ID: 1092276182

View in Genome Browser
Species Human (GRCh38)
Location 12:7062510-7062532
Sequence ATGCTGAGCCTACCATGTAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092276179_1092276182 3 Left 1092276179 12:7062484-7062506 CCTGTTTTCACTTTTGGCATGGG 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1092276182 12:7062510-7062532 ATGCTGAGCCTACCATGTATGGG 0: 1
1: 0
2: 0
3: 3
4: 99
1092276176_1092276182 27 Left 1092276176 12:7062460-7062482 CCTCTGTTTTTTCAGGTGCATTG 0: 1
1: 0
2: 2
3: 21
4: 241
Right 1092276182 12:7062510-7062532 ATGCTGAGCCTACCATGTATGGG 0: 1
1: 0
2: 0
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092276182 Original CRISPR ATGCTGAGCCTACCATGTAT GGG Exonic
903870246 1:26428828-26428850 ATGCTGGGCCAACCATTTCTTGG + Exonic
907741996 1:57175777-57175799 ATGCAGAGCGTACCAGGTACTGG + Intronic
910154378 1:84197138-84197160 ATTCTGACTCTACCATTTATTGG - Intronic
912229851 1:107780091-107780113 ATCCTCAGCTTACCATTTATTGG + Intronic
912869037 1:113286441-113286463 CTGCTGAGCCTAGCATATCTGGG + Intergenic
1064333525 10:14416683-14416705 ATGGTCAGCCTACCTTGTCTAGG + Intronic
1071702262 10:87952273-87952295 ATTCTCATCCTTCCATGTATTGG + Intronic
1073262226 10:102199240-102199262 AGGCTTATCCTACCATGTAGGGG + Intergenic
1081237187 11:40659583-40659605 ATGTTGAGACTACCAGCTATGGG + Intronic
1082815433 11:57505113-57505135 ATGCTGTGCATACCACATATTGG - Intronic
1085349162 11:75787539-75787561 GTCCTGAGCCTTCCATGTGTGGG + Intronic
1086756230 11:90566223-90566245 ATACTGAGCCTAACCTGGATGGG - Intergenic
1088752670 11:112857869-112857891 AGGCTGAGGCCACCATGTCTAGG - Intergenic
1089758350 11:120703838-120703860 ATCCTGTACCTACCATGTATAGG - Intronic
1092276182 12:7062510-7062532 ATGCTGAGCCTACCATGTATGGG + Exonic
1095106995 12:38246175-38246197 AAGCTGATGATACCATGTATTGG + Intergenic
1096371085 12:51069646-51069668 ATACTGAGCGTACTATGTACAGG + Intronic
1096769962 12:53928759-53928781 ATGCTGAAGCTACCAAGTAAAGG + Intergenic
1098484228 12:71001934-71001956 ATGGTCAGCCTACTATGTAAAGG + Intergenic
1098611759 12:72467455-72467477 ATGCTGAGTCTAAAATGTAGCGG + Intronic
1100955380 12:99902405-99902427 GTGCTGAGCCTTGCAGGTATGGG + Intronic
1102464695 12:113121664-113121686 ATGAAGCGCCTACCATGTACTGG + Intronic
1102933597 12:116879909-116879931 AGGCTGAGCCCACCATAGATGGG - Intronic
1103025275 12:117568703-117568725 ATGATGATGCTATCATGTATTGG - Intronic
1109317606 13:60768913-60768935 ATGCTGACCATACCAAGTACTGG - Intergenic
1109573556 13:64224064-64224086 ATCCTGAGCTAACTATGTATTGG + Intergenic
1110634784 13:77754125-77754147 ATGCTCAGCCTCCCAAGTTTGGG - Intronic
1111277360 13:85967382-85967404 GTGCTGAGTCGACCATGTACAGG + Intergenic
1119838844 14:77775327-77775349 AAGATGAGCCTATCAAGTATTGG - Intergenic
1120502077 14:85309665-85309687 TTACTGAGCCTACCACGTGTTGG + Intergenic
1125291634 15:38154986-38155008 ATGCTGAGGCTACGTTGGATTGG - Intergenic
1126900463 15:53309306-53309328 AGGATCAGCCTCCCATGTATGGG - Intergenic
1128388824 15:67169041-67169063 ATCCAGTGCCTACCATGTAGCGG + Intronic
1131826231 15:96324128-96324150 ATGCTGTGCCCCCCAAGTATGGG + Intergenic
1133455967 16:5942929-5942951 GTGCTGAGCCTACACTGTCTCGG + Intergenic
1137307700 16:47221055-47221077 ATGAAGAGCCTACCAGGTACTGG + Intronic
1138452129 16:57099540-57099562 AAGCTGACCATACCATGTGTTGG - Intronic
1147215209 17:38895100-38895122 ATTATGTGCCTACCATGTGTTGG - Intronic
1148492645 17:48033222-48033244 AGGATGAGCCCACCACGTATAGG + Exonic
1160477606 18:79206952-79206974 ATGCTGAGACTTTCATGAATGGG - Exonic
1161245647 19:3250098-3250120 ATGCTGAAGCCACCATGTTTTGG - Intronic
926039420 2:9660779-9660801 GTGCTAAGCCTCCCATGAATTGG - Intergenic
928213545 2:29342019-29342041 ATATTCAGCCTACTATGTATTGG + Intronic
930449327 2:51514512-51514534 ATTCTCAGCCTGCCATGTCTAGG - Intergenic
939461710 2:142504668-142504690 ACGCTGAGCCAACCCTGTACAGG + Intergenic
940203479 2:151176563-151176585 GTGCTGAGACCACCATGTGTAGG - Intergenic
