ID: 1092278996

View in Genome Browser
Species Human (GRCh38)
Location 12:7085692-7085714
Sequence GAACCTAGTAGGTTTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092278996_1092279000 19 Left 1092278996 12:7085692-7085714 CCTTCTTCAAACCTACTAGGTTC 0: 1
1: 0
2: 1
3: 5
4: 120
Right 1092279000 12:7085734-7085756 GGCCCCTGAAGCCAGTGCCCTGG 0: 1
1: 0
2: 4
3: 43
4: 365
1092278996_1092278998 -2 Left 1092278996 12:7085692-7085714 CCTTCTTCAAACCTACTAGGTTC 0: 1
1: 0
2: 1
3: 5
4: 120
Right 1092278998 12:7085713-7085735 TCCTGTTAGCACTATAATTTAGG 0: 1
1: 0
2: 0
3: 22
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092278996 Original CRISPR GAACCTAGTAGGTTTGAAGA AGG (reversed) Intronic
910108159 1:83653654-83653676 GAACCTAGAAGCTTGTAAGAGGG - Intergenic
911413812 1:97545432-97545454 TAACTTAGTAGGTTTGAACCTGG + Intronic
911947421 1:104130183-104130205 GAAGAGAGTAGGTTTGAAGCAGG - Intergenic
915866329 1:159503237-159503259 GAAACTAGGAGGTATGGAGAAGG - Intergenic
918951667 1:191148267-191148289 AAACCGAGTAGGTTAGAAGTGGG + Intergenic
920103412 1:203533131-203533153 CAACCTAGTAGATTGCAAGATGG + Intergenic
920583881 1:207138573-207138595 GAACCTAGTGTATTTGAAGGTGG - Intronic
920938664 1:210459798-210459820 TAAGCTAGTAAGTTTGTAGATGG - Intronic
922899741 1:229127308-229127330 GAACTTAGAAGTTTTCAAGATGG + Intergenic
1067187141 10:44040139-44040161 CCACCTAGTAGGTGTGCAGACGG - Intergenic
1074596549 10:114873089-114873111 GAACCTAGAAGGTTAGGGGATGG + Intronic
1075383691 10:122039347-122039369 GAACCTGGTAGGTTCTCAGAGGG + Intronic
1080850594 11:36065947-36065969 GAAGCGAGGATGTTTGAAGAAGG + Intronic
1084694283 11:70744501-70744523 GAGCCCAGAAGGTTGGAAGAGGG + Intronic
1086496100 11:87405942-87405964 GAACCAAGTAGTTTTGGATATGG + Intergenic
1087312790 11:96569353-96569375 AAATGTAGTAGATTTGAAGAAGG + Intergenic
1092038856 12:5365406-5365428 GAACATAGGAGGTTTGGAGAGGG + Intergenic
1092278996 12:7085692-7085714 GAACCTAGTAGGTTTGAAGAAGG - Intronic
1094292122 12:28863121-28863143 GAACCTATTATATTTGAAGGGGG + Intergenic
1100702300 12:97161460-97161482 GAACCCAGTAGGGCTGAAGCAGG + Intergenic
1103890920 12:124238548-124238570 GAACCAAGCATCTTTGAAGATGG - Intronic
1104235803 12:126935389-126935411 AAACCTAGTAAGTTGGCAGATGG - Intergenic
1105891559 13:24685872-24685894 GAAGCTAGTATGTGTGGAGAGGG + Intronic
1107804944 13:44144831-44144853 GAACCTAGAACATTTGAATATGG + Intronic
1111007630 13:82269047-82269069 GAACCTTGTGGCTTTGTAGATGG - Intergenic
1111773282 13:92626239-92626261 GAAAATATTAGGTTTGAAGGGGG + Intronic
1119715471 14:76856058-76856080 GAACCTTATAGGCTTGGAGAAGG - Intronic
1127636119 15:60871570-60871592 CAACCTAGGAGGGTTGATGAGGG + Intronic
1128831164 15:70770176-70770198 GATTCAAGTAGTTTTGAAGAAGG - Intergenic
1131228413 15:90643688-90643710 GATGCCAGTAGGTTTGAAGGGGG + Intronic
1133747187 16:8696241-8696263 GAACCCAGGAGGATTAAAGAAGG + Intronic
1133845280 16:9447732-9447754 GAACCTAGCAGGTTTCAATTTGG - Intergenic
1134854886 16:17510215-17510237 GGCCCCTGTAGGTTTGAAGATGG + Intergenic
1140250518 16:73290536-73290558 CAGCCTAGTAGGTTTCCAGAAGG + Intergenic
1145177576 17:20714232-20714254 AAACTTAGTAGGTTTGTAGCTGG - Intergenic
