ID: 1092276232

View in Genome Browser
Species Human (GRCh38)
Location 12:7062897-7062919
Sequence CAGGAGACACTGAAGAAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 512}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092276228_1092276232 16 Left 1092276228 12:7062858-7062880 CCTAGATTTTTTTTTTGTGACTC 0: 1
1: 0
2: 4
3: 73
4: 837
Right 1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG 0: 1
1: 0
2: 4
3: 45
4: 512
1092276227_1092276232 21 Left 1092276227 12:7062853-7062875 CCTTTCCTAGATTTTTTTTTTGT 0: 1
1: 2
2: 27
3: 610
4: 6071
Right 1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG 0: 1
1: 0
2: 4
3: 45
4: 512
1092276226_1092276232 22 Left 1092276226 12:7062852-7062874 CCCTTTCCTAGATTTTTTTTTTG 0: 1
1: 3
2: 18
3: 300
4: 3023
Right 1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG 0: 1
1: 0
2: 4
3: 45
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092276232 Original CRISPR CAGGAGACACTGAAGAAGGG AGG Exonic
900686852 1:3954282-3954304 CAGGAGAGGCTGGAGCAGGGCGG - Intergenic
901051454 1:6427711-6427733 CACGTGACACCGAGGAAGGGTGG + Intronic
901595571 1:10382837-10382859 GGGGAGAAACAGAAGAAGGGAGG + Intergenic
902664847 1:17930363-17930385 CAGGAGACAGGGAGGAAGGAAGG - Intergenic
902939688 1:19791760-19791782 CAGGAGTCACTGACGGAAGGAGG + Intronic
903379977 1:22890039-22890061 CAGGAGAGACTGCAAAATGGTGG + Intronic
903393551 1:22982139-22982161 GAGGAGACACTGCAGAAGGAGGG + Intergenic
903545858 1:24123102-24123124 CAGGACACATTGAAGTGGGGTGG - Intronic
904413734 1:30342322-30342344 CAGAAGACGGTGAAGAAGTGAGG - Intergenic
904445490 1:30570342-30570364 CAGAAGCCACTGCAGGAGGGTGG + Intergenic
904824374 1:33265140-33265162 CAGGAGAAATAGAAGTAGGGAGG + Intronic
904859669 1:33526177-33526199 AAGGAGTGACAGAAGAAGGGAGG + Intronic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
906246121 1:44275531-44275553 CAGGAGAAACTGCCAAAGGGAGG - Intronic
906716990 1:47977733-47977755 CAGGAGACATTGGAGGAGAGAGG + Intronic
907019326 1:51050762-51050784 AAGGAGTCACTGAAGATTGGTGG - Intergenic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907334925 1:53693696-53693718 CTGGCGGCACTGAAGAGGGGAGG + Intronic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
907988562 1:59556765-59556787 CAGCAGACACTCAAAAATGGTGG + Intronic
908457562 1:64319054-64319076 CAGGAGATACTTAAGAGGTGGGG - Intergenic
908475809 1:64487056-64487078 AAGAAGGCACTGAAGAAAGGTGG + Intronic
909209831 1:72808864-72808886 AAAGAGGCACTGAAGAAGGTAGG - Intergenic
909338387 1:74503443-74503465 CAGAAGACACTGCTGAAGTGAGG - Intronic
911227782 1:95326203-95326225 CAGGAGACACTGAAATTGTGCGG + Intergenic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
912048757 1:105495443-105495465 CTGGGGACACTGAAGAAGCAAGG - Intergenic
912865344 1:113251347-113251369 CACGAGTGACTGGAGAAGGGTGG - Intergenic
912899389 1:113631228-113631250 AAAGAGACACTGAAGAAGATAGG - Intronic
913040003 1:115012682-115012704 CAGGACACACTGAAGCAAGCAGG - Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
914855280 1:151346216-151346238 TCGGAGCCTCTGAAGAAGGGTGG + Exonic
915303206 1:154963109-154963131 CAGGAGGCACTGAGCAAGGGAGG + Exonic
915719469 1:157973725-157973747 AAGGAGACATTGAAGGAGAGTGG - Intergenic
916162385 1:161930980-161931002 CAGGAGAGACTGAACCTGGGAGG - Intronic
916348989 1:163827276-163827298 CAGGAGGAAATGAAGAAGGAGGG - Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916993304 1:170267984-170268006 AAGGAGACACTGAAGAGGGTAGG - Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
918018978 1:180665775-180665797 AAAGAGGCACTGAAGAAGGTAGG - Intronic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
919338046 1:196265574-196265596 TAGGACACACTGTAGAATGGGGG - Intronic
919797463 1:201329862-201329884 CAGGGGACACTGTGGCAGGGTGG + Intronic
921226295 1:213023275-213023297 ATTGAGACAATGAAGAAGGGTGG + Intergenic
922383789 1:225060807-225060829 CAGCAGACACTGCAGAACAGCGG + Intronic
922821188 1:228486999-228487021 CAGGAGTTACTGAAGTAGGAAGG + Intergenic
924516341 1:244769123-244769145 AAGGAGATACTGAAGAGGGTAGG - Intergenic
924833985 1:247629481-247629503 AAAGAGACACTGAAGAAGGTAGG - Intergenic
1062909761 10:1205081-1205103 CAGGAGTCTCTGCAGAATGGCGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064585639 10:16837100-16837122 CAGGAGACAGTGGGGAAGAGGGG - Intronic
1065543750 10:26797618-26797640 CAGCAGACAGTCAAGAAGGAAGG + Intronic
1066215408 10:33281538-33281560 CAGGGGACAATGAGGAAAGGAGG + Intronic
1067749137 10:48958367-48958389 CAGGAGTCACTCAGGGAGGGTGG + Intronic
1068156481 10:53205835-53205857 CAGGAGACAGAGAGCAAGGGTGG - Intergenic
1068311888 10:55289460-55289482 AAGGAGAGAGTGAGGAAGGGAGG + Intronic
1068340279 10:55692850-55692872 TAGGTGGCTCTGAAGAAGGGTGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068948602 10:62755104-62755126 CAGGAGAGAAGGAAGGAGGGAGG + Intergenic
