ID: 1092282000

View in Genome Browser
Species Human (GRCh38)
Location 12:7104652-7104674
Sequence GCATCCTGAACTGCTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092281998_1092282000 -3 Left 1092281998 12:7104632-7104654 CCAGCACTGGTTCATGCCTTGCA 0: 1
1: 0
2: 0
3: 27
4: 157
Right 1092282000 12:7104652-7104674 GCATCCTGAACTGCTGCAACAGG 0: 1
1: 0
2: 0
3: 9
4: 140
1092281995_1092282000 20 Left 1092281995 12:7104609-7104631 CCTGAAACAGGATGGTGTCCTGT 0: 1
1: 1
2: 2
3: 24
4: 208
Right 1092282000 12:7104652-7104674 GCATCCTGAACTGCTGCAACAGG 0: 1
1: 0
2: 0
3: 9
4: 140
1092281997_1092282000 2 Left 1092281997 12:7104627-7104649 CCTGTCCAGCACTGGTTCATGCC 0: 1
1: 0
2: 4
3: 57
4: 354
Right 1092282000 12:7104652-7104674 GCATCCTGAACTGCTGCAACAGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092282000 Original CRISPR GCATCCTGAACTGCTGCAAC AGG Intronic
902133353 1:14282749-14282771 GTATCCTGAGCTCCTGGAACAGG - Intergenic
902375868 1:16029718-16029740 GCATCCAGAACTGCAGGAAGGGG - Exonic
902397207 1:16138929-16138951 GCATCCTGAACTGATGAGGCTGG - Intronic
906781617 1:48577715-48577737 GCATCCAGCAGAGCTGCAACTGG + Intronic
906919971 1:50053685-50053707 ACATCCTAAACAGCTACAACTGG - Intronic
916585848 1:166149553-166149575 GCATGCTGAACTGATTCAGCAGG - Intronic
917026299 1:170646296-170646318 GCATCCTGAGCTGCTGGGATAGG - Intergenic
920799358 1:209173029-209173051 GCACCTTGAAGTGCTGCACCTGG - Intergenic
920926383 1:210345220-210345242 GCATCCTGAGCTGCTGGAATGGG + Intronic
922074751 1:222232508-222232530 GCATCATGAACTGCAACACCTGG + Intergenic
924439748 1:244076425-244076447 GCCTCCTAAAGTGCTGCACCTGG - Intergenic
1067544735 10:47184683-47184705 GCATCCTCAAGTGGTGCAGCTGG + Intergenic
1069844963 10:71364688-71364710 GGAGCATGAACTGCTGCCACCGG - Intergenic
1071154493 10:82673206-82673228 GCACCCTGAGCTGCTGGGACAGG + Intronic
1073041156 10:100607612-100607634 GCTTCCTGCTCTGCTGCATCTGG + Intergenic
1075427463 10:122352972-122352994 GCACCCTTATCTGCTGCATCAGG + Intergenic
1076231815 10:128826086-128826108 GGAGCCTGAATAGCTGCAACTGG + Intergenic
1077703434 11:4462247-4462269 GCAGTCTGAACTGCTGAAAAGGG + Intergenic
1079171810 11:18103673-18103695 GCACCTTGAACTGCTGGTACAGG + Intronic
1080381654 11:31777916-31777938 GTATTCTGAACTGCTCCAAGTGG - Intronic
1080857603 11:36125894-36125916 TCAACCTGATCTGCTGCAAAAGG + Intronic
1081346391 11:41992116-41992138 GCATCCTGAGCTGCTGGGATAGG + Intergenic
1083074880 11:60026533-60026555 TCATCCTGAACAGCTGAAAATGG - Intergenic
1084410568 11:69003983-69004005 GCATCCTGAACGGGGGCAACAGG + Intergenic
1089632102 11:119790198-119790220 GCCTCCTGCACAGCTCCAACAGG - Intergenic
1090290865 11:125543416-125543438 ACATCATGAACTGCTGCAAGTGG + Intergenic
1090450601 11:126802649-126802671 GCACCCTGAGCTGCTGGGACAGG + Intronic
1090640122 11:128722878-128722900 GCAGCCTGAACAGCTAGAACAGG - Intronic
