ID: 1092276950

View in Genome Browser
Species Human (GRCh38)
Location 12:7068592-7068614
Sequence AAAGCAACTGTAATCCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092276947_1092276950 4 Left 1092276947 12:7068565-7068587 CCATGGGTGACTGGGAGTCACCT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1092276950 12:7068592-7068614 AAAGCAACTGTAATCCTCTTGGG 0: 1
1: 0
2: 1
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092276950 Original CRISPR AAAGCAACTGTAATCCTCTT GGG Intronic