1070464117 10:76702766-76702788 AAGGAGGCACTGAAGAGGGTAGG + Intergenic
1070516454 10:77212664-77212686 CAAGAGACACTGAGCAGGGGAGG - Intronic
1072222299 10:93336780-93336802 CAGGAGAAAAGGAAGAAGGAAGG + Intronic
1072434331 10:95401646-95401668 GAGGAGACGCTGTAGAAGTGGGG + Intronic
1072681511 10:97510697-97510719 CAGGACACACTGAAGAAGTCAGG - Intronic
1074987433 10:118670485-118670507 CAGGACCCAGTGAAGCAGGGTGG + Intergenic
1075049449 10:119171888-119171910 CATCAGACTCTGCAGAAGGGGGG - Intronic
1076044510 10:127280715-127280737 CAGAACACAGTGAAGAATGGTGG - Intronic
1076638452 10:131898781-131898803 CAGGATCCACTGAAGACAGGAGG - Intergenic
1076815432 10:132912321-132912343 CAGGAGAGAGAGAAGAAGAGAGG - Intronic
1077305489 11:1866985-1867007 GAGGAGACACTGAAGCCGCGTGG + Intronic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1077754798 11:5015375-5015397 CAGAAGACACTGAACATGGTAGG - Intergenic
1078456361 11:11478830-11478852 CAGGAGGCACTGAAGAGAGATGG + Intronic
1078579458 11:12527239-12527261 CCGGGGGCACGGAAGAAGGGAGG + Intronic
1079474015 11:20808905-20808927 AAAGAGGCACTGAAGAAGGTAGG - Intronic
1080138753 11:28890028-28890050 CAGGAGACACTTAAGATTGTAGG + Intergenic
1080311329 11:30896513-30896535 CAGGTGATTCTGAATAAGGGTGG - Intronic
1080660568 11:34292862-34292884 AAGGAGTCACTGAGGAAGGTAGG + Intronic
1080769923 11:35331177-35331199 CAGGAGGAAGTGAGGAAGGGAGG - Intronic
1080866323 11:36198623-36198645 CAGGTGAGAGTGAAGAAGGCTGG - Intronic
1081346751 11:41996746-41996768 CATGAGTCACTGATGATGGGAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083528955 11:63398736-63398758 AAAGAGACACTGAAGAGGGTAGG - Intronic
1085008320 11:73115333-73115355 AAAGAGGCACTGAAGAAGGTAGG - Intronic
1085452197 11:76641145-76641167 GAGGCTACACTGAAGTAGGGTGG + Intergenic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085774456 11:79352744-79352766 AAGGAGACAGAGAAGAAGGGAGG + Intronic
1085779302 11:79393938-79393960 AGGGTGACACTGAAGGAGGGAGG + Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086277384 11:85147125-85147147 AAAGAGACACTAAAGAAGGTAGG - Intronic
1086569509 11:88265915-88265937 AAAGAGGCACTGAAGAAGGTGGG + Intergenic
1088274065 11:108065710-108065732 CAAGAGGCACTGAAGAGGGTAGG - Intronic
1088322447 11:108568022-108568044 CAGAATACACTGAAGACAGGGGG + Intronic
1088586875 11:111367182-111367204 CAGGAGGCTCAGAGGAAGGGAGG - Intronic
1088589774 11:111393437-111393459 AAGGACACACTGAAGACCGGTGG + Intronic
1088850644 11:113700522-113700544 TAGGAGGGAATGAAGAAGGGTGG - Intronic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089693077 11:120198665-120198687 CAGGAGACAGAGCAGTAGGGTGG + Intergenic
1090409691 11:126499284-126499306 CAGGAGGCACTAAAGTGGGGCGG - Intronic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1091180071 11:133596368-133596390 CAGAAGGCACGGAGGAAGGGAGG - Intergenic
1091301844 11:134512937-134512959 CAGCAGACACTGAACACAGGAGG + Intergenic
1092213329 12:6662773-6662795 CTGGAGACCCTGGAGAATGGGGG + Intronic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092615652 12:10213305-10213327 CAGGCGGCTCTGGAGAAGGGAGG + Intronic
1093281109 12:17197423-17197445 CAGGTACCACTGAAGAATGGGGG - Intergenic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1094544130 12:31388484-31388506 CAGGAAACATTGAAGATGTGAGG - Intronic
1095042608 12:37459411-37459433 CCGAAGACACAGAAGAAGGCAGG - Intergenic
1095144155 12:38704099-38704121 GAGGAGAGATGGAAGAAGGGTGG + Intronic
1096172340 12:49482296-49482318 CAGGAGATTCCGAGGAAGGGAGG + Intronic
1097154151 12:57000708-57000730 CAGAGGACACTGAACAAGGTGGG + Exonic
1097229200 12:57498884-57498906 CAGGACACAGAGAGGAAGGGAGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098217327 12:68234293-68234315 CAGGAAACAATGATGAAGGCAGG - Intergenic
1098959012 12:76719027-76719049 AAGGAGGCACTGAAGAGGGTAGG + Intergenic
1099046906 12:77732289-77732311 GAGGAGGGACTTAAGAAGGGAGG + Intergenic
1099281044 12:80646585-80646607 CAGGAGACACTCGAGGAGAGTGG + Intronic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101607355 12:106257782-106257804 AAAGAGGCACTGAAGAAGGTAGG + Intronic
1102429337 12:112869756-112869778 CAGGTGACAGTGAAGATAGGAGG + Exonic
1102438545 12:112944283-112944305 CAGGAGGCAGGGAAGAAGAGCGG - Intronic
1102535125 12:113575637-113575659 CAGGAGACAGGGAGGAAGTGAGG + Intergenic
1102542735 12:113634461-113634483 CAGGAAAAACTGGAAAAGGGGGG - Intergenic
1103164678 12:118760294-118760316 GAGGAGACAATGTGGAAGGGTGG + Intergenic
1103631592 12:122266135-122266157 CAGGAGGCAGCGATGAAGGGGGG - Intronic
1103791748 12:123477017-123477039 CAGGAGAGACTGAAGCAGAGGGG + Intronic
1104547362 12:129724334-129724356 CAGGAGACATAGAACATGGGTGG + Intronic
1104668792 12:130666768-130666790 AAGGAGAGAGGGAAGAAGGGAGG + Intronic
1104835864 12:131789950-131789972 GAGGTGACACTGAAGCAGCGCGG + Intronic
1105028605 12:132867086-132867108 AAGGAGCCTCTGAAGAAGGAAGG + Intronic