1092226522 12:6751915-6751937 GCATCATTACCTGCTGCATCCGG + Exonic
1092282000 12:7104652-7104674 GCATCCTGAACTGCTGCAACAGG + Intronic
1092947249 12:13468166-13468188 GGATCCTGATCTGCTGAAGCAGG + Intergenic
1095362731 12:41363541-41363563 GCATCCTGAACAGATGCATCTGG - Intronic
1096338880 12:50780191-50780213 GCTCCCTGAACTGCTGAACCAGG - Exonic
1096662341 12:53133930-53133952 GCTTCCTGAGTAGCTGCAACTGG + Intergenic
1097566209 12:61271966-61271988 GCATACTGAACTGCTGAGATAGG - Intergenic
1097615475 12:61879655-61879677 GCATCCTGTTCTGCTGCTCCAGG - Intronic
1098868695 12:75791096-75791118 GCATCTTGAAATTCAGCAACAGG - Intergenic
1100435320 12:94565813-94565835 GTATCCTGTACTGTCGCAACTGG + Intergenic
1101382195 12:104223790-104223812 GGAGCATGAACTGCTGCATCTGG + Intronic
1102392825 12:112563361-112563383 GCATCCACAACATCTGCAACTGG - Intergenic
1102711682 12:114933483-114933505 ACATCCTGACCTGGTGCTACTGG + Intergenic
1102929684 12:116852597-116852619 GCAACAGGAACTTCTGCAACTGG + Intronic
1106911170 13:34465032-34465054 CCATCCTGAACTGCTGATCCAGG - Intergenic
1108442885 13:50473862-50473884 CCATTCTGAACTGCTCCAGCAGG - Intronic
1108546333 13:51499001-51499023 CAAGTCTGAACTGCTGCAACTGG - Intergenic
1111495422 13:89042786-89042808 GCACCCTGAACTGCTGGGATAGG - Intergenic
1112626949 13:101115909-101115931 GCCTCCTCAGCTTCTGCAACTGG + Intronic
1113904535 13:113813040-113813062 GCATCCTGAACTCCTGTCACTGG - Exonic
1114550740 14:23531497-23531519 GCATCCTGAGCTTCAGCCACGGG - Exonic
1121469639 14:94142323-94142345 GCATCCTGAGCTGCTGGGATAGG - Intergenic
1124126785 15:26944235-26944257 GCCTCCTGCTCTGCTGTAACTGG - Intronic
1125927696 15:43576742-43576764 GCACCCTGAAATGCTCCAACTGG + Intronic
1125940839 15:43676307-43676329 GCACCCTGAAATGCTCCAACTGG + Intergenic
1127678313 15:61267048-61267070 GCATCCTGATCTGCAGTGACTGG + Intergenic
1128833384 15:70789514-70789536 GCACCCTGAGCTGCTGGGACAGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1139475971 16:67202743-67202765 GCAGACTGAACGGCTGCACCAGG + Exonic
1140420241 16:74813330-74813352 GCAGCCCGAGCTGCTGGAACAGG + Intergenic
1140706683 16:77636960-77636982 GCAACCTCAACTGCTGCCAGAGG - Intergenic
1143656152 17:8294894-8294916 GCAACCTGTACTGCTGAAACAGG - Intronic
1144957119 17:19024352-19024374 GCACCTTGAAGTGCTGCACCTGG + Exonic
1149192969 17:54086036-54086058 TCAACCTGAAATGCTGCAGCTGG + Intergenic
1153662917 18:7341480-7341502 CTTTCCTGAATTGCTGCAACAGG - Intergenic
1155466673 18:26143394-26143416 GTACCCTGAACTGCTGCAATAGG + Intronic
1159160780 18:64641552-64641574 GGGGCCTGAATTGCTGCAACTGG + Intergenic
1164603000 19:29576216-29576238 GCATCCTGAGCAGCTCCAGCAGG + Intergenic
1164954802 19:32373053-32373075 GCATCCTGACATGCTGGAAGGGG + Intronic
1165427024 19:35752033-35752055 GCAGCCTGAAAGGGTGCAACAGG - Intronic
