ID: 1092276947

View in Genome Browser
Species Human (GRCh38)
Location 12:7068565-7068587
Sequence AGGTGACTCCCAGTCACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092276947_1092276950 4 Left 1092276947 12:7068565-7068587 CCATGGGTGACTGGGAGTCACCT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1092276950 12:7068592-7068614 AAAGCAACTGTAATCCTCTTGGG 0: 1
1: 0
2: 1
3: 18
4: 208
1092276947_1092276949 3 Left 1092276947 12:7068565-7068587 CCATGGGTGACTGGGAGTCACCT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1092276949 12:7068591-7068613 GAAAGCAACTGTAATCCTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 174
1092276947_1092276951 9 Left 1092276947 12:7068565-7068587 CCATGGGTGACTGGGAGTCACCT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1092276951 12:7068597-7068619 AACTGTAATCCTCTTGGGAAAGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092276947 Original CRISPR AGGTGACTCCCAGTCACCCA TGG (reversed) Intronic
900173071 1:1279787-1279809 ACTTGGCTCACAGTCACCCAGGG + Intergenic
900183983 1:1324564-1324586 CGGCGGCTCCCACTCACCCAAGG + Exonic
900793326 1:4693343-4693365 CCATGACTCCCAGTCCCCCATGG - Intronic
901189674 1:7401944-7401966 AGGTGACTCAGAGTCAGGCATGG - Intronic
901758050 1:11453343-11453365 GGGAGACTGCCAGTCACCCCAGG + Intergenic
902332010 1:15735339-15735361 AGGCCACCCTCAGTCACCCAAGG - Intergenic
902573315 1:17360844-17360866 AGGTGAATCCCACTCAGCCTAGG - Intronic
903771122 1:25765153-25765175 AGATAACAGCCAGTCACCCATGG + Intronic
905260150 1:36711594-36711616 AGTGGACTCCCAGTGAGCCAGGG - Intergenic
907276443 1:53319468-53319490 GGGTGACTCTCAGTTTCCCAAGG + Intronic
910460313 1:87442062-87442084 AGGAAACTCCAAGTCACCCCTGG + Intergenic
911048075 1:93645101-93645123 ACGAGGCCCCCAGTCACCCATGG - Intronic
913370352 1:118092292-118092314 GGATGACTCTGAGTCACCCAGGG - Intronic
914317540 1:146528329-146528351 AGGAAACTCCAAGTCACCCCTGG + Intergenic
914496815 1:148205031-148205053 AGGAAACTCCAAGTCACCCCTGG - Intergenic
917477871 1:175384432-175384454 AGATGCCACCCTGTCACCCAGGG - Intronic
918150807 1:181796779-181796801 TGGGGACTCCCAGTCAGCCTGGG - Exonic
920371417 1:205481562-205481584 AGGTCTCTCCCAGGCACCCTGGG - Intergenic
923433380 1:233945841-233945863 AATTGACTCACAGTCACACATGG - Intronic
923637577 1:235715513-235715535 AGAAGACTCCCAGACACTCAAGG - Intronic
924239280 1:242025619-242025641 AGGTGATGCCCACTCATCCAAGG - Intergenic
1062918797 10:1264310-1264332 AAGTGACTGCCAGTCATTCAGGG + Intronic
1067752573 10:48981926-48981948 ATTTGACTCGCAGTAACCCATGG + Intronic
1068410331 10:56646237-56646259 AGGTGATACCCAGGCAACCAGGG - Intergenic
1070080729 10:73184098-73184120 AGCTGACTCACGGTCAGCCAGGG - Intronic
1070764805 10:79050176-79050198 AGGTGACTCCCTGCCACCAGGGG - Intergenic
1073495314 10:103885404-103885426 AGGTGACTTACAGGCATCCATGG + Intronic
1075776958 10:124995343-124995365 AGGTGTCTCCCACTCCCCAACGG + Intronic
1076889390 10:133276443-133276465 AGGTGAATCCCAGGAACCCAGGG + Intronic
1077893607 11:6437477-6437499 AGGTGCCTCCCAGGTACCCGCGG - Exonic
