ID: 1092276949

View in Genome Browser
Species Human (GRCh38)
Location 12:7068591-7068613
Sequence GAAAGCAACTGTAATCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092276947_1092276949 3 Left 1092276947 12:7068565-7068587 CCATGGGTGACTGGGAGTCACCT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1092276949 12:7068591-7068613 GAAAGCAACTGTAATCCTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092276949 Original CRISPR GAAAGCAACTGTAATCCTCT TGG Intronic