944945767 2:204682789-204682811 ATGCTGTGACTACCATGAACTGG - Intronic
945577881 2:211554820-211554842 TAACTGACCCTACCATGTATGGG - Intronic
1173435047 20:43024801-43024823 GTGATGAGCCTAGCATGTGTTGG - Intronic
1174302548 20:49593013-49593035 GTGGTGAGCCTGCAATGTATTGG + Intergenic
1174425035 20:50426161-50426183 ATGCTCAGGCTACCATATTTTGG - Intergenic
1176698346 21:10008798-10008820 ATATTGACCCTACCAGGTATAGG + Intergenic
1177626372 21:23665692-23665714 ATTCTGAGCCTGTCATATATGGG - Intergenic
1178693095 21:34766302-34766324 ATGGAGAGGCTGCCATGTATGGG + Intergenic
1180825187 22:18856682-18856704 ATGCTGAGCCTCCCCTGCCTTGG - Intronic
1181187543 22:21117865-21117887 ATGCTGAGCCTCCCCTGCCTTGG + Intergenic
1181211655 22:21292628-21292650 ATGCTGAGCCTCCCCTGCCTTGG - Intergenic
1181375863 22:22457496-22457518 ATGCTGAGCCTGATATGTTTGGG - Intergenic
1181397852 22:22634258-22634280 ATGCTGAGCCTCCCCTGCCTTGG + Intergenic
1181500598 22:23313628-23313650 ATGCTGAGCCTCCCCTGCCTTGG + Intronic
1181651555 22:24261800-24261822 ATGCTGAGCCTCCCCTGCCTTGG - Intergenic
1181705820 22:24648939-24648961 ATGCTGAGCCTCCCCTGCCTTGG + Intergenic
1203215298 22_KI270731v1_random:2804-2826 ATGCTGAGCCTCCCCTGCCTTGG + Intergenic
1203275332 22_KI270734v1_random:82585-82607 ATGCTGAGCCTCCCCTGCCTTGG - Intergenic
949269637 3:2199752-2199774 ATTCTCTGCATACCATGTATTGG - Intronic
951595883 3:24317673-24317695 ATTCTTAGACTACCATATATGGG + Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
954636000 3:52071213-52071235 AGGCTGAGCCTACCAGGCAATGG + Intergenic
955828771 3:62979344-62979366 ATGATTAACCTACTATGTATTGG - Intergenic
957862559 3:85974079-85974101 AGGCTGAGCCTACAGTTTATTGG + Intronic
968359809 3:198138958-198138980 ATCCTGAGCCTTCCATGTTGGGG - Intergenic
977805360 4:101291398-101291420 GTGATGAGCATACCATGTGTTGG - Intronic
985266686 4:188157787-188157809 TTGCTGAGGTTACCATGTACTGG - Intergenic
985424218 4:189812660-189812682 AGGCTGAGCATCCCATGGATAGG - Intergenic
987938225 5:24497332-24497354 ATGCTGAGCCTGCCAAGCAGAGG + Intronic
988051084 5:26031784-26031806 CTGCTGACCATACCATGTGTTGG - Intergenic
990227473 5:53671495-53671517 ATGCTGAGCTTAAGATGTTTAGG - Intronic
992462850 5:76978422-76978444 ATGCTGAGTCTACTCTGTCTGGG + Intronic
992989209 5:82266794-82266816 ATGCTGAGAATACCAAGTACTGG - Intronic
993018143 5:82560499-82560521 ATGATGAGCCAATCATGAATTGG + Intergenic
993374079 5:87128729-87128751 GTGCTGAGCCTGTCAGGTATGGG + Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
999589652 5:153130989-153131011 ATCGTGAGACTATCATGTATTGG - Intergenic
1000255435 5:159533948-159533970 ATGCTGACTCTACCACTTATTGG + Intergenic
1001121624 5:168985589-168985611 ATGCTGCGCCCACCATGCATAGG - Intronic
1004897343 6:20161551-20161573 ATCCAGTGCCTACCATGTGTTGG + Intronic
1008395132 6:50997603-50997625 GTGCTGAGGCTGCAATGTATTGG + Intergenic
1008544388 6:52573011-52573033 ATTCTGAGCCTATCATTTGTAGG - Intronic
1009991004 6:70842826-70842848 ATGCTGCACCTTCCATGTGTTGG - Intronic
1019260178 7:77690-77712 ATCCTGAGCCTTCCATGTTGGGG + Intergenic
1023183234 7:37507455-37507477 GTGCTGAGCTTTCCATGTCTGGG + Intergenic
1026306808 7:69149527-69149549 ATACTGAGTCCACCAGGTATGGG + Intergenic
1028486174 7:91359866-91359888 ATCCTAAGCCTACCATGTGACGG + Intergenic
1034315957 7:150133515-150133537 ATGCTGAGCTTATCAGGGATGGG + Intergenic
1049921378 9:367927-367949 ATGCTGAGACTTCCATTCATGGG - Intronic
1054316397 9:63592586-63592608 ATATTGACCCTACCAGGTATAGG + Intergenic
1058643151 9:107106441-107106463 ATGCAGACCCTACCCTGTAAAGG - Intergenic
1062744514 9:138202779-138202801 ATCCTGAGCCTTCCATGTTGGGG - Intergenic
1186308815 X:8294638-8294660 AGACTGAGACTACCATGAATAGG + Intergenic
1186925060 X:14324526-14324548 ATGCTGACCCTACTGTGCATGGG + Intergenic
1193021284 X:76796589-76796611 ATGATGAGCCTCCCATGTTATGG - Intergenic
1193022269 X:76802944-76802966 ATGATGAGCCTCCCATGTTATGG - Intergenic
1195472904 X:105253102-105253124 ATGCTGAGTCATTCATGTATTGG - Intronic