ID: 1092278462

View in Genome Browser
Species Human (GRCh38)
Location 12:7081005-7081027
Sequence CGTCCACCCGGACTACCGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092278462_1092278465 -7 Left 1092278462 12:7081005-7081027 CCTGACGGTAGTCCGGGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1092278465 12:7081021-7081043 GTGGACGCTGACCCTGCGGATGG 0: 1
1: 0
2: 1
3: 5
4: 111
1092278462_1092278466 -6 Left 1092278462 12:7081005-7081027 CCTGACGGTAGTCCGGGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1092278466 12:7081022-7081044 TGGACGCTGACCCTGCGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 60
1092278462_1092278467 -5 Left 1092278462 12:7081005-7081027 CCTGACGGTAGTCCGGGTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1092278467 12:7081023-7081045 GGACGCTGACCCTGCGGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092278462 Original CRISPR CGTCCACCCGGACTACCGTC AGG (reversed) Exonic
1078175120 11:8964422-8964444 CCTCCGCCCGCACTTCCGTCTGG + Exonic
1092278462 12:7081005-7081027 CGTCCACCCGGACTACCGTCAGG - Exonic
1101758213 12:107638240-107638262 GGACCACCAGGACCACCGTCTGG + Intronic
1105840484 13:24249659-24249681 CGTCCACACGGTCTTCCTTCTGG - Exonic
1107844900 13:44501549-44501571 CCTCCACCCGGCCTAGCCTCTGG - Intronic
1122857317 14:104566069-104566091 CCTCCACCCGGCCCACCCTCAGG + Intronic
1134143370 16:11741694-11741716 AGTTCACCCGGACGAGCGTCCGG + Intronic
1138385774 16:56635029-56635051 CGGCCACCCCTACTACCGGCTGG - Intergenic
1143448914 17:7024110-7024132 CGTCCACCCCGACTCCCGCACGG - Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164896974 19:31885481-31885503 CGGCCTCCTGGGCTACCGTCAGG + Intergenic
929808734 2:45170173-45170195 CCTCCACCCGTCCGACCGTCGGG - Intergenic
934858070 2:97741331-97741353 CGCCCACGCGGACTCCCCTCTGG + Intergenic
1172595386 20:36147862-36147884 TGTCCACCCAGCCTCCCGTCGGG - Intronic
1012431871 6:99172387-99172409 CGTCCTCTAGGACTACTGTCGGG + Intergenic
1023562995 7:41495323-41495345 AGTCTACCCTGACTACCTTCAGG + Intergenic