1165836005 19:38756494-38756516 GCCTCCTGAACAGCTGGGACTGG - Intronic
1166138919 19:40795204-40795226 GCTTCCAGAAATCCTGCAACTGG - Intronic
927923016 2:26988200-26988222 GCATCCTGACCTGCTAGAAGGGG + Intronic
927959492 2:27232153-27232175 GCCGCCAGACCTGCTGCAACAGG + Exonic
931872922 2:66481102-66481124 GCATCCTGATCCCCTGCAGCAGG + Intronic
931938180 2:67221431-67221453 CCATCATGAGATGCTGCAACAGG + Intergenic
935568463 2:104634558-104634580 GCATCTTGACCTGCTGCACTGGG + Intergenic
936363130 2:111825381-111825403 GCATGCTCAAGTCCTGCAACTGG + Intronic
938581412 2:132649618-132649640 GCTGCCTGCACTGGTGCAACTGG + Intronic
947250956 2:228103294-228103316 GCCTCAGGAACTGCTGCAAAGGG + Intronic
948746162 2:240095702-240095724 GCATCCGCAACTCCTGCACCTGG - Intergenic
1172936246 20:38622631-38622653 GGATCATGAAAGGCTGCAACTGG + Intronic
1175125973 20:56751738-56751760 GCATAATGAACTGTTGCAATAGG + Intergenic
1176185367 20:63775530-63775552 GCATCCTCACCTCCCGCAACAGG + Intronic
1177826485 21:26089998-26090020 CCATCCAGAACTGGTGCAAGCGG - Exonic
1179265211 21:39796995-39797017 GCATCCTCCTCTGCTGAAACTGG + Intronic
1181479146 22:23186821-23186843 GAATCCTGAACTCCTGAAGCAGG - Intronic
949637191 3:5995860-5995882 GCATCCTGCATTGGTGCATCTGG + Intergenic
950631669 3:14286140-14286162 GTACCCTGAACTGCTGCTTCTGG - Intergenic
956137216 3:66111124-66111146 GCTTCCTGAACTGTTGCCAAGGG - Intergenic
964778674 3:160310746-160310768 GCCTCCTGATGTGATGCAACAGG + Intronic
967460584 3:189741428-189741450 TCTTTCTGAACTGCTACAACGGG + Intronic
969622564 4:8286008-8286030 GCATCCTGCAGGGCTGCAGCAGG - Intronic
972408487 4:38768209-38768231 GCATCCTGAAGTCCTGCCAGGGG - Intergenic
972635733 4:40882510-40882532 GGATTCAGAACTGATGCAACTGG + Intronic
975729035 4:77319837-77319859 CCATCCTGAGCTGATGCTACAGG - Intronic
975736894 4:77389681-77389703 CCATCCTGACCTGATGCTACAGG - Intronic
976479591 4:85524781-85524803 GCAACCTGAATTACTGTAACTGG + Intronic
978602797 4:110446241-110446263 GCCTCCTGAACTTCTGCAGTGGG - Intronic
978759803 4:112344291-112344313 CCAGCCTGAACTGCTGCGAGTGG + Intronic
979292244 4:118990985-118991007 GCAGCCTGAACTGGGCCAACAGG + Intronic
980608800 4:135128913-135128935 GTTTCCTGAATTTCTGCAACAGG + Intergenic
981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG + Intergenic
983558267 4:169077352-169077374 GTGTCCAGAACTGCTGCAAAAGG + Intergenic
986199457 5:5568237-5568259 GCACCCTGAGCTGCTGGAATAGG + Intergenic
987033233 5:13994969-13994991 CCACCCTGAACTCCTGGAACGGG - Intergenic
987440742 5:17952483-17952505 ACATCCTGAACTTCTGCTCCAGG - Intergenic
987712711 5:21522793-21522815 GCAGCCTGAACTGCTGAAGATGG - Intergenic
995775648 5:115722469-115722491 GCCTCCTGAAGTGCTGGGACAGG - Intergenic
1002288625 5:178182726-178182748 GCACCCTGACCAGGTGCAACTGG - Intergenic
1003575677 6:7292315-7292337 GCATTCTGAACTTAGGCAACTGG - Intronic