1078333228 11:10443129-10443151 AGATCACTACCAGTCACCTATGG - Intronic
1078510327 11:11979998-11980020 AGGTGTGTCCCAGTGACCCGGGG + Intronic
1078604976 11:12767089-12767111 AGGCAGCTCCCAGTCAACCAGGG - Intronic
1079324293 11:19478293-19478315 AGGGGAGTCCCAGTCACTGAGGG + Intronic
1085035180 11:73295689-73295711 AGGTGATACCCAGTTCCCCAAGG - Intronic
1088408501 11:109507368-109507390 TGGTGCCACCCAGTCACCAAAGG + Intergenic
1090620416 11:128555772-128555794 AGGAGACTCCCACTCACCAGAGG + Intronic
1091584553 12:1808721-1808743 CGGTCAGTCTCAGTCACCCAGGG + Intronic
1092276947 12:7068565-7068587 AGGTGACTCCCAGTCACCCATGG - Intronic
1092961758 12:13602688-13602710 AAGTGACTTCCAGACCCCCATGG + Intronic
1094073142 12:26441679-26441701 AGGTGACTTTGAGTCATCCATGG - Intronic
1096651433 12:53063778-53063800 AGGTGACACACATTCTCCCAGGG - Exonic
1100070567 12:90711330-90711352 AGTTGACTCCCAGTTTCACATGG + Intergenic
1103162735 12:118743588-118743610 AGTTGACTCCCAGTTCCACAAGG - Intergenic
1103838526 12:123844038-123844060 AATTGACTCACAGTCACGCATGG + Intronic
1105069851 12:133227761-133227783 TGGTGCCTCCCTGTCCCCCAAGG - Intronic
1110125000 13:71931682-71931704 AGTTGACTCACAGTTCCCCAGGG - Intergenic
1113813748 13:113157944-113157966 AGTTGACTCCCAGTTCCACATGG - Intergenic
1113905010 13:113815099-113815121 AGGAGACTCCCTGTAACCCAAGG - Exonic
1117315219 14:54566347-54566369 AGGGGACCCCCAGTGACCCGCGG - Intergenic
1119545908 14:75471277-75471299 AGCTGAATCCCTGCCACCCAGGG + Intronic
1120527278 14:85591654-85591676 ATGGGATTCCCAGTCACCTAAGG - Intronic
1121717927 14:96089490-96089512 AGGTGCCACCCAGTCACAGAAGG - Exonic
1122138767 14:99649911-99649933 AGGTGGTTCCCAGTGAACCATGG + Intronic
1122266161 14:100547864-100547886 AGGAGGCTCCCAGTCCCCCTGGG + Intronic
1123446337 15:20333434-20333456 ATTTGACTCACAGACACCCATGG + Intergenic
1123455753 15:20422763-20422785 AATTGACTCCCAGTTCCCCATGG - Intergenic
1123635815 15:22308082-22308104 AATTGACTCCCAGTTCCCCATGG + Intergenic
1127489019 15:59444577-59444599 AGGTGGCTCCAGGTCTCCCAGGG - Intronic
1127614860 15:60674113-60674135 ATGTGACTCACAGTGACTCACGG - Intronic
1127771400 15:62234114-62234136 AGGAGGCTCCCAGTCATGCAGGG - Intergenic
1130712363 15:86295752-86295774 ATGTGACTCTCAGTCAGTCAAGG + Intronic
1131408737 15:92188186-92188208 AAGTGACTCCCAGTCAGAGAAGG + Intergenic
1133011468 16:2914361-2914383 AGGTGTCTCTCAGACACCAAGGG - Intronic
1133254018 16:4505367-4505389 AGGTGACACCCACACACCCCAGG - Intronic
1135810361 16:25581270-25581292 AGGTCCCTCCCAGGGACCCATGG - Intergenic
1136609427 16:31357156-31357178 AGGAGACTCCCAGCCCCCCGCGG - Intronic
1138796353 16:59974302-59974324 CAGTTACTCCCAGTCAACCATGG - Intergenic
1139621784 16:68150964-68150986 AATTGACTCACAGTCCCCCATGG - Intronic
1139955774 16:70692338-70692360 TGGGGTCTCCCAGTGACCCAGGG + Intronic
1141697799 16:85628347-85628369 AGGGGACCCCCAGGGACCCAGGG + Intronic
1142033586 16:87850479-87850501 TGGTGACTCGCAGTCACCGATGG - Intronic
1142990897 17:3730134-3730156 ATCTGACTCCCAGTGACCCTGGG - Intronic
1143032967 17:3977906-3977928 AGGTACCTGCCAGTCACCCTCGG + Intergenic