1105562301 13:21505329-21505351 CAGAAGGCACTGATGCAGGGCGG + Intronic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1105892527 13:24691749-24691771 CAGGAGAGACTGAGGAGGAGGGG - Intronic
1107637673 13:42409044-42409066 GAGAAGACACTGAAGGTGGGAGG - Intergenic
1108137823 13:47384913-47384935 AAAGAGACACTGAAGAAGATAGG + Intergenic
1109512708 13:63400633-63400655 CAGGAGACACTAGAAAAGGAAGG - Intergenic
1111572205 13:90103686-90103708 AAAGAGACACTGAAGAAGGTAGG - Intergenic
1112176837 13:97034254-97034276 AAGGAGGCACTGAAGAAGGTAGG + Intergenic
1113244447 13:108378370-108378392 CAAGAGGCACTGAAGAGGGTAGG - Intergenic
1113305535 13:109074482-109074504 CAGGAGACAGAGAGCAAGGGGGG + Intronic
1113518221 13:110919387-110919409 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1113558485 13:111257666-111257688 AAGGAGAAACTGAAGAGGGTAGG + Intronic
1113660443 13:112103797-112103819 CAGGAAACACGGCAGAGGGGAGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114209168 14:20601023-20601045 CTGCAGCCACTGATGAAGGGAGG - Intronic
1114255935 14:21001389-21001411 GAGGGGACTCTGAAGGAGGGCGG + Exonic
1116079291 14:40153500-40153522 AAAGAGGCACTGAAGAAGGCAGG + Intergenic
1116119639 14:40705971-40705993 CAGGACACACTGAAGCAAGGGGG + Intergenic
1118615719 14:67573273-67573295 CAGGAGTCACTGGAGAAGTCGGG + Exonic
1119344235 14:73909049-73909071 TGGGAGTCACTGAAGAAGGTAGG + Intronic
1119444962 14:74655399-74655421 CAGGAGAAACTATTGAAGGGGGG + Intronic
1119535803 14:75401598-75401620 CAGGAGCCAGGGAAGAAGGGCGG + Intergenic
1119558651 14:75572430-75572452 CAGGAGAGGCTGCAGCAGGGTGG + Intergenic
1119744518 14:77034277-77034299 CAGGAGAGAGGGAGGAAGGGAGG + Intergenic
1121270899 14:92637546-92637568 CAGGACCCTCTGGAGAAGGGAGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121981500 14:98458364-98458386 AAGAAGACACTGAAGAGGAGAGG + Intergenic
1122006650 14:98710868-98710890 TAGGAGACATAGAAGATGGGTGG - Intergenic
1122155082 14:99746030-99746052 CAGTAGGCACTGAAAAATGGCGG + Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122410123 14:101521540-101521562 TAGGAGACACGGGAGAAGGGAGG + Intergenic
1123011930 14:105353375-105353397 CAGGGGACAGTGATGAGGGGGGG - Intronic
1123011943 14:105353407-105353429 CAGGGGACAGTGATGAGGGGGGG - Intronic
1124932223 15:34131775-34131797 TAGGAGAAAATAAAGAAGGGTGG - Intergenic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1126686985 15:51257004-51257026 AAGGAGACACTTAAGATTGGAGG - Intronic
1127347789 15:58118396-58118418 CAGGAGACACTGAAGCACATAGG - Intronic
1127710142 15:61589087-61589109 CAGGAGAGAGTGAGCAAGGGGGG + Intergenic
1127788661 15:62378822-62378844 GAGGAAATATTGAAGAAGGGAGG + Intergenic
1127899810 15:63332788-63332810 GAGAAGACACTGAGGAGGGGAGG + Intronic
1128780920 15:70358155-70358177 CAGGAGACACTGAAGGAGACTGG + Intergenic
1129463615 15:75712075-75712097 GAGGAGAGAATGAAGAGGGGAGG + Intronic
1129721273 15:77879327-77879349 GAGGAGAGAATGAAGAGGGGAGG - Intergenic
1130321853 15:82848526-82848548 TAGGAGAAACTGAAAAAGGCAGG + Intronic
1130996614 15:88907810-88907832 GAGGGGACACTGAGGAAGAGGGG - Intronic
1131439627 15:92449163-92449185 CAGTAGACACTGGAGAAGAAGGG - Intronic
1132592197 16:730962-730984 GAGGTGACACTGGAGAAGGAGGG - Exonic
1132787640 16:1666772-1666794 CCGGAGCCACTGACGAAAGGTGG + Intronic
1133064248 16:3194911-3194933 CAGAAGTCACAGAAGAAGGGCGG - Intergenic
1133221824 16:4322148-4322170 CAGGGGATCCTGAGGAAGGGGGG + Intronic
1134354971 16:13473571-13473593 CAGAAGAAACTGAGGAAGGGTGG - Intergenic
1136301161 16:29335238-29335260 TGGGAGACACTGTAGGAGGGTGG + Intergenic
1136533326 16:30884216-30884238 CAGGAGAGAGTCAAGAATGGGGG + Intronic
1139505718 16:67397217-67397239 CAGCACCCACTGAAGCAGGGCGG - Intronic
1140280841 16:73554011-73554033 CAGGAGTCACAGTACAAGGGGGG + Intergenic
1140726380 16:77816798-77816820 CAGGAAGGAGTGAAGAAGGGAGG + Intronic
1140813644 16:78601202-78601224 CAGGTGGCACTGAAGAAGAAAGG - Intronic
1142056807 16:88002863-88002885 CATGAGCAACTGAAGAAGGACGG - Intronic
1142122980 16:88396434-88396456 GAGGAGACCCTTATGAAGGGAGG + Intergenic
1142122999 16:88396488-88396510 GAGGAGACCCTCATGAAGGGAGG + Intergenic
1142123097 16:88396785-88396807 GAGGAGACCCTTGAGAAGGGAGG + Intergenic
1142123147 16:88396947-88396969 GAGGAGACCCTCATGAAGGGAGG + Intergenic
1142624817 17:1185284-1185306 CCGGAGGCATTGAAGAAGTGGGG - Intronic
1143704263 17:8686245-8686267 AAGGAGACAGTGTAGGAGGGAGG - Intergenic
1144520265 17:15948240-15948262 CAGATGACAGTGTAGAAGGGAGG + Intronic
1144670534 17:17130339-17130361 AAGGAGAAAATGAAGAAAGGAGG - Intronic
1144754664 17:17671810-17671832 CAGGACAACCTGAAGAAGGTGGG + Intergenic
1145779320 17:27551907-27551929 CAGGAAGCACTGAAAAAGGATGG - Intronic
1147011534 17:37452971-37452993 CTGGATAATCTGAAGAAGGGAGG - Intronic
