ID: 1092282386

View in Genome Browser
Species Human (GRCh38)
Location 12:7108205-7108227
Sequence CTCCCTGGCCACAGTCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 1, 2: 3, 3: 53, 4: 354}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092282378_1092282386 0 Left 1092282378 12:7108182-7108204 CCACTTCCCACAACCCCGGGAAT 0: 1
1: 0
2: 1
3: 24
4: 246
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282373_1092282386 27 Left 1092282373 12:7108155-7108177 CCTCCAGATGGGGGATTCAGGGC 0: 1
1: 0
2: 2
3: 11
4: 128
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282374_1092282386 24 Left 1092282374 12:7108158-7108180 CCAGATGGGGGATTCAGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282380_1092282386 -7 Left 1092282380 12:7108189-7108211 CCACAACCCCGGGAATCTCCCTG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282370_1092282386 30 Left 1092282370 12:7108152-7108174 CCTCCTCCAGATGGGGGATTCAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282376_1092282386 3 Left 1092282376 12:7108179-7108201 CCGCCACTTCCCACAACCCCGGG 0: 1
1: 0
2: 2
3: 23
4: 395
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282379_1092282386 -6 Left 1092282379 12:7108188-7108210 CCCACAACCCCGGGAATCTCCCT 0: 1
1: 0
2: 1
3: 14
4: 110
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092282386 Original CRISPR CTCCCTGGCCACAGTCCTGG CGG Intronic
900094960 1:936509-936531 CTGCCTGGTCACAGTTGTGGGGG + Intronic
900214706 1:1475295-1475317 CTTCCTGGCCTCACTGCTGGCGG + Intronic
900325720 1:2107843-2107865 CTCCCTCGACACTGCCCTGGGGG - Intronic
900376414 1:2356884-2356906 CTCACTGGCCCCAGCCTTGGGGG + Intronic
900376989 1:2359380-2359402 CTCCTTGGGCACAGTCCTCTGGG - Intronic
900414822 1:2530138-2530160 CTCCACGGCCACAGTGCTGGGGG + Exonic
900422194 1:2560465-2560487 CTCCCTGTCCAGAGTCTTGGAGG - Intronic
900671928 1:3859640-3859662 CTCCCCGGCTACAGTGTTGGGGG + Intronic
900748183 1:4375635-4375657 CTCCATGGCCTCAGTCCTCAGGG - Intergenic
900895702 1:5481501-5481523 CTCCCTGGCCACAGCTCTCCTGG + Intergenic
901137567 1:7007787-7007809 CTCCCTGGCCTCTCTTCTGGAGG - Intronic
901225554 1:7611099-7611121 CTTCCTCTCCACAGTCCCGGAGG - Intronic
901461540 1:9394841-9394863 CTCCCTGGTCACAGTGCAGGTGG - Intergenic
902197669 1:14809818-14809840 ATCACAGGCCACAGTGCTGGTGG + Intronic
903540535 1:24093834-24093856 CTCCCTGGGCTCAGAGCTGGGGG + Intronic
903650316 1:24917984-24918006 TGCCCTGGCCACACTCCTGCTGG - Intronic
903658998 1:24965602-24965624 CTCCCTGGCAACAATGGTGGTGG - Intergenic
904410785 1:30323616-30323638 CTTCCTGGTCACAGTGCTGGTGG - Intergenic
904683796 1:32246905-32246927 CTCCCAGGCCAGGGCCCTGGAGG + Intergenic
905345928 1:37311277-37311299 AGCCCTGACCTCAGTCCTGGAGG - Intergenic
905558766 1:38909247-38909269 TTCCGTGGGCACAGGCCTGGGGG + Intronic
905732851 1:40308148-40308170 GGCCCTGGCCTCTGTCCTGGTGG + Intronic
