGG + Intergenic
1027895660 7:84040578-84040600 GAGAGCCATGTCAGGGAGGCCGG + Intronic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1029115966 7:98237214-98237236 CACACGCAAGACAGGGAGGCAGG - Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1029977285 7:104846753-104846775 CAGAGCCAGGACAGGGACCTGGG - Intronic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1032017247 7:128388089-128388111 AAGAAAGAGGACAGGGAAGCAGG + Intergenic
1032456102 7:132074704-132074726 CAGTGGCATGACAGGGAGGCCGG + Intergenic
1032585159 7:133139681-133139703 CAGAACTAGGATAGGGGAGCTGG - Intergenic
1032992523 7:137409730-137409752 TAGAAACAGCACAGGAAGGCAGG - Intronic
1033351998 7:140569441-140569463 CAGGACAAGGATGGGGAGGCAGG + Intronic
1034052257 7:147995807-147995829 AAGAATTCGGACAGGGAGGCCGG - Intronic
1034110738 7:148535446-148535468 CAGAAACTGAACAGGGAAGCCGG + Intergenic
1034983707 7:155494694-155494716 CAGTTCCAGGACAGGGAACCTGG - Intronic
1034983727 7:155494766-155494788 CAGTTCCAGGACAGGGAACCTGG - Intronic
1035608702 8:946917-946939 CGGCAGCAGGACAGGGCGGCCGG - Intergenic
1036181459 8:6588836-6588858 CAGCACCACGACAGGCAGGCTGG + Intronic
1037834416 8:22207665-22207687 GAGAACCAGGCCTGGGGGGCAGG + Intronic
1037876491 8:22551420-22551442 CGGAGCCAGGACAAGGGGGCAGG - Intronic
1038762413 8:30396497-30396519 CAGAACGAGGAGAGGGATGTGGG + Intronic
1038777840 8:30546915-30546937 AAGAGCCAGGCCTGGGAGGCAGG - Intronic
1040059628 8:43093360-43093382 CAGAAGCCAGACAGGGAGACTGG + Intergenic
1040798935 8:51319965-51319987 CAGGACTGGGACAGGGAGCCGGG + Exonic
1041163268 8:55066531-55066553 CACAACCAGGAAGGGGAGGGAGG - Intergenic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1041446218 8:57953719-57953741 CAGAATCATGACAGGAAGGTGGG - Intergenic
1042898278 8:73694883-73694905 CAGCACCTGCACAGGGAGGGAGG + Intronic
1047204916 8:122795354-122795376 CAGGGCTAGGCCAGGGAGGCAGG - Intronic
1047711919 8:127561103-127561125 CACAACAAGCATAGGGAGGCGGG + Intergenic
1048001419 8:130382468-130382490 GAGAAGCAGAACAGGGAGGAAGG + Intronic
1048195269 8:132327491-132327513 CAGAGCCAGGACAGGGTCCCTGG - Intronic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1049098138 8:140560804-140560826 CAAAGCCAGGACAGGGAGTCTGG - Intronic
1049137684 8:140918970-140918992 TTGTACCAGGACAGGGAGGCAGG - Intronic
1049238120 8:141522911-141522933 GAGAACCAGGATAGGCACGCAGG + Intergenic
1049257015 8:141619571-141619593 GGGCACTAGGACAGGGAGGCAGG + Intergenic
1049340456 8:142109566-142109588 CAGAACCAGGGCAAAGAGCCTGG + Intergenic
1049388624 8:142356917-142356939 CAGCCCCAGGACAGGAAGGGGGG + Intronic
1049505502 8:142994293-142994315 CAGGACCAGGAGTGTGAGGCTGG + Intergenic
1049584291 8:143425808-143425830 CAGAACCAGAGCAGGCAGGCAGG - Intronic
1049675536 8:143887311-143887333 CAGCACCGGGGCAGGGAAGCAGG + Intergenic
1049750723 8:144282414-144282436 CAGGCCCAAGGCAGGGAGGCTGG + Intronic
1049764894 8:144350591-144350613 CAGAACTGGGGCAGGGAGGAGGG - Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050044137 9:1525975-1525997 CAGAACCAAGGAAGGGAGGAAGG + Intergenic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1051016467 9:12481648-12481670 CAGAACAAAGACAGGTCGGCAGG + Intergenic
1052824690 9:33166635-33166657 CTGATCCAGAAGAGGGAGGCTGG + Intronic
1052828721 9:33197438-33197460 CAAGGCCAGGACTGGGAGGCTGG + Intergenic