1147163220 17:38579593-38579615 GAGGAGAGACTGAAGAAGGGAGG - Intronic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147688492 17:42301018-42301040 CAGGAGAAACTGGGCAAGGGCGG - Intronic
1149007204 17:51818585-51818607 CAGGAGTCAGTGAAGTAGTGTGG - Intronic
1149009823 17:51844739-51844761 CAGGCCACACTCAAGAAGAGGGG - Intronic
1149024869 17:52016037-52016059 GAGTAGACATTGGAGAAGGGTGG + Intronic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149382200 17:56105528-56105550 CAGGAGGCAGGGAAGGAGGGAGG - Intergenic
1149814222 17:59707255-59707277 AAGGAGAAAATGAAGAAGGTGGG + Intronic
1149992837 17:61392347-61392369 CAGGAGAGACTGTAGAAGCTCGG + Exonic
1152092101 17:78252741-78252763 CAGGAGGCTCTGAGGAGGGGGGG - Intergenic
1152268875 17:79312214-79312236 CAGGAGACAAAGAAGAGGGCTGG + Intronic
1152366036 17:79857000-79857022 TAGAAGAGACTGAAGAGGGGAGG + Intergenic
1152541683 17:80979852-80979874 CGGGAGAAACTGAGGCAGGGAGG - Intergenic
1152621288 17:81366157-81366179 CAGGAAGGACTGAAGAACGGGGG - Intergenic
1152700100 17:81814409-81814431 CAGGAGGCTCAGAGGAAGGGCGG - Intergenic
1152732718 17:81980514-81980536 CAAGAGAGACTGGAGAAGGATGG - Intronic
1153474364 18:5481672-5481694 AAGGAGACACTGAATCAGAGTGG + Intronic
1153789002 18:8560839-8560861 AAGGAGAAACGGAGGAAGGGAGG - Intergenic
1155267254 18:24106061-24106083 CAGGTCACACTGGAGTAGGGTGG - Intronic
1155338329 18:24788101-24788123 CAGGAGAGAAAGAGGAAGGGGGG - Intergenic
1155796132 18:30039245-30039267 AAGAAGACACTGAAGGTGGGAGG + Intergenic
1156021690 18:32606636-32606658 AAGGAGGCACTGAAGAAGGTAGG - Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157439110 18:47696800-47696822 GAGGAGACAGTGAAGAGGAGTGG - Intergenic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1158522462 18:58183118-58183140 CAGCAGTCACTGAAGAAATGAGG + Intronic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159525779 18:69586962-69586984 CAGGTGACACTGAATAAGCAGGG + Intronic
1160035468 18:75297638-75297660 TAGGAGACAGTGAGGAAGTGTGG - Intergenic
1160298828 18:77660470-77660492 AAGGAGGCACTGAAGAGGGTCGG + Intergenic
1160405045 18:78639647-78639669 CAGGAGGTACTGCAGAGGGGCGG - Intergenic
1161719523 19:5895276-5895298 CAGGAGAGCCTGGAGAAGTGGGG - Intronic
1162575753 19:11497844-11497866 CTGGAGAAACCTAAGAAGGGAGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164656108 19:29923223-29923245 CAGCAGTCACTGAACAGGGGTGG - Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1165281600 19:34802877-34802899 AAGGAAAAACTGAAGAAGGGAGG + Intergenic
1166878656 19:45913843-45913865 TAGGAGATACTGAACAAGGCTGG - Exonic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167582318 19:50352561-50352583 AAGGACACACTGAAGAGGGTAGG - Intronic
1167803329 19:51760916-51760938 CATGAAACTCTGAAGAAGGAAGG + Intronic
925204785 2:1996661-1996683 CAGCCCACACTGAAGCAGGGTGG - Intronic
925204825 2:1996868-1996890 CAGTCCACACTGAAGCAGGGCGG - Intronic
925204851 2:1997002-1997024 CAGCCCACACTGAAGCAGGGCGG - Intronic
925204877 2:1997136-1997158 CAGCCCACACTGAAGCAGGGTGG - Intronic
925217918 2:2113067-2113089 CAGGAGACAGTGAAGCTGGCAGG - Intronic
925484859 2:4316638-4316660 AAAGAGACACTGAAGAGGGTAGG - Intergenic
926589878 2:14729317-14729339 GAAGAGACAGTGAAGAGGGGCGG - Intergenic
927779291 2:25926528-25926550 AAGGAGAAAATGAAAAAGGGAGG + Intergenic
927981986 2:27380240-27380262 CAGTATCCACTGAAGAGGGGAGG + Exonic
928715667 2:34056808-34056830 AAAGAGGCACTGAAGAAGGTAGG - Intergenic
928738333 2:34319155-34319177 CTGGAGACAGATAAGAAGGGTGG - Intergenic
928864133 2:35896449-35896471 CAAGAGGCACTGAAGATGGTAGG - Intergenic
928943632 2:36752660-36752682 TAGGAGACACTGGAGGAGGAGGG - Intronic
928963664 2:36955560-36955582 GAGAAGAGACAGAAGAAGGGAGG - Intronic
929549117 2:42878243-42878265 CAGCAGACTCTGAGGAAGGGAGG + Intergenic
932042214 2:68311844-68311866 CCTAAGACACTGAAGAATGGCGG + Intronic
933350652 2:81148193-81148215 CAGGAGAGACTGGAGGAGGCAGG + Intergenic
934161870 2:89257452-89257474 CGGAAGACACAGAGGAAGGGAGG + Intergenic
934205412 2:89924910-89924932 CGGAAGACACAGAGGAAGGGAGG - Intergenic
934928846 2:98403933-98403955 AAAGAGACACTGAAGAGGGTAGG + Intergenic
937193942 2:120133342-120133364 AAGGAGGCACTGAAGAGGGTAGG + Intronic
937196666 2:120163551-120163573 CAGGAGATACTGGATAAAGGAGG - Intronic
937198063 2:120177658-120177680 CAGGAGACACTGCTGAACAGAGG + Exonic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
937745113 2:125403243-125403265 AAGGTGACAGTGGAGAAGGGGGG - Intergenic
937964466 2:127492051-127492073 CAGGAGACCCTGAAGCATAGTGG - Exonic
938293005 2:130160239-130160261 CAGGAGCCACTGCAGAGGAGAGG - Intronic
938463552 2:131512726-131512748 CAGGAGCCACTGCAGAGGAGAGG + Intergenic
938655582 2:133429482-133429504 CAGTAGACCTTGAAGGAGGGAGG - Intronic
939522764 2:143252138-143252160 CAGAAGAAACTGAAAAAGGCTGG - Intronic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
941851944 2:170191743-170191765 AAAGAGACACTGAAGAGGGTAGG - Intronic