1143949406 17:10620767-10620789 CTGTGCCTGCCAGTCACCCAGGG + Intergenic
1146610249 17:34298691-34298713 AAGTGACTCCCAGGCAGCCATGG + Intergenic
1148704330 17:49615750-49615772 AGCTGAATGCCATTCACCCAAGG - Intronic
1148736979 17:49870351-49870373 AGGGATCTCCCAGCCACCCAAGG + Intergenic
1149686843 17:58540626-58540648 AGGTTACTCCCAGTCTTCCTGGG - Intronic
1150147231 17:62779184-62779206 GGGTGACTCACAGCCTCCCAGGG + Intronic
1151625238 17:75271818-75271840 AGGTGCCCTCCTGTCACCCAGGG - Intergenic
1151890356 17:76947767-76947789 AGGTGTCTCCCAGGCACACCTGG + Intronic
1157015549 18:43708291-43708313 TGGAGACTCACAGTCACGCAAGG + Intergenic
1157424053 18:47570000-47570022 ATGTGATTCAAAGTCACCCAAGG - Intergenic
1158950801 18:62493048-62493070 AGGGCACACCCCGTCACCCAAGG + Intergenic
1159622178 18:70651223-70651245 AGGTGACTCACAGTTCCGCATGG + Intergenic
1160418956 18:78731326-78731348 ACGTGACGTCCAGGCACCCAGGG - Intergenic
1160432092 18:78819369-78819391 AAGTGACTGCCAGCCTCCCACGG - Intergenic
1162563731 19:11433556-11433578 AGGTTACTCTTAGTCCCCCAAGG + Intronic
1163631202 19:18418759-18418781 AGTTAACTCACAGTCACCCTGGG - Intergenic
1163932850 19:20414392-20414414 AGGGAATTCCCAGTGACCCAGGG + Intergenic
1164028033 19:21371289-21371311 AGAGGATTCCCAGTGACCCAGGG - Intronic
1164745150 19:30606689-30606711 AGTTGACTCCCAGGCACAAACGG + Intronic
1165774539 19:38396855-38396877 AGGGAACTCCCAGACACCCTGGG + Intergenic
1166777641 19:45322648-45322670 AGGGGCCTCCCAGACACACAAGG + Intronic
1167391773 19:49200165-49200187 AGGACCCTCCCAGTCACCCGGGG - Intronic
1167829882 19:52011029-52011051 AGGTGACCCCCACCCACTCATGG - Intergenic
926039988 2:9665265-9665287 ACATGTCTCCCAGTCACCAATGG - Intergenic
926401850 2:12505085-12505107 AGGTGACTCCAACTCACCATGGG + Intergenic
927243472 2:20938435-20938457 GGGTTATTCCCAGTCTCCCAGGG + Intergenic
927243478 2:20938455-20938477 GGGTTATTCCCAGTCTCCCAGGG + Intergenic
927860622 2:26558064-26558086 TGGTTTCTCCCAGTCACCCTGGG + Intronic
929422649 2:41809373-41809395 AGGTGACTCCCATCCATCAAAGG + Intergenic
931402505 2:61943976-61943998 ACTTGGCCCCCAGTCACCCAGGG + Intronic
932480571 2:72036687-72036709 AGTTGTGTCTCAGTCACCCATGG - Intergenic
935456107 2:103269258-103269280 ACGTGGCTCCCAGTCACCCCTGG + Intergenic
936628050 2:114169939-114169961 AGGTGAGTCCCATTTGCCCACGG + Intergenic
937471625 2:122178784-122178806 AGGTAAATCCCTGTCACCCTTGG + Intergenic
937859401 2:126696329-126696351 AGGCCACTCCCAGGGACCCAGGG + Exonic
938400656 2:130988198-130988220 AGGTGACTGCCAGACTCCCAGGG - Intronic
938656113 2:133435892-133435914 AGGTGACTCAAGGTCAGCCATGG - Intronic
944026744 2:195179655-195179677 AAGTGACTCCCAGTTCCACATGG + Intergenic
946771301 2:223091902-223091924 TGGTGACTCCCTGTCTTCCAAGG + Intronic
948490660 2:238310495-238310517 AGTTGACTCCCACTGACCCCAGG - Intergenic
1172635421 20:36406747-36406769 GGGTGAGTCCCCTTCACCCAGGG + Intronic
1174169572 20:48607557-48607579 AAGTGACACCCAGATACCCAGGG + Intergenic
1175167223 20:57053493-57053515 AGGTAACCCACAGTCACACACGG + Intergenic