1149837235 17:59923942-59923964 AAACTTAGTAGGTTTGTAGCTGG - Intronic
1150082072 17:62249280-62249302 AAACTTAGTAGGTTTGTAGCTGG + Intergenic
1154045419 18:10899773-10899795 GAACATTGTAGGTTTCATGAGGG - Intronic
1157132672 18:45022070-45022092 GCTCCTAGTAGGTTTTGAGAAGG - Intronic
1161278015 19:3429738-3429760 GAGCCTGGTAGGTTTGGAGGTGG - Intronic
1162541626 19:11300031-11300053 GAACCTAGTGAGTATGAATAAGG + Intronic
1163515261 19:17759025-17759047 GAACCTGGTAGGTTGGAGGAGGG + Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927221102 2:20711051-20711073 CACCATAGTAGGTATGAAGATGG + Intronic
931131987 2:59346362-59346384 GAAACTAGTACTTTAGAAGATGG + Intergenic
933478937 2:82829664-82829686 CTACCTAGCAGGTTTGAAGCAGG - Intergenic
933894100 2:86794825-86794847 GAACCTAGGAGGAGTGAAGAAGG - Intronic
934094303 2:88584944-88584966 GAACCTTGCATGTTTTAAGAAGG + Intronic
934184907 2:89662968-89662990 GAACCTAGTGGGTAAGGAGAAGG + Intergenic
936097444 2:109541814-109541836 CAACCAAGTAGGTTTGGAGCAGG - Intergenic
936577624 2:113669151-113669173 GAGCCGAGGAGGTCTGAAGAGGG - Intergenic
937160302 2:119754846-119754868 CATGCTACTAGGTTTGAAGATGG + Intergenic
939215271 2:139228865-139228887 TAACATATTATGTTTGAAGAAGG + Intergenic
942410026 2:175699572-175699594 GAAGTTAGGAGCTTTGAAGAAGG - Intergenic
942410667 2:175705999-175706021 GAAGTTAGGAGATTTGAAGAAGG - Intergenic
944851129 2:203720402-203720424 TAACCTAGTAGGTTTGACCTAGG + Intronic
945856673 2:215077066-215077088 GAACCTACTAGGTTTACACAGGG + Intronic
948012046 2:234656685-234656707 TAACCTAGTAGCTTTGGACAAGG + Intergenic
1169791030 20:9410908-9410930 GAACCTTGTAGTATTAAAGAGGG + Intronic
1170080962 20:12475013-12475035 CATCCTAGTAAGTTTGAAGTGGG + Intergenic
1172737304 20:37136820-37136842 GTACATAGTAGGTGTAAAGACGG - Intronic
1173092150 20:39983300-39983322 GAACCCATTAGGTGGGAAGAAGG + Intergenic
1174976215 20:55338496-55338518 GAACCTACTGGATTTTAAGATGG + Intergenic
1175691849 20:61071229-61071251 GAACCTGGGAGCTTGGAAGAAGG + Intergenic
1176659857 21:9624093-9624115 GAACGTGGGAGGTCTGAAGATGG + Intergenic
1181137238 22:20776883-20776905 GAACTCAGTAGGCCTGAAGATGG - Intronic
1182279854 22:29211952-29211974 GAACCTGTTAGGGTTGAATATGG - Intronic
1183622324 22:38981834-38981856 GAAGCTGGGAGGTTGGAAGAGGG + Intronic
1183627490 22:39013733-39013755 GAAGCTGGGAGGTTGGAAGAGGG + Intergenic
1184441217 22:44517414-44517436 CATGCTAGTGGGTTTGAAGAGGG + Intergenic
952427740 3:33192728-33192750 GAACCCAGAAGGTTAGAAGGTGG + Intronic
953069230 3:39502852-39502874 GAACCTAGAAGCTTTGACGGGGG - Exonic
953613741 3:44470794-44470816 GCAACTCGTAGGATTGAAGATGG + Intronic
956354168 3:68372477-68372499 GAGCCAGGTGGGTTTGAAGATGG + Intronic
956567858 3:70659627-70659649 GTAGGTAGTAGGATTGAAGAGGG + Intergenic
956601140 3:71023686-71023708 GTACTTCTTAGGTTTGAAGATGG + Intronic
958042386 3:88242902-88242924 GAACCTAGTAAGTATGAAATAGG + Intergenic
959870834 3:111325735-111325757 GAATCTAGAAGATTGGAAGAGGG - Intronic
960531258 3:118767867-118767889 GAACCAAGAAGGATTTAAGAAGG + Intergenic
967148095 3:186623166-186623188 GAACCTAGAATGTGTCAAGAAGG - Intergenic
970516074 4:16831511-16831533 GAACGTGGTGGCTTTGAAGAAGG + Intronic