942486760 2:176447989-176448011 CTTGAGAGACTGAAGATGGGTGG + Intergenic
942603215 2:177662554-177662576 TCGGAGACACTGAGGATGGGAGG + Intronic
943831650 2:192471783-192471805 AAGGAGACACTGAAGAGGGTAGG + Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
947009290 2:225547724-225547746 AAGGAGGCACTGAAGAGGGTGGG - Intronic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
948125344 2:235560936-235560958 CATGAGAAACTGATGGAGGGTGG - Intronic
948760932 2:240190671-240190693 CAGGAGACCCACAGGAAGGGTGG - Intergenic
948841124 2:240649562-240649584 CAGGACAGGCTGAAGAGGGGCGG + Intergenic
1168775671 20:445355-445377 CAGGAGACAATACAGCAGGGTGG + Intronic
1168795695 20:609133-609155 CAGGAGACTGAGAAGAAAGGAGG - Intronic
1169194403 20:3675442-3675464 CAGGAGACACTGCCGAAGAATGG + Intronic
1169623801 20:7540093-7540115 CAAGAGGCACTGAAGAGGGTAGG + Intergenic
1170105829 20:12753716-12753738 CAGGAAACACTGAAGCATGAGGG - Intergenic
1170465120 20:16615768-16615790 CAGGAAACACTGAAGGGGGTTGG - Intergenic
1170919111 20:20659475-20659497 TAGGATATATTGAAGAAGGGAGG - Intronic
1171327739 20:24310581-24310603 CAGGGGAAACTGAGGAAAGGGGG - Intergenic
1172183912 20:33019801-33019823 GAGGGGACAGTGAAGCAGGGAGG - Intronic
1172217529 20:33246852-33246874 CAGTAGACACTGGAGAGGTGAGG + Intergenic
1173079665 20:39853497-39853519 TCTGAGACACTGAAGATGGGAGG + Intergenic
1174408773 20:50320587-50320609 CAGTAGGCACCCAAGAAGGGCGG + Intergenic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1175628702 20:60512742-60512764 CAGGAGACAGGGAAGAAAAGAGG - Intergenic
1176225337 20:63994926-63994948 CAGAAGTCACAGAAGAAGAGTGG + Exonic
1176520357 21:7819549-7819571 CAGGAGACAGTTCAGCAGGGTGG - Exonic
1176938235 21:14892392-14892414 CAGGCGGCACTGAAGCAGTGAGG + Intergenic
1176957623 21:15124324-15124346 CAGGAGACAGGGAAGAAGGAGGG + Intergenic
1177090432 21:16760682-16760704 AAAGAGACACTGCAGAAGGAAGG + Intergenic
1177295154 21:19163671-19163693 CAAGAGGCACTGAAGAGGGTAGG - Intergenic
1177957166 21:27613082-27613104 CAGCGTACACTGAAGAAGTGGGG + Intergenic
1178074206 21:29000418-29000440 CAGGAGCCACGGAAGCGGGGAGG - Intergenic
1178265741 21:31141569-31141591 TTGGAGTCACTGAGGAAGGGAGG - Intronic
1178654380 21:34449561-34449583 CAGGAGACAGTTCAGCAGGGTGG - Intergenic
1179068153 21:38045874-38045896 CAGGATAAACTCAGGAAGGGAGG + Intronic
1179788753 21:43743621-43743643 CAGCAGACCCTGCAGAGGGGTGG - Intronic
1180048409 21:45320357-45320379 GAGCACACACTGAAGATGGGAGG + Intergenic
1180082799 21:45494331-45494353 CAGGAGCCACTGGTGAGGGGAGG - Intronic
1180121332 21:45750406-45750428 CAGGAGTCCAGGAAGAAGGGGGG - Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181362594 22:22349571-22349593 AAGGAGACAAGGAAGAAGAGAGG - Intergenic
1182029974 22:27151014-27151036 CAGGAGAAACTGGAGCAGGTGGG + Intergenic
1182736724 22:32536127-32536149 CAGGAGGCACTGGGGAAGGCTGG + Intronic
1183353659 22:37347277-37347299 CAGGAAATAATGAAGATGGGAGG - Intergenic
1184394691 22:44226212-44226234 CAGGAGAAAGTGAAGGGGGGTGG - Intergenic
949940277 3:9149405-9149427 AAGGAGAGACTGAAGAAGTGGGG - Intronic
950427365 3:12931725-12931747 CTGGAGCTACTGCAGAAGGGAGG - Intronic
951029416 3:17864232-17864254 AAAGAGACACTGAAGATGGTAGG - Intronic
951179864 3:19646845-19646867 CAAGTGAAACTGAAGTAGGGGGG - Intergenic
951379623 3:21967992-21968014 AAAGAGACACTGAAGTAGGTAGG + Intronic
951390663 3:22099683-22099705 CAGCAGACCCTGAAGCATGGCGG + Intronic
952518022 3:34125248-34125270 CAGGAGGCATTGAAGAGGGTAGG - Intergenic
952562480 3:34611405-34611427 CAGGAGAGAATGAAGGAAGGAGG - Intergenic
953373661 3:42410644-42410666 CAGGATATTCTGAAAAAGGGAGG + Intergenic
953381580 3:42476535-42476557 CAGGAGCCTTTGAAGAAGGAGGG - Intergenic
953395891 3:42569454-42569476 CACCAGACACTGAAGCAGCGAGG + Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955518504 3:59751956-59751978 CAGGAAAGACTGGAGAAAGGTGG + Exonic
955664651 3:61337608-61337630 CAGGAGACACTGACGACTGTTGG + Intergenic
955825450 3:62941494-62941516 CAGCAGACACTGAAAAAGCAGGG - Intergenic
955884964 3:63588332-63588354 CAGGAGACACAGTGGAAGGTTGG - Intronic
956400929 3:68878958-68878980 TAAGAGACACAGAAGAAAGGTGG - Intronic
957211097 3:77259926-77259948 CAAGAGACAATAAAGAAGGCTGG - Intronic
957243624 3:77690594-77690616 CAGGAGACAATCAAGCAGTGAGG - Intergenic
957810599 3:85215990-85216012 AAAGAGACACTGAAGAGGGAAGG - Intronic
958083298 3:88774413-88774435 AAAGAGACACTGAAGAGGGTAGG + Intergenic
958099269 3:88988429-88988451 AAAGAGGCACTGAAGAAGGTAGG + Intergenic
958893055 3:99801693-99801715 AAGCTGACACTGAAGAAGGCAGG + Intergenic
959118620 3:102206998-102207020 AAAGAGACACTGAAGAGGGTAGG - Intronic
959596475 3:108134427-108134449 GAGGAAACACTGAAAACGGGTGG + Intergenic
960095562 3:113686391-113686413 AAGGAGACACTGAAGATGGTAGG - Intronic
960413195 3:117353250-117353272 CAGGAGACAAGGAAGAAGCCTGG - Intergenic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
