ID: 1092282030

View in Genome Browser
Species Human (GRCh38)
Location 12:7105014-7105036
Sequence GAGCTGCATCTCCCTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092282027_1092282030 20 Left 1092282027 12:7104971-7104993 CCAAAAACAGAAGGATTAAGTGA 0: 1
1: 0
2: 4
3: 43
4: 330
Right 1092282030 12:7105014-7105036 GAGCTGCATCTCCCTCCACCAGG 0: 1
1: 0
2: 2
3: 20
4: 250
1092282028_1092282030 -10 Left 1092282028 12:7105001-7105023 CCTGCCAAACAGTGAGCTGCATC 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1092282030 12:7105014-7105036 GAGCTGCATCTCCCTCCACCAGG 0: 1
1: 0
2: 2
3: 20
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092282030 Original CRISPR GAGCTGCATCTCCCTCCACC AGG Intronic
900087099 1:903974-903996 GAGCTCCCTCTCCAGCCACCCGG - Intergenic
900326322 1:2110297-2110319 GGGCTGAATCTGCCTCCAGCGGG + Intronic
900404177 1:2485314-2485336 GACCTGCAACTCCTGCCACCAGG - Intronic
900552590 1:3264291-3264313 GATATGCTGCTCCCTCCACCTGG - Intronic
901392902 1:8958757-8958779 GACCTCCATCTCTCTCCATCTGG - Intronic
901456682 1:9367082-9367104 TAGCTGCATCTCCTGCCAGCAGG + Intronic
902822676 1:18953021-18953043 GAGCTGCAGCTTCCTCCAGGTGG + Intronic
903355000 1:22741065-22741087 GACCTGCATCCCCCACCACAGGG - Intronic
904267706 1:29327076-29327098 GAGCTGCCTCTCACTCCACTGGG + Intergenic
905033170 1:34901002-34901024 GAGCGGCAGCACCCTCCCCCAGG - Intronic
905787620 1:40770652-40770674 GAGCTGCATGCCCCTCTCCCAGG + Intronic
911055483 1:93705090-93705112 GAGCTGGTTCTAGCTCCACCCGG + Intronic
912217116 1:107627098-107627120 CAGCTGCACCTCCCTTCTCCAGG + Intronic
913191827 1:116419517-116419539 CAGGTGCTTCTCCCTCGACCCGG + Intergenic
913410026 1:118541609-118541631 AAGCTGCATCTCCGGCCACATGG + Intergenic
915124203 1:153651952-153651974 CAGCTGCATCTCCATTCAGCAGG - Intergenic
917476652 1:175374711-175374733 CTGCTGCCTCTCCCTGCACCAGG - Intronic
920278628 1:204827157-204827179 GGGGTGCCTCTCCCTCCATCAGG + Intergenic
920867579 1:209766014-209766036 GTGCTCCATCTCTTTCCACCCGG - Intronic
921324073 1:213973420-213973442 TTGCTGCCTCTGCCTCCACCAGG + Intergenic
922575173 1:226656304-226656326 GAGTTTGATCTCCCTCCTCCTGG - Intronic
922606430 1:226892503-226892525 GTGCAGCATCTCCCTGCTCCAGG - Intronic
924419898 1:243898099-243898121 GAGCTGAAAGACCCTCCACCTGG + Intergenic
1062935649 10:1384488-1384510 GAGCTGCAACTCCCTCATCCTGG - Intronic
1063122488 10:3114703-3114725 GAGCATCCTTTCCCTCCACCTGG - Intronic
1063503886 10:6579679-6579701 GACCTGCCTCCCCCTCCCCCAGG + Intronic
1063603314 10:7501192-7501214 CATCTGCATCTCCTTCCAGCCGG + Intergenic
1067054157 10:43041600-43041622 CAGCTGCTCCTCCCTCCTCCTGG + Intergenic
1071040840 10:81307757-81307779 GAGCTGCTTCTCTCACAACCAGG - Intergenic
1073461205 10:103666966-103666988 GAGCTGCCTCTCAATCCAGCTGG - Intronic
1075685958 10:124365324-124365346 CAGCTACTTCTCTCTCCACCAGG + Intergenic