971559583 4:28059893-28059915 CAACCTATTACCTTTGAAGAAGG - Intergenic
974623628 4:64394029-64394051 GAACATATTTTGTTTGAAGAAGG - Intronic
974859490 4:67501993-67502015 GATCCTAGTAAGTATGGAGATGG + Intronic
976137106 4:81950311-81950333 TAATCTAGTAGGTTTGGAGTGGG - Intronic
976244927 4:82997398-82997420 GAACCTTGTAGATTTAAAGATGG - Intronic
976987543 4:91320839-91320861 GAACCTATTATCTTTCAAGAGGG - Intronic
977351725 4:95897274-95897296 TAACCTATGTGGTTTGAAGAGGG + Intergenic
978536763 4:109770876-109770898 GGACCTAGTACCTCTGAAGAAGG + Intronic
979470711 4:121092973-121092995 GAGACTAGTGGGTTTGAAGGGGG + Intergenic
981559663 4:146033198-146033220 GAACTTTGTAAGTTTGAACAGGG + Intergenic
983286945 4:165751900-165751922 GAATCTAGGAGCTTAGAAGAGGG + Intergenic
983990104 4:174108075-174108097 GAACCTAGAAGCTTGGAGGAGGG + Intergenic
988168883 5:27630258-27630280 GAACCTATTGGGTTAGAATACGG - Intergenic
992772615 5:80062458-80062480 GAAATTATTAGCTTTGAAGAAGG + Intronic
993585694 5:89725003-89725025 GCACCAAGTAGTTTTGAAGCAGG + Intergenic
994728434 5:103463766-103463788 GTATCTAGGAGGTATGAAGAAGG + Intergenic
998148380 5:139743360-139743382 GAACCTGGGAGGTTGGAAGCTGG + Intergenic
998459768 5:142301262-142301284 GAAACTAGAGGGTTTTAAGAAGG + Intergenic
998663377 5:144266381-144266403 GAGCCTAGAATATTTGAAGAAGG + Intronic
1002337983 5:178493614-178493636 GAACCTTGGAGGTGTGGAGATGG - Intronic
1004465656 6:15882720-15882742 GAATCTTGGAGGTTGGAAGATGG + Intergenic
1005516669 6:26561443-26561465 GAACATACTGGGTTTGAAAATGG + Intergenic
1010585817 6:77657851-77657873 GTACCTGGAATGTTTGAAGATGG - Intergenic
1011637785 6:89390464-89390486 CATCCTAGTAGGTGTGAAGTGGG - Intronic
1013097302 6:106957405-106957427 GAAGCTAGTGGGTTTTAGGATGG + Intergenic
1022204760 7:28152798-28152820 GAAGGTAGGAGGTTTGAAAAGGG + Intronic
1022683962 7:32577297-32577319 GAACCTAGTACTTTAAAAGATGG - Intronic
1023832275 7:44046418-44046440 GAACATAGGAGGTCTGAAGAGGG - Intronic
1023950493 7:44840113-44840135 GAACCCAGGAGGTTTGAGGTTGG + Intronic
1031874030 7:127118156-127118178 AAACTTAGTAGATTAGAAGAAGG + Intronic
1036932720 8:12972241-12972263 GAACCTAGAAGCTTGGACGAGGG + Intronic
1037690881 8:21180530-21180552 GAAGCTAGAAGGTATGAATATGG - Intergenic
1038848051 8:31248103-31248125 GAACCAATTAGGTATGAAGGTGG + Intergenic
1039630320 8:39105160-39105182 GAACAGATTAGTTTTGAAGAAGG + Intergenic
1043483281 8:80674238-80674260 GAACCTAGCAGGTTTGAAGGTGG - Intronic
1044405134 8:91818099-91818121 AAACCTAGTAGATTTGAATCAGG - Intergenic
1047343525 8:124005469-124005491 GAACCTAGCAGTTCTGAGGAGGG - Intronic
1049663854 8:143834263-143834285 GAACCTGCTAGCTCTGAAGATGG + Exonic
1052923337 9:33991205-33991227 GAACCTAGAAGGCTTGAACCTGG + Intronic
1055195645 9:73589747-73589769 GAACGTGGTAGGAATGAAGAGGG + Intergenic
1056503455 9:87233479-87233501 GAAGCTAGAAGGTTTTATGATGG - Intergenic
1186004948 X:5059447-5059469 CAACCTAGAAAGTGTGAAGATGG + Intergenic
1186845185 X:13523794-13523816 GAACCTAGAAGATTGGAGGAGGG + Intergenic
1189120910 X:38393929-38393951 GAAGACACTAGGTTTGAAGATGG - Intronic
1191933897 X:66405255-66405277 GAACCCAGAGGGTTTGATGAAGG - Intergenic
1199487343 X:148362557-148362579 GGACCAAGAACGTTTGAAGATGG + Intergenic