905868961 1:41392022-41392044 CTCCCTCAGCACAGCCCTGGTGG + Intergenic
906248320 1:44292677-44292699 CTGCCTGCCCACAGCCCTGGGGG + Intronic
907944304 1:59119968-59119990 CTCCCTGGTCACTGTCTTAGTGG + Intergenic
908398977 1:63752471-63752493 CTCCCTGGGCTCTGTGCTGGTGG + Intergenic
912802619 1:112729999-112730021 CTTCCTGGACACAGTCTTGAGGG - Intergenic
913698240 1:121348337-121348359 CACCCTGGCCACAGTGCAGATGG - Intronic
913971591 1:143421585-143421607 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
914065968 1:144247198-144247220 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
914113183 1:144719156-144719178 CTCCCTGGCTAGGGGCCTGGGGG - Intergenic
914139309 1:144931715-144931737 CACCCTGGCCACAGTGCAGATGG + Intronic
915102990 1:153514059-153514081 CTCCCTACCCACAGTCCCTGTGG + Intergenic
915141077 1:153769032-153769054 CTCCCTGTCTGCAGGCCTGGAGG - Intronic
915947489 1:160164214-160164236 CTCCCTGACGTCAGGCCTGGCGG + Exonic
916138722 1:161675361-161675383 CTCCCTGGCTCCAGTCCAGCCGG - Intronic
917729360 1:177858765-177858787 CTCCGTGGCAACAGTACTGCCGG + Intergenic
918316622 1:183328053-183328075 CTCTCTGGCCCAAGTCCTGGAGG - Intronic
920200626 1:204257759-204257781 CTCTCCGGCCGCACTCCTGGCGG + Exonic
920485639 1:206366993-206367015 CACCCTGGCCACAGTGCAGATGG - Intronic
921046403 1:211481023-211481045 CTCCCTGACTCTAGTCCTGGTGG + Intronic
921064019 1:211609994-211610016 CTTCCTGGACACAGTCCAGTGGG + Intergenic
922473601 1:225891025-225891047 CTCCCTGACCCCAGGCCTGGGGG + Intronic
922474659 1:225898854-225898876 CTCCCTGACCCCAGGCCTGAGGG - Intronic
924473591 1:244364780-244364802 CTGCCTGGCTTCAGTCCCGGAGG - Intronic
924918313 1:248597789-248597811 CTCCATGGGAGCAGTCCTGGGGG + Intergenic
1064035919 10:11913272-11913294 CTGCCTGCCCGCAGCCCTGGCGG - Intergenic
1064851593 10:19714574-19714596 GTCCGTGGGCACAGTCCTGGGGG + Intronic
1065942234 10:30575368-30575390 GTCCCTTGCCACAGTTCTGAAGG - Intergenic
1067054316 10:43042256-43042278 ATCCAAGACCACAGTCCTGGGGG + Intergenic
1067184148 10:44012884-44012906 CTGCTTGGCCACAGCCATGGAGG + Intergenic
1067348440 10:45455162-45455184 CTACCTGGCCACAGGCATGCAGG - Exonic
1068854247 10:61781424-61781446 CTCTATGGCCACAGTCCTCAGGG - Intergenic
1069703450 10:70442161-70442183 CTCCCTGGCCACTGTCTAGATGG + Intronic
1069819671 10:71219699-71219721 AGCCCTGGCCACAGCCCTCGAGG + Intronic
1070514342 10:77189750-77189772 CTGCCTGTCCATAATCCTGGTGG - Intronic
1071064465 10:81614390-81614412 TTCTCTCGCCCCAGTCCTGGTGG - Intergenic
1071106513 10:82103741-82103763 CTCTCTGGCCTCAGAACTGGAGG - Intronic
1071362763 10:84866616-84866638 CTCCCTCTCCACAGAGCTGGTGG - Intergenic
1071451099 10:85791981-85792003 CTCCCTGGCCTCCTGCCTGGGGG - Intronic
1072695791 10:97601876-97601898 CGCCCTGGCCAATGTCCTGGGGG + Exonic