1075904024 10:126065035-126065057 GAGCTGCCTCTCCCTTTCCCCGG - Intronic
1076669621 10:132112294-132112316 GGGCAGCATCTCCCACCACCCGG - Intronic
1076807623 10:132866882-132866904 GAACTGGTTCTCCCACCACCTGG - Intronic
1076838732 10:133034110-133034132 TCCCTGCATCTCCCTCCACTGGG - Intergenic
1077266399 11:1652954-1652976 CTCCTGCAGCTCCCTCCACCCGG - Intergenic
1078038940 11:7839282-7839304 GAGCTGGATCACCCACCAGCTGG - Intergenic
1078403069 11:11044913-11044935 GAGCTGCATCCACCTCCCCCAGG - Intergenic
1080142845 11:28943225-28943247 GTCCTGCATCTCACTCCTCCTGG + Intergenic
1083544690 11:63539438-63539460 GAGCTGCAGCTCCCCCAGCCAGG + Intronic
1083595827 11:63917871-63917893 AAGCAGCATCCCCCTCCCCCCGG + Intergenic
1083691168 11:64409763-64409785 GAGCTTCCTCTCCCTCCTCCCGG + Intergenic
1084710817 11:70842816-70842838 GAGGTGAAGCTCCCTCCACACGG + Intronic
1084929758 11:72545597-72545619 CAGCTTCATCTCCCTCCTTCAGG + Intergenic
1085017790 11:73186541-73186563 TGCCTGCATCTCCCTCCACCTGG + Intergenic
1086400823 11:86459884-86459906 GCTCTGCAGCTTCCTCCACCTGG - Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088747777 11:112818715-112818737 GAACTGCATGTCCTACCACCTGG - Intergenic
1090247209 11:125224948-125224970 GGGGTCCATCTCCCTCCCCCAGG + Intronic
1090510659 11:127371248-127371270 GATCTGAATCTCCCTACACATGG - Intergenic
1090578435 11:128133669-128133691 GAGCTGCACCTCCCCCTCCCAGG + Intergenic
1090615735 11:128512929-128512951 GACTTACATCTCCCTCCTCCAGG + Intronic
1091133500 11:133166688-133166710 GACCTCCTTCTCCCTCCACAGGG + Intronic
1091973321 12:4806405-4806427 GAGCTGTGTCTTCCTTCACCTGG + Intronic
1092282030 12:7105014-7105036 GAGCTGCATCTCCCTCCACCAGG + Intronic
1092330651 12:7583919-7583941 TAGCTGTGTCTCCCTCCACAGGG + Intergenic
1092923723 12:13255867-13255889 CAGCTGCACCTTCCTCCTCCCGG - Intergenic
1093500492 12:19806347-19806369 GAGCTGCCAGTCCCTCCACTAGG - Intergenic
1093503585 12:19838765-19838787 GATCTGCTTCTCTATCCACCTGG - Intergenic
1093932309 12:24966642-24966664 GAGCTGCCTCTCCATGCTCCAGG + Intergenic
1097925340 12:65121270-65121292 GCGCTGCAGCTCCCTCAGCCAGG + Exonic
1100855118 12:98751154-98751176 GGGCACCATCTCCCTCAACCTGG - Intronic
1101717153 12:107320796-107320818 GAGCTGCAGCTCTCACCACTTGG + Intronic
1102497463 12:113329544-113329566 GAGCTGCACAGCCCTCCCCCAGG + Intronic
1102674407 12:114647041-114647063 GTGCTGCTTCTCCCTCCCTCTGG - Intergenic
1103700313 12:122845779-122845801 GAGCTCCAGCTCCCCGCACCCGG - Intronic
1103951670 12:124554765-124554787 AAGCTGCATCTCCCGGCACCTGG - Intronic
1104674229 12:130701887-130701909 GGGCTGCATGTACCTCCAGCGGG - Intronic
1104760488 12:131295144-131295166 GAGCTGCATCTGCATCCACAGGG - Intergenic
1104819286 12:131665641-131665663 GAGCTGCATCCGCATCCACAGGG + Intergenic
1105026279 12:132851397-132851419 AGGCTACATCTCCATCCACCGGG - Intronic