1179818983 21:43925494-43925516 AGGTGCCTCAAAGTCAGCCAGGG - Intronic
1180867250 22:19126697-19126719 ATGCGACTCCCACTCCCCCAGGG + Intergenic
1182830364 22:33300126-33300148 AGGTTACTCCCAAACCCCCAGGG - Intronic
1184935177 22:47715984-47716006 AGGGGACTCCCAGCTCCCCAAGG - Intergenic
956619582 3:71207831-71207853 AGGTGGCTCCCAGTGTCCAAGGG + Intronic
956970768 3:74522607-74522629 ACTGGACTTCCAGTCACCCATGG - Intergenic
958026331 3:88054113-88054135 AGATAACTCCAAGTCACACAGGG + Exonic
959366420 3:105464403-105464425 AGGTGACTCTTAGTTACTCAAGG + Intronic
962537489 3:136342970-136342992 AGGATACTCACTGTCACCCATGG - Intronic
964611630 3:158621661-158621683 AGGAGGCCCCCAGTCACCCAGGG + Intergenic
965091138 3:164163643-164163665 AGGGGAGTCCCAGTCCCTCATGG + Intergenic
966757519 3:183385403-183385425 AGGAGCCTCCCACTCACCCCTGG + Intronic
967100452 3:186211300-186211322 AGCTGACTCACAGGTACCCAGGG - Intronic
968518805 4:1026502-1026524 AGGGGACTCCTGGGCACCCAAGG - Exonic
968549995 4:1217197-1217219 AGGGGACCCCCAGTCACTCTGGG + Intronic
969848903 4:9941703-9941725 AGGGGACACAGAGTCACCCAGGG - Intronic
973612999 4:52655274-52655296 AGGTGAGTCCCTGTCCCCAAGGG - Intronic
975695767 4:77011373-77011395 AGCTGACTGCCACTCCCCCAAGG - Intronic
977561267 4:98536451-98536473 AGGTGTCTCCCAGATACACAGGG + Intronic
979787375 4:124733079-124733101 AGTTGACTCACAGTTCCCCATGG - Intergenic
980410363 4:132410105-132410127 AGGATACTCCCAGAGACCCAGGG - Intergenic
981550095 4:145935395-145935417 AGTTCAATCACAGTCACCCAAGG - Intronic
985076945 4:186225093-186225115 AACTGACTCACAGTTACCCATGG - Intronic
986508530 5:8478365-8478387 AATTGACTCCCAGTTCCCCAGGG + Intergenic
987260158 5:16195181-16195203 AGGTGACTGCAAGTCAGGCAAGG + Intergenic
987493023 5:18605343-18605365 ATGTGACTCACAGTCACCAAAGG - Intergenic
987519549 5:18962806-18962828 AGGTGTCAGCTAGTCACCCATGG + Intergenic
987987053 5:25161337-25161359 ACGAGGCCCCCAGTCACCCAGGG + Intergenic
988769359 5:34415846-34415868 ATGGGGCCCCCAGTCACCCAGGG - Intergenic
989427713 5:41315824-41315846 AGCGGACGCCCAGTCACACAGGG + Intronic
992187503 5:74258254-74258276 TGCTGCCTCCCAGTCACTCAGGG + Intergenic
995364907 5:111347558-111347580 AGGGGACTGCCAGTCTCCCCTGG - Intronic
996916485 5:128718437-128718459 TGGTGACTCCTAGTCACCAAAGG + Intronic
997893800 5:137697947-137697969 AGGTGACTCCTATTCTCCCCAGG - Intronic
997951140 5:138243441-138243463 AGGTGACTCCCAGCAAGCAAAGG - Intergenic
1000139258 5:158385626-158385648 AATTGACTCACAGTTACCCATGG + Intergenic
1000725837 5:164769915-164769937 AGTTGACTCACAGTACCCCATGG + Intergenic
1000827168 5:166059311-166059333 AAGAGATTCCCAGTCACCTATGG - Intergenic
1000930427 5:167244738-167244760 TGGTGTCTCTCAGTCTCCCAAGG + Intergenic
1001259173 5:170212457-170212479 AGCTAACTCCAAGGCACCCAGGG + Intergenic
1002030998 5:176430372-176430394 ACGAGGCCCCCAGTCACCCAAGG + Intergenic
1003559885 6:7171751-7171773 ACATGACTCCCACTGACCCATGG - Intronic
1007752782 6:44080565-44080587 AGCTGCCTCCCAACCACCCAAGG + Intergenic
1010754892 6:79655900-79655922 AGGTGACCCAGATTCACCCAAGG + Intronic
