ID: 1092276949 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:7068591-7068613 |
| Sequence | GAAAGCAACTGTAATCCTCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 186 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 10, 4: 174} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1092276947_1092276949 | 3 | Left | 1092276947 | 12:7068565-7068587 | CCATGGGTGACTGGGAGTCACCT | 0: 1 1: 0 2: 0 3: 13 4: 191 |
||
| Right | 1092276949 | 12:7068591-7068613 | GAAAGCAACTGTAATCCTCTTGG | 0: 1 1: 0 2: 1 3: 10 4: 174 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1092276949 | Original CRISPR | GAAAGCAACTGTAATCCTCT TGG | Intronic | ||