1105740937 13:23322614-23322636 CAGGTGCATCTCCATACACCGGG + Intronic
1105823051 13:24096889-24096911 CAGCAGCATCTCCTTACACCTGG - Intronic
1106242318 13:27921566-27921588 GAGCTGCTTCCCCCTACTCCCGG - Intronic
1106461769 13:29976783-29976805 GAGCCGCATGTCCCTTCTCCAGG + Intergenic
1106498815 13:30307565-30307587 CCGCTGCACCTCCCTCCCCCCGG - Intergenic
1112336813 13:98523109-98523131 CAGCAGCATCTCCCTCACCCCGG - Intronic
1112340180 13:98546558-98546580 GGGCTGCGTGTCCTTCCACCTGG + Intronic
1113631097 13:111884405-111884427 GGGCTGCACCTCCCACCATCGGG - Intergenic
1113932898 13:113977636-113977658 GAGCAGCATCACCCATCACCAGG + Intergenic
1118039353 14:61900618-61900640 GAGCTGCTTCTCTCTCCTGCAGG - Intergenic
1119611809 14:76069808-76069830 GAGTTGTAGCTCCCTCCTCCTGG + Intronic
1119695915 14:76713417-76713439 AAACTGCATCCCCCTTCACCTGG + Intergenic
1121105200 14:91274901-91274923 GAGCTGCTTTCCACTCCACCAGG + Intronic
1122027766 14:98889924-98889946 GAGCTCCATCTCATTCCAGCAGG - Intergenic
1122290571 14:100678416-100678438 AGGCTGCATCTCCCTCCTCAGGG - Intergenic
1123632916 15:22274563-22274585 CAGCTGCCCCTCCCTCCACAGGG + Intergenic
1124636233 15:31366596-31366618 ACCCTGCATCTGCCTCCACCCGG - Intronic
1127297293 15:57620023-57620045 GAGCTGCATGTCCCTCCCAAAGG - Intronic
1127918972 15:63478273-63478295 GAGATTCATCTCCTACCACCAGG + Intergenic
1128292000 15:66485127-66485149 CAGCCGCATCTCCTTCCACCTGG - Exonic
1129693824 15:77729299-77729321 CAGCTGCGCCTCCCTGCACCTGG - Intronic
1130963629 15:88681583-88681605 GAGCCCCTTCTCCCTCCTCCTGG + Intergenic
1132032536 15:98450379-98450401 CAACTGCATCTCCCTCCAGGGGG - Intronic
1132975992 16:2711498-2711520 GGCCTGCCTCTCCCTCCACCTGG + Intergenic
1133338287 16:5020767-5020789 GAGCTCCATCTTCCCCCACAGGG - Intergenic
1136567285 16:31077944-31077966 GGGCTGCCTCTGCCTCCACTGGG - Exonic
1137440132 16:48491191-48491213 CAGCAGCATCTCCCACCACTGGG - Intergenic
1142169728 16:88615252-88615274 GGGCTGCCTCTACCTCCTCCAGG + Intronic
1142619372 17:1154976-1154998 GATCTGCAGATCCCTCCTCCTGG - Intronic
1142684692 17:1571132-1571154 GAGGTGCAGCACACTCCACCTGG - Intronic
1143913979 17:10275529-10275551 GAGCTGCAACTGCCCCCACAGGG + Intergenic
1145786026 17:27594450-27594472 GTCCTGCATCTCCACCCACCTGG + Intronic
1147353226 17:39868404-39868426 GAGGTGGGGCTCCCTCCACCCGG + Exonic
1148245343 17:46026515-46026537 GAGCTGCAGATCCCCCCAGCTGG - Exonic
1150722483 17:67625448-67625470 CAGCTGCACCTGCCACCACCGGG + Intronic
1151830453 17:76546227-76546249 GAGCAGCACCTCCCTGCTCCTGG - Intronic
1151959169 17:77396459-77396481 TGGCTGCGTCTCCCTCCACAGGG + Intronic
1152336405 17:79701845-79701867 CAGCACCATCTCCCTGCACCTGG - Intergenic
1156565880 18:38189437-38189459 GAGATGCTTCTCCTTCTACCAGG - Intergenic
1157292869 18:46422511-46422533 GGACTACATCTCCCTCCACCTGG + Intronic