1004929239 6:20445899-20445921 GCACCCTGAGCTGCTGGGACAGG - Intronic
1010191417 6:73201032-73201054 GCACCCTGAGCTGCAGCAAGGGG - Intergenic
1011944877 6:92888514-92888536 GCTCCCTGAACTGCTGAACCAGG + Intergenic
1014537227 6:122628831-122628853 GCATACTGAACACATGCAACTGG - Intronic
1016224412 6:141717465-141717487 AAACCCTGAACTACTGCAACTGG - Intergenic
1021949690 7:25762537-25762559 GTATCCAGAACTGCTGCACAGGG + Intergenic
1024948445 7:54834444-54834466 GCTTCCGGAACTGCTGGAAGAGG + Intergenic
1029215958 7:98949823-98949845 GCCTGCTGAACTACTGCAAGTGG + Exonic
1030898678 7:115094296-115094318 GCATCCTGAACAGCTACCAAAGG + Intergenic
1034290407 7:149926610-149926632 GCATCCTGCACGGCTGCACTGGG + Intergenic
1034475971 7:151282224-151282246 GCAGCCTGAGCTGCTGTCACGGG + Intergenic
1034660664 7:152766231-152766253 GCATCCTGCACGGCTGCACTGGG - Intronic
1036058613 8:5289409-5289431 GCATCTTGAACTGCTGGGATAGG - Intergenic
1036219443 8:6908924-6908946 GCATCCTGAAGTCCTGTAAATGG - Intergenic
1037362173 8:18084784-18084806 GCTTAATGAACTGCTGCATCGGG - Exonic
1038683940 8:29697959-29697981 GCATTCTAAGCTTCTGCAACAGG + Intergenic
1042879882 8:73475366-73475388 GCATCCTGATCTGTGGGAACAGG - Intronic
1047042563 8:121013148-121013170 GCTTCCTGAACTTCAGCCACAGG - Intergenic
1049130520 8:140836003-140836025 GCATCCTGAGCTGCTGGGATAGG + Intronic
1051431817 9:16987285-16987307 ACATGCTGAACTGCTGGAAAGGG + Intergenic
1061791353 9:133060879-133060901 GCCTCCTGAATTGCTGGCACCGG + Intergenic
1061795031 9:133081446-133081468 GCCTCCTGAATTGCTGGCACCGG + Intronic
1062497642 9:136839159-136839181 GCGTCCTGAACTGCCCCACCCGG - Intronic
1188304503 X:28546121-28546143 GAACCCTGAACTGCTGTAAAAGG + Intergenic
1193155263 X:78165525-78165547 ACATTCTGAGCTGCTGCACCTGG - Intergenic
1194467751 X:94254960-94254982 GTTTCCTGAATTGCTGCAGCTGG - Intergenic
1199534461 X:148886403-148886425 GCATTCTGAAATGGTGCATCTGG - Intronic
1200684710 Y:6247856-6247878 GCAGCCTTAACTTCTTCAACTGG + Exonic
1200687338 Y:6268170-6268192 GCAGCCTTAACTTCTTCAACTGG + Intergenic
1200990240 Y:9339121-9339143 GCAGCCTTAACTTCTTCAACTGG + Exonic
1200992901 Y:9359436-9359458 GCAGCCTTAACTTCTTCAACTGG + Exonic
1200995555 Y:9379714-9379736 GCAGCCTTAACTTCTTCAACTGG + Intronic
1200998220 Y:9400060-9400082 GCAGCCTTAACTTCTTCAACTGG + Exonic
1201000730 Y:9468594-9468616 GCAGCCTTAACTTCTTCAACTGG + Intronic
1201003396 Y:9488924-9488946 GCAGCCTTAACTTCTTCAACTGG + Exonic
1201006052 Y:9509206-9509228 GCAGCCTTAACTTCTTCAACTGG + Intergenic
1201008710 Y:9529519-9529541 GCAGCCTTAACTTCTTCAACTGG + Exonic
1201047935 Y:9906540-9906562 GCAGCCTTAACTTCTTCAACTGG - Intergenic
1201063289 Y:10067531-10067553 GCAGCCTTAACTTCTTCAACTGG - Intergenic
1201268979 Y:12236096-12236118 GCCTCTTGAGCTGCTGAAACTGG - Intergenic
1201664624 Y:16436028-16436050 GCAGCATGAACCGCTGCACCTGG + Intergenic