962436662 3:135373285-135373307 CAGGATGCACTGAAGAGGGCTGG - Intergenic
962636903 3:137340477-137340499 CAGGAAACACTGAAGAATTTTGG - Intergenic
962947131 3:140182456-140182478 CAGGACAGACTGAAGAAGGCTGG - Intronic
963108437 3:141665712-141665734 AAGGAGACAATGAAGGAAGGAGG + Intergenic
963108517 3:141665962-141665984 AAGGAGACAATGAAGGAAGGAGG + Intergenic
963384986 3:144581308-144581330 CAGGAGAGACTAAAGGAGTGGGG + Intergenic
963850714 3:150207901-150207923 CAGTAGACGCTTAAGAAGCGGGG + Intergenic
965535383 3:169818280-169818302 AAAGAGGCACTGAAGAAGGTAGG - Intergenic
965786538 3:172340794-172340816 TAGGAGACACAGAACAGGGGTGG - Intronic
966976557 3:185088970-185088992 CAGCAGAGCCTGAAGAGGGGAGG + Intronic
967002456 3:185349280-185349302 TAAGAGACATTGAGGAAGGGAGG - Intronic
967542865 3:190689921-190689943 CATGAGACACAGAAGAACTGGGG - Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967841973 3:194012895-194012917 ATGAAGACAATGAAGAAGGGAGG - Intergenic
967920312 3:194609435-194609457 CAGGAAACACAGAAGAGTGGGGG + Intronic
968949332 4:3682430-3682452 CAGGCGTCACAGATGAAGGGTGG + Intergenic
968980990 4:3849231-3849253 TGGGAGAGACTGAAGAAGGGTGG - Intergenic
969354533 4:6617622-6617644 CAGAAGACCATGAAGAAGGGCGG - Intronic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971834457 4:31744702-31744724 GAGGAAACAAGGAAGAAGGGAGG + Intergenic
972091140 4:35285576-35285598 GAGGAAACAGTGATGAAGGGTGG + Intergenic
972444992 4:39135472-39135494 CTGGAGACATTGCAGAAGGAAGG - Intergenic
974144160 4:57925402-57925424 CAGTATACACTTAAGAAGGAGGG + Intergenic
974868072 4:67604284-67604306 AAAGAGACACTGAAGAGGGTAGG - Intronic
974921419 4:68245002-68245024 CAGGAGAAAGTGAAGAATAGAGG - Intronic
975290242 4:72670088-72670110 CAAGAGAAAGTGAAGAAGGCAGG + Intergenic
975318168 4:72978995-72979017 GAGGATATACTGAAGTAGGGTGG + Intergenic
975762980 4:77636054-77636076 CTGCAGCCACTGATGAAGGGAGG + Intergenic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976987057 4:91314684-91314706 TAGAAGGCAGTGAAGAAGGGAGG - Intronic
977912600 4:102555276-102555298 CAGGCTACACTGAAAAAGGAGGG - Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978339304 4:107705402-107705424 CAGGAGAGAGAGAACAAGGGGGG - Intronic
978766686 4:112412049-112412071 CAGAAGACACTGAGGACGCGGGG - Intronic
980182161 4:129414490-129414512 GGGGAGACCCTGGAGAAGGGTGG + Intergenic
980623400 4:135340635-135340657 CGGGAGACACTGAAGAACATGGG + Intergenic
981965050 4:150590553-150590575 AAGGAGAAACTGTAGAAGGGGGG + Intronic
982834998 4:160112435-160112457 CAGGAGACTCTGAACTCGGGAGG + Intergenic
983492987 4:168411304-168411326 AAGGAGGCACTGAAGAGGGCAGG + Intronic
984149396 4:176108000-176108022 CAGGAGGAAGGGAAGAAGGGTGG - Intronic
985273412 4:188216198-188216220 AAGGAGACAGGGAAGGAGGGAGG - Intergenic
985819937 5:2152908-2152930 AAGGAGAGACAGAAGAAGAGAGG - Intergenic
986029964 5:3884433-3884455 CGGGAGACACTGAAGAACAGAGG - Intergenic
986631324 5:9776358-9776380 AAGGAGGCACTGAAGAGGGTAGG - Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988299062 5:29398299-29398321 CAGGAAATACTGAAGATTGGGGG + Intergenic
988413345 5:30914613-30914635 CAGGAAACACTTCACAAGGGAGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
992195644 5:74336438-74336460 CAGGAGGCACCGAAGCAGGCAGG - Intergenic
992322503 5:75627839-75627861 CAGCAGAAACTCAAGAAGTGGGG - Intronic
993026576 5:82653891-82653913 AAAGAGACACTGAAGAGGGTAGG - Intergenic
993269118 5:85770535-85770557 AAAGAGACACTGAAGAGGGTAGG - Intergenic
994730999 5:103490518-103490540 AAGGAGAGACGGAGGAAGGGAGG - Intergenic
994881208 5:105498662-105498684 CAAGAGACATTGAAGAGGGCAGG - Intergenic
995569561 5:113465116-113465138 AGGGAGACAATGAGGAAGGGAGG + Intronic
996180335 5:120410858-120410880 AAAGAGGCACTGAAGAAGGTAGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997662620 5:135601095-135601117 CAGAAGACACTGAAGAGTGAAGG + Intergenic
997857146 5:137382616-137382638 CAGGAGAGACAGAGTAAGGGGGG + Intronic
997865665 5:137460499-137460521 CAGGAGACATTGAAGTAAGCTGG + Intronic
997870523 5:137501566-137501588 CAAGAGTCTCTGAAGAAGTGAGG - Intronic
998498635 5:142613015-142613037 CAGGAGACATAGAAGAAGACAGG - Intronic
998819418 5:146044754-146044776 AAGGAGACAATGAAGAAGAGGGG - Intronic
999410098 5:151343050-151343072 CAGGAGACACAGAACAAGGCAGG + Intronic
999849619 5:155524017-155524039 AAAGAGACACTGAAGAGGGTAGG - Intergenic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000791962 5:165619021-165619043 CATGAGAAAATGAAGATGGGTGG - Intergenic
1001407559 5:171486634-171486656 GAGGAGTCACTGAACAAGGCTGG + Intergenic
1003224221 6:4189984-4190006 CAGGAGAGAATGAAGAGGAGAGG + Intergenic
1003815850 6:9839530-9839552 CAAGAGAAAATGAAGAAGAGGGG - Intronic
1003911351 6:10747084-10747106 CAGGAAACACAGAAGAGGAGCGG + Intergenic
1005018257 6:21394008-21394030 GAAGAAATACTGAAGAAGGGAGG - Intergenic