1157896663 18:51475436-51475458 GAGCTGGATCACCCACCAGCTGG - Intergenic
1158045050 18:53145643-53145665 TAGCTGCATCTTAATCCACCTGG - Intronic
1160720984 19:596819-596841 GAGCTGCCTCCCCCTCCCCAGGG + Intronic
1161031775 19:2061095-2061117 CAGCCGCATCTCCCTGCCCCTGG - Intergenic
1161578685 19:5068652-5068674 GAGCTGCACCTCCCGCCACTCGG - Intronic
1161587448 19:5113414-5113436 AAGCTGCCCCTCCCTCCACCAGG + Intronic
1161954562 19:7486076-7486098 GAGCTGCATCCCCCCATACCTGG + Intronic
1162046043 19:8001077-8001099 GAGCTTCAGCTTCCTCCACTGGG + Intronic
1162450559 19:10751760-10751782 GAGCTGCGTCTCCGTCGCCCAGG + Intronic
1162496771 19:11027690-11027712 GAGGTGCATCGCCCGCCTCCAGG - Intronic
1163365508 19:16873776-16873798 CAGCTGCATCTCCCTGGGCCAGG + Intronic
1163631891 19:18421709-18421731 AGGCTGCCTCTTCCTCCACCTGG - Intronic
1164599431 19:29550941-29550963 GAGCTGCAGCCCTCTCCACTGGG - Intronic
1166437908 19:42785249-42785271 GAGCTGCTTCTCCCTCACCAAGG + Intronic
1166466810 19:43039910-43039932 GGGCTGCTTCTCCCTCAACAAGG + Intronic
1166472946 19:43095988-43096010 GAGCTGCTTCTCCCTCACCAAGG + Intronic
1168192722 19:54751511-54751533 AAGCTGGGTCTCCCTCCATCTGG + Intronic
925564522 2:5235809-5235831 GAGCTGCAGCTTCCCCCTCCTGG + Intergenic
928987863 2:37198020-37198042 GAGCTGGGACTCCCGCCACCAGG - Intronic
929544931 2:42849467-42849489 GCCCTGCACCCCCCTCCACCTGG - Intergenic
929933690 2:46277760-46277782 GTGCTTCCTCTCCCTCCCCCAGG + Intergenic
931361550 2:61582210-61582232 CAGCAGCATCACCATCCACCCGG + Intergenic
932433065 2:71686879-71686901 CAGCTGCCTCTCCCTCCAGAAGG - Intergenic
932437615 2:71711928-71711950 TTTCTGCTTCTCCCTCCACCTGG + Intergenic
932558957 2:72850653-72850675 GAGCTGCGTCTCCCACCTCAGGG - Intergenic
932740283 2:74285849-74285871 GAGCCTCATCTTCCTCCCCCAGG + Exonic
933950570 2:87325981-87326003 GTGCTGCATCTCCATCCAAAGGG + Intergenic
934573362 2:95385434-95385456 GAGCAGCATCTCTCTCCTCCTGG - Exonic
935547143 2:104412586-104412608 GAAATGCCTCTCCATCCACCAGG - Intergenic
935612223 2:105037691-105037713 GAGCCGGCTCTTCCTCCACCTGG - Intergenic
936047144 2:109196718-109196740 GTGGTGCAGCTCCCTCCTCCGGG - Intronic
936329210 2:111532598-111532620 GTGCTGCATCTCCATCCAAAGGG - Intergenic
936618646 2:114073177-114073199 CACCTCCATCTCTCTCCACCTGG - Intergenic
937268035 2:120629647-120629669 GAGGAGCATCTCCCACCCCCGGG - Intergenic
939893120 2:147760774-147760796 AAGCTACTTCTACCTCCACCAGG - Intergenic
940055442 2:149508038-149508060 GAGCTGCCTCTCCCTCTGCTGGG - Intergenic
940317168 2:152337079-152337101 GAGCTCTCTCTCCCGCCACCTGG + Intronic
943347770 2:186760295-186760317 GAGTTGCAGCTCCTTCTACCTGG - Intronic
947104153 2:226650610-226650632 GCCATGCATCTCCCTCCAGCTGG + Intergenic
947445193 2:230157653-230157675 GAGCAGCATCTCCCGACTCCTGG - Intergenic