1072808161 10:98438843-98438865 CCCTCTCGCCACAGGCCTGGAGG + Intronic
1073317650 10:102593979-102594001 TTCCTTGTCCACAGTGCTGGCGG + Exonic
1073435740 10:103514642-103514664 CTCCCTTGCCACAGTGCCAGGGG - Intronic
1075565710 10:123502312-123502334 CTCCCTGGCTCCAGTCCTGGAGG + Intergenic
1075747503 10:124737890-124737912 CTGCCTCCCCACAGTCCTAGTGG - Intronic
1076096236 10:127736840-127736862 CTCCCAAGCCACAGCCCTGGGGG + Intergenic
1076994391 11:291036-291058 TGCCATGGCCTCAGTCCTGGGGG + Exonic
1077111017 11:862306-862328 CTCCATGGCCACAGTCGGGGAGG - Intronic
1077228067 11:1447002-1447024 AGCCCTGGCCAGAGTACTGGTGG + Intronic
1077308283 11:1877442-1877464 CTCCCTGGCTAGGGGCCTGGGGG - Intronic
1077369490 11:2174778-2174800 CACGCTGGGCACAGGCCTGGAGG + Intergenic
1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG + Intronic
1078573222 11:12476953-12476975 ATCCCTGACCACAGGCCTGGGGG - Intronic
1078664488 11:13313402-13313424 CTCCCAGTCCACACTCCTAGTGG + Intronic
1080231270 11:30019078-30019100 CCCCCTGGCCTCAACCCTGGTGG + Intergenic
1080457282 11:32428762-32428784 CTTCCTGCCGAAAGTCCTGGAGG - Intronic
1081907180 11:46677502-46677524 CTGCCTGGCCAAGGTCATGGGGG + Exonic
1083272617 11:61580048-61580070 CTCCCAGGCCACTCCCCTGGCGG + Intronic
1084206130 11:67594172-67594194 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1084275133 11:68047515-68047537 CGCCCTGGCCATGGTCCTTGCGG + Exonic
1084329333 11:68421330-68421352 CACCCTGGCCACACTCCTCCCGG - Intronic
1084650570 11:70486968-70486990 CTTCCTCTCCACAGACCTGGGGG - Intronic
1084916686 11:72434105-72434127 CGCCCTGGCCGCAGCGCTGGTGG - Exonic
1086345666 11:85893353-85893375 CTCTCTGGCCTGAGTTCTGGTGG + Intronic
1088221074 11:107570434-107570456 TTCCCTGGGCACAGGCCTGGGGG + Intergenic
1089462206 11:118659890-118659912 CGCCCTGAACACAGTCCTGTGGG - Exonic
1089466736 11:118690525-118690547 CGCCCTGAACACAGTCCTGTGGG - Intergenic
1090856038 11:130609941-130609963 CTCCCTGGACAGAGTCCTCGGGG - Intergenic
1091049235 11:132352614-132352636 CACACTGGACACAGGCCTGGGGG - Intergenic
1091220278 11:133926512-133926534 CTTCCAGGCCACCTTCCTGGAGG - Intronic
1091602901 12:1928713-1928735 CTCTCTGGAAACAGTCCCGGAGG + Intergenic
1091994084 12:4979076-4979098 CTCCCTGGCCTCAGTCCTAGGGG - Intergenic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1095971955 12:47908147-47908169 CAGCCTGGCCACTGTCCTCGAGG + Intronic
1096275308 12:50202211-50202233 CTCTCTGGCAGCAGTTCTGGAGG - Intronic
1096414496 12:51401744-51401766 GTCCCTGGGCACAGGCCTGGGGG + Intronic
1096994322 12:55829520-55829542 CACCCTGGCCCCAGGCCGGGCGG - Exonic
1097794096 12:63844128-63844150 CGCCCTGGGCACAGCCCCGGCGG - Intergenic
1098356470 12:69617231-69617253 CTCCCTGGGCACAGCCCTTCAGG - Intergenic
1101455701 12:104827962-104827984 GTCCATGGGCACAGGCCTGGGGG - Intronic
1102028624 12:109727396-109727418 CTCCCTGGCCAGTCCCCTGGAGG - Intronic