1005506773 6:26476088-26476110 AAGGAGACATAGGAGAAGGGAGG - Intronic
1005862390 6:29911548-29911570 GAGGAGACATAGAAGAGGGGAGG + Intergenic
1006114830 6:31769970-31769992 CAGGAAACGGGGAAGAAGGGAGG + Intronic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006966088 6:37986725-37986747 GATGAGTCTCTGAAGAAGGGAGG + Intronic
1007257356 6:40538329-40538351 CAGGGGGCCCTGGAGAAGGGGGG - Intronic
1008306364 6:49906094-49906116 AGGAAGTCACTGAAGAAGGGTGG + Intergenic
1008643273 6:53486535-53486557 CAGGAGAAACTGAATAAGATGGG - Intergenic
1009246170 6:61240836-61240858 GAGAAGACACTGAAGAATTGAGG - Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010472780 6:76249555-76249577 CAGGAGACACAGAAGACGGGTGG + Intergenic
1011509847 6:88088383-88088405 CAGGAGAACCTGCAGAAGGGAGG + Intergenic
1011712359 6:90067476-90067498 CAGGAGACACTCATGCAAGGAGG + Intronic
1012455705 6:99402667-99402689 CAGGAGACAGTGAAGATGAGAGG - Exonic
1012989670 6:105912115-105912137 CAGGAGGCACTAGAGAAGGAGGG - Intergenic
1013073756 6:106752375-106752397 CAGGAGACACAGCAGAGGGATGG - Intergenic
1013614952 6:111834396-111834418 AAGGAGGCACTGAGGAAGGTGGG - Intronic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014726332 6:124976290-124976312 CAGGTGACAGGGAGGAAGGGAGG - Intronic
1015590602 6:134819256-134819278 CAGAAGAAATTTAAGAAGGGTGG + Intergenic
1016527381 6:145017458-145017480 CAGGAGAGGCTGAAGCAGTGTGG - Intergenic
1016541356 6:145169857-145169879 AAAGAGGCACTGAAGAAGGTAGG + Intergenic
1018306460 6:162461835-162461857 AAAGAGACAATGAAGAAGAGTGG + Intronic
1018581220 6:165309716-165309738 CAGAAGGCACAGAAGAGGGGAGG - Intergenic
1018977433 6:168575976-168575998 CATGAGACACAGAGGCAGGGTGG + Intronic
1018978576 6:168583849-168583871 TGGGACAAACTGAAGAAGGGAGG + Intronic
1018995830 6:168709880-168709902 AAGGACACAATGAAGGAGGGAGG - Intergenic
1019467133 7:1196102-1196124 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467170 7:1196212-1196234 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467229 7:1196392-1196414 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467254 7:1196464-1196486 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467278 7:1196536-1196558 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467291 7:1196570-1196592 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467306 7:1196608-1196630 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467344 7:1196717-1196739 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467358 7:1196753-1196775 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467371 7:1196787-1196809 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1019467383 7:1196821-1196843 CAGGAGGCTGTGATGAAGGGGGG + Intergenic
1020781924 7:12528649-12528671 CAGGAGACACTTTAGAACGATGG + Intergenic
1020975761 7:15004040-15004062 CAGGAGCCAATGAAGACAGGTGG - Intergenic
1021214759 7:17901721-17901743 CAAGAGGCACTGAAGATGGTAGG - Intronic
1022231963 7:28423078-28423100 CAGGAGAAAAGGAAGAAGGGAGG - Intronic
1022652717 7:32291997-32292019 AAGTAGACATTGTAGAAGGGCGG - Intronic
1023739244 7:43263700-43263722 TAGGAAACAGAGAAGAAGGGAGG + Intronic
1024047949 7:45597784-45597806 CAAGAGGCTCTGGAGAAGGGTGG + Intronic
1024619726 7:51147052-51147074 CAGAAGGCACTGCAGAGGGGAGG + Intronic
1024983918 7:55179862-55179884 CAGGAGATGCTGTAGATGGGAGG + Intronic
1026213876 7:68330960-68330982 CAGGAGAATCTAAGGAAGGGAGG + Intergenic
1028169624 7:87580911-87580933 AAAGAGGCACTGAAGAAGGTAGG - Intronic
1028353538 7:89879127-89879149 AAAGAGGCACTGAAGAAGGTAGG - Intergenic
1028522148 7:91743143-91743165 AAAGAGACACTGAAGAGGGTAGG - Intronic
1028713579 7:93938736-93938758 CAGGAGACAAGGAGGAAGAGTGG - Intergenic
1029501501 7:100933611-100933633 CAGAAGACACTGGAGTTGGGAGG - Intergenic
1030665520 7:112273468-112273490 AAAGAGGCACTGAAGAAGGTAGG - Intronic
1031528994 7:122853775-122853797 CAGGAGAGATGGAAGAAGAGAGG + Intronic
1031721792 7:125186533-125186555 AAAGAGGCACTGAAGAAGGGAGG + Intergenic
1032329111 7:130961200-130961222 CAGGAGTCACTCAAGACTGGAGG + Intergenic
1032911774 7:136440513-136440535 CAGGAGACAGAGAAGAGGGAGGG - Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034897540 7:154887120-154887142 CAGGAGACAATGAAGAGGACTGG - Intronic
1035330636 7:158094850-158094872 CAGGAGACCCTGAGGGATGGTGG - Intronic
1035472201 7:159117644-159117666 CAGGTGACTCTGAAGATGGAAGG - Intronic
1035657417 8:1320411-1320433 CGGGACACAGTGAAAAAGGGTGG + Intergenic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036828656 8:12001677-12001699 CAGGAGACAATATAGAAGAGTGG - Intergenic
1037578909 8:20233136-20233158 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1037598527 8:20374260-20374282 CAGGAAACAGTGAAGAGGGAGGG + Intergenic
1038048661 8:23789109-23789131 CAGGAGAACCTGAACAAGGCTGG + Intergenic
1038105276 8:24426645-24426667 CATGTGACACAGAAGAAGGTAGG - Intergenic