947924748 2:233911488-233911510 GGGCTGCATTTCTCCCCACCAGG + Intergenic
948151478 2:235747935-235747957 GAGCTGCCCCTCCCGCCAGCGGG - Intronic
1169074204 20:2751574-2751596 TCGCTGCAGCCCCCTCCACCAGG - Intronic
1169282753 20:4280955-4280977 CTGCAGCATCTCCTTCCACCAGG - Intergenic
1169816174 20:9658983-9659005 GAGCTACATGTCCCACCAACAGG + Intronic
1170614384 20:17937185-17937207 GAGCTGCAGCTGCATCCAGCTGG + Intergenic
1171105213 20:22426873-22426895 GAGCTCCATCTCTCTTCACCTGG + Intergenic
1171749947 20:29038916-29038938 GAGCAGCAAGTCCCTGCACCGGG + Intergenic
1175081693 20:56426045-56426067 CAGCTTCATCTCCCTCTCCCAGG + Intronic
1175128022 20:56766942-56766964 GGTCTGCATCTCCCTCCTCTCGG - Intergenic
1175308419 20:57994084-57994106 GAGCTGCTTCACCCTCCACCTGG - Intergenic
1175561618 20:59934482-59934504 GAGCTGCATCTCAGTGCACGTGG - Intronic
1175650215 20:60715373-60715395 GAGCTTCAGCTCCTCCCACCAGG + Intergenic
1176110644 20:63409098-63409120 GAGCTGCGGCTCCATGCACCAGG + Intronic
1176131001 20:63496824-63496846 GGGCTGCATCACCCTTTACCTGG - Intronic
1176315279 21:5237000-5237022 GAGCAGCAAGTCCCTGCACCGGG - Intergenic
1177845540 21:26283851-26283873 GAGCTGCATCACCTGCCAGCTGG - Intergenic
1178258481 21:31076875-31076897 TAGCTGCTTCTCCCAGCACCCGG - Intergenic
1179460431 21:41531134-41531156 GAGCTGCTTCTCACTCTTCCAGG - Intergenic
1179888607 21:44325052-44325074 GAGCTGCCACTCCCTCTCCCAGG + Intronic
1180106266 21:45620194-45620216 GAGCCCCATCTACCTCCACTAGG + Intergenic
1181962778 22:26634942-26634964 CAGCTGCCTCTTCCTCCAACAGG + Intergenic
1183249994 22:36723630-36723652 AGGCTGCTTCTCCCTCCACATGG - Intergenic
1183523436 22:38309892-38309914 GAGCTGCCTCCCCCTGCAGCAGG + Intronic
1183548906 22:38469633-38469655 GAGCTGATTCTCCCCTCACCAGG - Intronic
1184071973 22:42152258-42152280 GACCCGCATCTCCCGCCCCCAGG - Intergenic
1184892813 22:47389951-47389973 GACCTCCATCTTCCTGCACCGGG + Intergenic
1185060443 22:48603682-48603704 CAGCTGCCTCTCCCTTCTCCTGG + Intronic
1185205749 22:49537080-49537102 GAGCTGCCTCTGCCTCCGCATGG - Intronic
949513135 3:4783863-4783885 GGGCTTCATCTCCGTCCACTTGG - Exonic
950111775 3:10423359-10423381 GAGCTGAACCTCCCTGGACCTGG - Intronic
954576895 3:51681241-51681263 AAACTTCCTCTCCCTCCACCTGG - Intronic
955101946 3:55859148-55859170 GAGCTGTATGTCTCTCCATCTGG - Intronic
956477390 3:69637053-69637075 CAGATGCCTCTCCCCCCACCAGG + Intergenic
958187106 3:90136228-90136250 GGGCTGCACCTCCCACCACAGGG + Intergenic
958863273 3:99469859-99469881 AAGCTCCCCCTCCCTCCACCAGG - Intergenic
960191289 3:114709501-114709523 GAGTTGTCTCTCCCTGCACCAGG - Intronic
960997359 3:123348948-123348970 CTGCTTCGTCTCCCTCCACCTGG + Intronic
961046794 3:123714250-123714272 CAGCAGCATCTCCCTCCTCATGG - Intronic
962850234 3:139302938-139302960 GATCTGGACCTACCTCCACCAGG - Intronic
966910540 3:184557188-184557210 GGGCTGCAGCTCCTTACACCCGG - Intronic