1104176477 12:126337767-126337789 CCCCAGGGCCACATTCCTGGGGG - Intergenic
1104424454 12:128663545-128663567 CTCACTGGCCACAGAGATGGGGG - Intronic
1104763877 12:131314098-131314120 CTTCCTGGCCTCATTCCTGCTGG + Intergenic
1104815615 12:131643958-131643980 CTTCCTGGCCTCATTCCTGCTGG - Intergenic
1105775816 13:23659132-23659154 CGCTCTGGCCACCGTCCTGCTGG + Exonic
1106016101 13:25870378-25870400 GTCCCTGGACACAGGCCTGGGGG + Intronic
1106615436 13:31322895-31322917 CTCCCTGGCCACATTTTTTGTGG - Intronic
1110484333 13:76020121-76020143 GTCCCTGAGCACAGGCCTGGGGG + Intergenic
1111343996 13:86924860-86924882 GTCCCTGGGCACAGGCCTGGGGG + Intergenic
1112901784 13:104365651-104365673 CTCTCTGTGCACAGTCATGGAGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113698749 13:112366951-112366973 CTCCCTTGTCACCATCCTGGTGG - Intergenic
1113750410 13:112773083-112773105 CTCACAGGCCACAGCCCTCGGGG - Intronic
1113924053 13:113930541-113930563 TTCCCAGGTCAGAGTCCTGGGGG + Intergenic
1114028650 14:18555182-18555204 ATCCCTGGCCTCAGTACTGTAGG + Intergenic
1114099103 14:19361868-19361890 CTCCCGGGCCATAGTCTAGGGGG - Intergenic
1115333849 14:32225811-32225833 TTCCCTGGACAGAGACCTGGAGG - Intergenic
1115814947 14:37153571-37153593 CTTTCTAGCCCCAGTCCTGGGGG - Intronic
1118244526 14:64096417-64096439 ACCCCTGGCCACAGTCCATGAGG - Intronic
1119323533 14:73745380-73745402 GTCCCTGGCCACTGTCTAGGTGG - Intronic
1120931100 14:89849202-89849224 CTGCCTGGGCACAGACCTAGAGG - Intronic
1121085844 14:91145530-91145552 CTTCCTGTCCTCAGTCCTGGTGG - Intronic
1121320073 14:92987105-92987127 CTCCCGGGCCACTGTCCTCCAGG + Intronic
1121482258 14:94288314-94288336 CTACCTGACCACAGACTTGGTGG - Exonic
1121613136 14:95294696-95294718 CTCCCTGCCCTGTGTCCTGGGGG + Intronic
1122836302 14:104432602-104432624 GACCCTGGCCAGAGCCCTGGTGG - Intergenic
1123007718 14:105332459-105332481 CTGTGTGGCCTCAGTCCTGGAGG - Intronic
1123120078 14:105912382-105912404 CCCCATGTCCCCAGTCCTGGGGG - Intergenic
1124439780 15:29677647-29677669 GCCCCTGGCAGCAGTCCTGGAGG + Intergenic
1125380771 15:39084309-39084331 CTGCTGAGCCACAGTCCTGGTGG - Intergenic
1125681092 15:41530658-41530680 CTCTCTGCTCACAGTGCTGGGGG - Intronic
1127497039 15:59523163-59523185 CTCCTTGGCCAGAGTCCAGCTGG - Exonic
1127848084 15:62888886-62888908 CTCCCAGGCTACAGGGCTGGTGG - Intergenic
1128414944 15:67436465-67436487 TTCTCTGGCCACCGTCCTGATGG - Intronic
1128994661 15:72287775-72287797 CTAGCTGGCCACATTCCTGGTGG + Intronic
1129242504 15:74259876-74259898 CTGCATGGACACATTCCTGGGGG - Intronic
1129613764 15:77082093-77082115 CTCCCTGTCCCCAGTACTGCTGG - Intronic
1129702549 15:77776064-77776086 CTCCCTGGAAACAGCCGTGGTGG - Intronic
1130093243 15:80838341-80838363 CTGCCTCGCCACAGTTCTGGAGG - Intronic
1130093616 15:80840447-80840469 CTGCCTCGCCACAGTTCTGGAGG - Intronic