1011798146 6:90980332-90980354 AGTAGCCTCCCAGTTACCCATGG + Intergenic
1013108889 6:107049332-107049354 AGATGGCTCCCAGTCATCCCTGG + Intronic
1021866171 7:24960680-24960702 AGGTGACCACCAGTCACCAGGGG + Intronic
1024511754 7:50209990-50210012 AAGTGACTGCCAGGCACCGAGGG - Intergenic
1028994453 7:97085059-97085081 AATTGACTCACAGTCACACATGG + Intergenic
1030438135 7:109551880-109551902 AGGTGACTGCCAGTCAGGCAAGG + Intergenic
1032500813 7:132398451-132398473 AGCTGACTCCCGCACACCCAGGG - Intronic
1034039358 7:147860718-147860740 AGTTGACTCCCAGTTCCTCATGG - Intronic
1035239443 7:157520303-157520325 GGCTGACTCCAAGTCACCCCTGG + Intergenic
1035746481 8:1965164-1965186 AGGTGTCTGCGTGTCACCCATGG + Intergenic
1039911971 8:41833265-41833287 AGGTCTCCCCCAGTCACCCCTGG + Intronic
1043048697 8:75359132-75359154 TGGTGACTCCCAGGCAAACAGGG - Intergenic
1043335088 8:79165925-79165947 AGGAGGCTCACAGTCTCCCAAGG - Intergenic
1045763685 8:105642033-105642055 AGGTGACTCACTGTCATTCAAGG + Intronic
1048854390 8:138673998-138674020 AGGTGAGTCCCAGGTACCCACGG + Intronic
1049564082 8:143328878-143328900 AGGTGACTGCCCTTCGCCCATGG - Intronic
1050170202 9:2807688-2807710 ATATTACTCCCAGTCACTCATGG - Intronic
1050684384 9:8150790-8150812 AATTGACTCACAGTCACACAGGG - Intergenic
1051272898 9:15372356-15372378 ATGTGGCCCCCTGTCACCCAGGG - Intergenic
1051723515 9:20064894-20064916 ATGTGCCTGCCAGTCACCCTGGG + Intergenic
1052339791 9:27353848-27353870 AGCTGACTCCCTGGCAGCCAAGG + Intronic
1052677432 9:31645131-31645153 AGGTGACCCCAAGAAACCCAAGG - Intergenic
1054775750 9:69122097-69122119 AGGTGGCTCCCAGACACCTGTGG - Intronic
1056557697 9:87703488-87703510 AAGAGAGACCCAGTCACCCAGGG - Intronic
1057040784 9:91846022-91846044 AGGTGACTAACACTCACACAGGG + Intronic
1057780288 9:98044309-98044331 ATGTGGCCCCCGGTCACCCAGGG + Intergenic
1058519069 9:105801601-105801623 AGATGACTCCCAGTATCGCAGGG - Intergenic
1058759609 9:108118302-108118324 AAGTGCCTCCCTGTCTCCCAGGG - Intergenic
1061926523 9:133808624-133808646 AGGACACTCCCAGCCCCCCATGG + Intronic
1062040807 9:134403483-134403505 AGGTGCCAGCCAGTCAGCCAAGG - Intronic
1062111194 9:134782929-134782951 AGGTTATTCCCAGTCCCCAAGGG - Intronic
1062114681 9:134802031-134802053 AAGTGACACCGAGTGACCCATGG - Intronic
1062582456 9:137234585-137234607 TGGTGACTCCCAGTTCCCCCAGG + Exonic
1188904730 X:35778596-35778618 ACGTGGCCCCCAGTCACCCAGGG + Intergenic
1189080952 X:37972126-37972148 ATGAGGCTCCCGGTCACCCAAGG + Intronic
1190569899 X:51770347-51770369 AGTTGGCCCCCAGTCACCCAGGG - Intergenic
1194777894 X:97988183-97988205 AGCTGACTCACAGTCACTGATGG + Intergenic
1195688760 X:107607119-107607141 AGGTGACTGTCAGTCACCTCAGG - Intergenic
1196059098 X:111388280-111388302 AGGTAACACCTATTCACCCATGG - Intronic
1198937554 X:141914487-141914509 AGTTGACTCCCAGTTCCACACGG - Intergenic
1198961498 X:142188379-142188401 AGTTGACTCCCAGTTCCACACGG + Intergenic
1199321743 X:146447632-146447654 ACTTGGCCCCCAGTCACCCAGGG + Intergenic
1201859778 Y:18584286-18584308 GGGTGACTACAAGTCACCCTGGG - Intronic
1201873543 Y:18736095-18736117 GGGTGACTACAAGTCACCCTGGG + Intronic