967949732 3:194831624-194831646 CAGATGCAGCTCCCTCTACCCGG - Intergenic
968312219 3:197693500-197693522 GAGCAGCCACTCCATCCACCTGG + Intronic
968704009 4:2069734-2069756 GAGCTGCAGCACCCTCGGCCTGG - Intergenic
968832874 4:2942238-2942260 GAGCAGCCTCTCCCTCCGCTGGG - Exonic
969581631 4:8068740-8068762 GGGCTGCACCTCCCTGCAGCAGG + Intronic
970114146 4:12674459-12674481 GAGCTGAGTCTCTCACCACCTGG + Intergenic
970192794 4:13531236-13531258 GAGCTGCTTCTCCTTCTCCCTGG - Intergenic
970931607 4:21518448-21518470 CCGCTGCATCTCCCACCAGCAGG - Intronic
974307300 4:60157702-60157724 CAGATGCCTCTCCCCCCACCAGG - Intergenic
975797342 4:78021727-78021749 GTCCTTCATCCCCCTCCACCTGG + Intergenic
975865744 4:78722111-78722133 GAGGAGCATCTCCATCCCCCGGG - Intergenic
976274429 4:83261637-83261659 GGGCTGCCTCTCCCTCTTCCCGG - Intronic
976429372 4:84945203-84945225 TAACTGCTTCTCCTTCCACCTGG - Intronic
979133968 4:117085421-117085443 GAGCCGCAGCTGCCTCCCCCTGG + Exonic
981050368 4:140303738-140303760 GAGCTCCATTTCCCTATACCTGG - Intronic
983120156 4:163873517-163873539 CGGCTGCATCTCCCACCATCAGG - Intronic
984714034 4:182910120-182910142 CTGCTGCATCTCACTGCACCAGG - Intronic
985034155 4:185821239-185821261 CAGCTGCCACTTCCTCCACCTGG - Intronic
985892504 5:2726557-2726579 GAGCAGCCTCTCCCTCCAGGGGG - Intergenic
986092068 5:4519426-4519448 CATTTGCATCGCCCTCCACCTGG + Intergenic
989100125 5:37815447-37815469 TAGCTGGATCTCCCTCTACCAGG + Intronic
997383732 5:133456257-133456279 GGGCTTCATCTCCACCCACCAGG - Intronic
997661833 5:135595099-135595121 GGGCTCCACCTGCCTCCACCAGG - Intergenic
998625808 5:143844358-143844380 GAGCATCATCTGCCTTCACCAGG + Intergenic
1001316465 5:170644493-170644515 CACCTGCATCTCACTCCAACTGG + Intronic
1003045758 6:2731418-2731440 GAGGTGCTTCTCCCTCTGCCTGG + Intronic
1003301931 6:4892056-4892078 CAGCTCCATCTCTCTCCAGCCGG + Exonic
1004272684 6:14209917-14209939 GATGTGCACTTCCCTCCACCAGG - Intergenic
1006133142 6:31880620-31880642 TTGCTGCATCTCCCACCCCCTGG + Intronic
1006379373 6:33688699-33688721 GGGCAGCATCTCCTTCAACCTGG + Exonic
1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG + Intronic
1006924000 6:37644265-37644287 GGGCTGCATCTCCCTCAGACTGG + Intronic
1008315241 6:50031034-50031056 GCGCGTCATCTCTCTCCACCTGG + Intergenic
1010265004 6:73856191-73856213 GAGCTCCCTCTCCCACCTCCTGG - Intergenic
1010706111 6:79112716-79112738 CACCTGCAGCTCCCTCCATCTGG + Intergenic
1013359497 6:109381783-109381805 GAGCTGCCTCTCCCTGCCACTGG - Intronic
1016748165 6:147603561-147603583 TGGCTGCATCTCCCAGCACCAGG + Intronic
1016882142 6:148921810-148921832 GAGCCCCATCTCCCTCCAGTTGG + Intronic
1017896770 6:158686857-158686879 GAGCCCCTTCTCCCTCCTCCTGG + Intronic
1018709217 6:166485854-166485876 AGGCTGCATCTCCCACCACTGGG + Intronic
1022816801 7:33921888-33921910 GAGCTGGATCCCGCTTCACCTGG - Intronic