1052943574 9:34149453-34149475 CAGAACCAGGCCAGGAACGGTGG - Intergenic
1053000255 9:34574013-34574035 AAGCTCCAGGACAGGGAGGAGGG + Intronic
1053315994 9:37052328-37052350 CAGAGACTGGTCAGGGAGGCTGG + Intergenic
1056786287 9:89594806-89594828 CAGACCCAGGAAAGGGAAGGAGG - Intergenic
1056986951 9:91372090-91372112 GAGAACATGAACAGGGAGGCAGG - Intergenic
1057242414 9:93423211-93423233 CAGCAGCAGGATAGGGAAGCTGG + Intergenic
1057242731 9:93426515-93426537 TAGAAACAGGACATGGAGGCAGG - Intergenic
1057857445 9:98612250-98612272 CAGAACTAGGATATGGGGGCTGG + Intronic
1058849290 9:108994938-108994960 AACAACCATGAGAGGGAGGCTGG + Intronic
1059391361 9:114001522-114001544 CAGAACAGGGACAGGGACCCAGG + Intronic
1060110706 9:120904566-120904588 CAGAAACAGGACCGGGTGGAAGG - Exonic
1060367535 9:123033626-123033648 CAGAACTAAGACACGGAGGGAGG - Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060546659 9:124465968-124465990 AAGATCCAGGGCAGGGAGCCAGG - Intronic
1060788419 9:126468631-126468653 CTGAACCAGGCGAGGGACGCTGG - Intronic
1061088284 9:128411955-128411977 CAGAACCAGGAGTGGGGTGCGGG + Intronic
1061664699 9:132153728-132153750 CAGAACCAAGAGAGGAAGTCGGG + Intergenic
1061745086 9:132733765-132733787 CAGAGCCAGGAAAGGGAGAAAGG + Intronic
1061817689 9:133206504-133206526 CAGCACCAGGACAGGGGGAGAGG + Intronic
1062170761 9:135133457-135133479 CAGGACCAGGACAGGGGGCTTGG + Intergenic
1062287526 9:135779645-135779667 TGGAACCAGGAGATGGAGGCAGG + Intronic
1062325540 9:136010835-136010857 CAGAACAAGGACAGGGTGTGGGG + Exonic
1062360890 9:136187571-136187593 CCCAACCAGGACAGGGAGGGAGG + Intergenic
1062513981 9:136922886-136922908 GAGGACTAGGACAGGGAGGATGG + Intronic
1062697933 9:137884901-137884923 GAGAAACAGAAGAGGGAGGCGGG - Intronic
1185477492 X:424219-424241 GAGAACCGAGACAGGGAGGCAGG + Intergenic
1185558639 X:1041157-1041179 CAGAGGCCGGGCAGGGAGGCGGG + Intergenic
1187007184 X:15244039-15244061 TGGAACCAGGACAGTGATGCTGG + Exonic
1187193724 X:17060738-17060760 CAGAACCGGGGTAGAGAGGCTGG + Intronic
1187249729 X:17586077-17586099 CAGAACCAAGACAAGGAGATGGG - Intronic
1189014995 X:37087736-37087758 CAGAACGAGGAGAGGGATGTGGG + Intergenic
1189198068 X:39168285-39168307 CAGGTCCAGGACACTGAGGCAGG - Intergenic
1189414711 X:40803770-40803792 CCGAAGCTGGACAGGGAGGTTGG + Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190597850 X:52065065-52065087 CAGGCCCAGGCCAGGCAGGCAGG + Intronic
1190602793 X:52109410-52109432 GAATACTAGGACAGGGAGGCAGG - Intergenic
1190610974 X:52189008-52189030 CAGGCCCAGGCCAGGCAGGCAGG - Intronic
1191019285 X:55842428-55842450 GAGAACCTGGAAAGGGTGGCTGG + Intergenic
1192940000 X:75902146-75902168 CAGAATCAGAACATGGAGGTTGG - Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1194674993 X:96783683-96783705 CAGAATCAAGACTGGGAGGAGGG - Intronic
1195723925 X:107894058-107894080 CTGAACCAGATGAGGGAGGCAGG - Intronic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197587999 X:128373592-128373614 CAGGAGCAAGCCAGGGAGGCAGG - Intergenic
1197620196 X:128739277-128739299 CAGAGTCAGGACAGGGACCCAGG - Intergenic
1198653335 X:138887752-138887774 AATAACCTTGACAGGGAGGCAGG - Intronic
1199142923 X:144333448-144333470 CTGAAGCTGGACAGGGAGGTTGG + Intergenic
1201335832 Y:12878952-12878974 CACCTCCAGGACAGGGCGGCTGG - Intergenic