ID: 1092276950 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:7068592-7068614 |
Sequence | AAAGCAACTGTAATCCTCTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 228 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 208} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1092276947_1092276950 | 4 | Left | 1092276947 | 12:7068565-7068587 | CCATGGGTGACTGGGAGTCACCT | 0: 1 1: 0 2: 0 3: 13 4: 191 |
||
Right | 1092276950 | 12:7068592-7068614 | AAAGCAACTGTAATCCTCTTGGG | 0: 1 1: 0 2: 1 3: 18 4: 208 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1092276950 | Original CRISPR | AAAGCAACTGTAATCCTCTT GGG | Intronic | ||