1022866840 7:34430536-34430558 GAGTAGCACCTCCCTCCAGCAGG - Intergenic
1023171516 7:37394237-37394259 GGACTGCTTCCCCCTCCACCTGG - Intronic
1024285268 7:47751657-47751679 TGGCTTCATCTCCCACCACCAGG - Intronic
1024510894 7:50204033-50204055 AATCTCCATCTCCCTCCACGAGG + Intergenic
1024544349 7:50504776-50504798 GAGATGAGTCTCCCTCCAGCAGG + Intronic
1029381890 7:100220328-100220350 GAGCAGCATCTCTCTCATCCTGG + Exonic
1029402054 7:100352778-100352800 GAGCAGCATCTCTCTCATCCTGG + Exonic
1032214741 7:129949187-129949209 GAGCTGTTTGTTCCTCCACCAGG + Intronic
1032447307 7:131995501-131995523 GAGCTGCATCCCAAGCCACCAGG - Intergenic
1032911538 7:136437133-136437155 CAGCTGGATCTCTCTCCACACGG + Intergenic
1034526720 7:151668590-151668612 GAGGTGCATCTCCCTTGTCCTGG + Intronic
1035782488 8:2239515-2239537 GAGCTGCACCTACCACCAGCTGG - Intergenic
1035809631 8:2480073-2480095 GAGCTGCACCTACCACCAGCTGG + Intergenic
1036050824 8:5194810-5194832 CAGATGCATCTCCCTATACCTGG + Intergenic
1037833752 8:22204264-22204286 GAGCTTCACCTGCCTCTACCAGG + Intronic
1037846962 8:22292031-22292053 AAGCTTCTTCTCCCTTCACCTGG - Intronic
1037890313 8:22620623-22620645 GAGCAGCAGCACCCTCCAGCAGG - Exonic
1038720250 8:30028550-30028572 CAGCCGCATCTCCCTCCACCTGG - Intergenic
1042042041 8:64602364-64602386 GATCTGCATCTCCCTATTCCTGG - Intronic
1047064131 8:121261709-121261731 GAGCTGTATCTCCCACAAACTGG - Intergenic
1048727277 8:137400740-137400762 CAACTGCATCTCCCTCAACTGGG + Intergenic
1049251428 8:141591146-141591168 GTGCTCCATCTCCCCTCACCAGG - Intergenic
1049695421 8:143982117-143982139 CAGCAGCATCACCCTCCACCAGG - Intronic
1051371230 9:16360818-16360840 GAAATGTATCTCCCTCCACCAGG + Intergenic
1055212350 9:73811931-73811953 GAGCCGCATTTGCCTCAACCTGG + Intergenic
1056561356 9:87732701-87732723 CAGCTTCATCTCCCAACACCTGG - Intergenic
1057548841 9:96037546-96037568 GGACAGCATCTCTCTCCACCTGG - Intergenic
1058431895 9:104927591-104927613 GACCTGCAGCTCTCCCCACCCGG + Intronic
1058521565 9:105818128-105818150 GTACTCCACCTCCCTCCACCAGG + Intergenic
1061233390 9:129328053-129328075 GAACTGCACCTCCATCCAACTGG - Intergenic
1062168341 9:135120170-135120192 GAGTTGTAGCTCCCTCCTCCTGG + Exonic
1062385353 9:136307168-136307190 GCGCGTCATTTCCCTCCACCTGG - Intergenic
1203454164 Un_GL000219v1:149538-149560 GAGCTGCAAGTCCCTGCACCGGG - Intergenic
1185776549 X:2807941-2807963 AAGCTGCATCTCCCTCTCCCTGG + Intronic
1187081819 X:15998103-15998125 GAGTTGCCTCCCCCTCCTCCAGG + Intergenic
1187412493 X:19063274-19063296 GAGCAGCAGCTCCCCCGACCCGG - Intronic
1187757855 X:22546379-22546401 GAGAGGAATCTCCCTTCACCAGG - Intergenic
1191762617 X:64662030-64662052 CAGATGCCCCTCCCTCCACCAGG + Intergenic
1197794613 X:130285854-130285876 GAGTTGCATCTCTCCCCACATGG - Intergenic
1201251497 Y:12062993-12063015 TAGCTTCATTTCCCTCCACAGGG - Intergenic