1038315435 8:26480779-26480801 AAAGAGACTCTCAAGAAGGGAGG - Intronic
1038957744 8:32485572-32485594 AAGCAGACACTCAAGAAGGAAGG + Intronic
1040944786 8:52873336-52873358 CAGGATACCTTGAAGCAGGGAGG + Intergenic
1041782625 8:61594403-61594425 CAGGAGACACTGATGCAAGCTGG - Intronic
1042464895 8:69117560-69117582 CAGGACATACTGAATTAGGGTGG + Intergenic
1043919501 8:85965108-85965130 CAGAAGAAACTGGAGAAGGAAGG + Intergenic
1043997891 8:86842278-86842300 AAAGAGGCACTGAAGAAGGTAGG + Intergenic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044593590 8:93937722-93937744 CAGGAGACAGTGTAGGAGAGTGG + Intergenic
1044989850 8:97786246-97786268 TAGGAGCAACTGAAGAAGTGTGG - Intronic
1045544242 8:103113889-103113911 CAGCAAACACAGTAGAAGGGAGG + Intergenic
1046138603 8:110061888-110061910 GAGTATTCACTGAAGAAGGGAGG + Intergenic
1046374416 8:113357809-113357831 CAGGAGACAGAGAGGAAAGGGGG - Intronic
1047209104 8:122826355-122826377 CAGGAGACACTGTACCAGGCGGG + Intronic
1048366857 8:133745831-133745853 CAGGTGGCACTGAAGATGGCAGG + Intergenic
1049062420 8:140286549-140286571 CAGGAAGCACTGAGGGAGGGAGG + Intronic
1051177236 9:14373111-14373133 AAGGGAACACTGGAGAAGGGTGG + Intronic
1051455202 9:17247544-17247566 AAAGAGGCACTGAAGAAGGAAGG - Intronic
1052177931 9:25486923-25486945 AGGGAGACTCTGAAGAAGGTTGG + Intergenic
1052988875 9:34506922-34506944 CTGGAGCCACTGGAGGAGGGAGG + Intronic
1055610038 9:78012993-78013015 CAAAAGACAGTGAAGAAAGGGGG + Intronic
1057213056 9:93210971-93210993 AATGAGTCAGTGAAGAAGGGAGG - Intronic
1057289284 9:93790849-93790871 CAGGAAAAAGTGAAGAGGGGAGG + Intergenic
1057745049 9:97744781-97744803 CAGTGGACACTGAACAAGGCAGG + Intergenic
1058522934 9:105829550-105829572 AAGGAGGCACTGAAGAGGGTAGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059998178 9:119933990-119934012 CAAGAGACACAGTAGAGGGGAGG + Intergenic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060376450 9:123118827-123118849 CAGGAGCCTCTGCAGAAAGGTGG - Intronic
1060937235 9:127522607-127522629 CACGAGGCCCTGAAGCAGGGAGG - Intronic
1061083702 9:128387048-128387070 CAGGTGACCCTGAAGACAGGTGG + Intronic
1061510754 9:131059645-131059667 CAGGAAGCACTGCAGCAGGGAGG - Intronic
1061649858 9:132038794-132038816 CAGGAGACAGGGAAGAAGGAAGG + Intronic
1062170358 9:135131621-135131643 CTGGAGTCAGTGATGAAGGGGGG - Intergenic
1185595760 X:1305743-1305765 CAGGAGAAACTGAGGCAGGGTGG + Intronic
1185822912 X:3221846-3221868 CAGGACACTCTGAGGCAGGGGGG + Intergenic
1186239950 X:7555242-7555264 CAGGAGGGAGAGAAGAAGGGAGG + Intergenic
1186302772 X:8218640-8218662 CAAGAGACACTCAACAAAGGAGG - Intergenic
1187991227 X:24875170-24875192 CAGAAGCCACAAAAGAAGGGGGG + Intronic
1188634912 X:32417541-32417563 AATGATACAGTGAAGAAGGGGGG + Intronic
1189235583 X:39484440-39484462 CAGGAGACAGGGAAGAAGCGGGG + Intergenic
1189640635 X:43067337-43067359 AAAGAGGCACTGAAGAAGGTAGG + Intergenic
1190014973 X:46819104-46819126 AAAGAGGCACTGAAGAAGGTAGG + Intergenic
1190254613 X:48753311-48753333 CAGGAGTCACTGACGAAAGGGGG - Intergenic
1190282379 X:48939588-48939610 CAGGAAAGACTGAAGATGTGAGG + Intronic
1190296405 X:49030214-49030236 CAGGGGACACTGAAGAGAGCAGG + Exonic
1190502513 X:51093574-51093596 CAGGAGTCACTGGAGAGGTGGGG + Intergenic
1191740975 X:64434827-64434849 CAGGAGGCACTGAGCAAGGGAGG - Intergenic
1192568813 X:72185341-72185363 GAGGAGACACTCCAGAATGGGGG - Intronic
1193245447 X:79223371-79223393 CAGGAGAGAAGGAAGAAAGGAGG + Intergenic
1193456816 X:81741779-81741801 CTGGGGACCCTGAAGTAGGGAGG - Intergenic
1193742222 X:85231521-85231543 AAAGAGGCACTGAAGAAGGTAGG + Intergenic
1193931671 X:87561262-87561284 AAGGAGCCACTGAAGAGGGTAGG + Intronic
1194280732 X:91950306-91950328 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1195914281 X:109920707-109920729 CAGAATAAACTGGAGAAGGGGGG - Intergenic
1196234619 X:113263436-113263458 AAAGAGACACTAAACAAGGGAGG - Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1197040591 X:121931341-121931363 CAACAGACACTTAAGAATGGAGG + Intergenic
1197153393 X:123244496-123244518 CAGTAGAAACTTAAAAAGGGTGG - Intronic
1197346160 X:125327288-125327310 CAGGACACACTGGAGAAGTGCGG - Intergenic
1197771064 X:130089710-130089732 CAGGAGACAATGAGCAAGGAAGG - Intronic
1198218063 X:134574817-134574839 CACGAGGTACTGAAGAATGGTGG + Intronic
1198770777 X:140127500-140127522 AAAGAGACACTGAAGAGGGTAGG - Intergenic
1199134145 X:144231333-144231355 CAGGAGCCCATGGAGAAGGGGGG + Intergenic
1200133514 X:153863797-153863819 CAGGAGGCCTTGCAGAAGGGTGG + Intronic
1200224356 X:154409076-154409098 CTGGGGAGACGGAAGAAGGGAGG - Intronic
1200598216 Y:5173862-5173884 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1201696190 Y:16829102-16829124 GAGGAGAGACTGAGGGAGGGAGG + Intergenic
1201759868 Y:17525053-17525075 CAAGTGACACTGAAGAAAAGAGG - Intergenic
1201841686 Y:18380937-18380959 CAAGTGACACTGAAGAAAAGAGG + Intergenic