1130554663 15:84914427-84914449 TGCCCTGGGAACAGTCCTGGAGG - Intronic
1132400482 15:101502001-101502023 TCCCCGGGGCACAGTCCTGGAGG - Intronic
1132847300 16:2006502-2006524 CACCCTGGCCACTGTGCTGCGGG - Intronic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1133199441 16:4194147-4194169 CTCCATAGCCACATGCCTGGTGG + Intronic
1133282639 16:4675972-4675994 ATCCCTGGCCTGGGTCCTGGCGG + Intronic
1133763904 16:8821872-8821894 CTCCCTGGCTAGAGTCCCTGGGG - Intronic
1134023297 16:10936734-10936756 TTCCCTGGCCACAGCACTGAGGG - Intronic
1134025974 16:10954191-10954213 CTTCCTGGCCACAGGTCTGTGGG + Intronic
1134236258 16:12468630-12468652 CTCCCAGGGCTCAGTCCTTGGGG - Intronic
1134358352 16:13505842-13505864 CTCCCTGCCCAAAGACATGGGGG - Intergenic
1134681812 16:16131663-16131685 CTCCCAGGCCTCAGCACTGGGGG - Intronic
1136514389 16:30759186-30759208 CTCTCTGGCCACAGTTTGGGTGG + Exonic
1136690557 16:32025217-32025239 CTTCCTGGCCACTGTTTTGGCGG - Intergenic
1136791146 16:32968779-32968801 CTTCCTGGCCACTGTTTTGGTGG - Intergenic
1136878668 16:33885153-33885175 CTTCCTGGCCACTGTTTTGGTGG + Intergenic
1137004072 16:35255911-35255933 TTCCCTGCCCACTGCCCTGGCGG + Intergenic
1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG + Exonic
1141199016 16:81882961-81882983 CCCCATGGCCACACTCCTGGAGG + Intronic
1141767304 16:86067090-86067112 GTCCGTGGGCACAGGCCTGGGGG + Intergenic
1142399234 16:89850630-89850652 CTTCCTGGCCAGGGTCCGGGAGG + Exonic
1203093355 16_KI270728v1_random:1230240-1230262 CTTCCTGGCCACTGTTTTGGTGG - Intergenic
1142806722 17:2375349-2375371 CCCCGTGGCCACAGTGTTGGAGG + Intronic
1144622068 17:16824105-16824127 CTCCTAGGCCACAGTAGTGGGGG - Intergenic
1144884355 17:18448608-18448630 CTCCTAGGCCACAGTAGTGGGGG + Intergenic
1144946019 17:18969840-18969862 CTCCCTGGCCTTTGTCCTGCAGG - Exonic
1145026367 17:19470814-19470836 CTCACTCACCACAGTCGTGGGGG + Intergenic
1145147876 17:20495769-20495791 CTCCTAGGCCACAGTAGTGGGGG - Intergenic
1145276866 17:21436825-21436847 CTCACTCACCACAGTCATGGGGG + Intergenic
1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG + Intergenic
1145713148 17:26994655-26994677 CTCACTCACCACAGTCATGGGGG + Intergenic
1145991159 17:29080270-29080292 CTACCTGGACCCAGACCTGGAGG - Intronic
1145998055 17:29115673-29115695 CTCCCAGGCCACTCTCCTCGGGG + Exonic
1147153419 17:38531353-38531375 CTCCCTGGCCACTGTTTTGGCGG - Exonic
1147189710 17:38731306-38731328 TTCCCTGGCCACAGGCCCAGTGG + Exonic
1147464092 17:40597446-40597468 CTCCTTGGCTCCTGTCCTGGGGG + Intergenic
1147574036 17:41588440-41588462 CTCCTAGGCCACAGTAGTGGGGG - Intergenic
1147720371 17:42536256-42536278 CTCCATGGTCTCAGTCCTGCGGG - Exonic
1147921599 17:43920636-43920658 GTCCGTGGGCACAGGCCTGGGGG - Intergenic
1148127669 17:45245254-45245276 GTCCCTGGACAGTGTCCTGGCGG + Exonic
1148855367 17:50576141-50576163 CCCGCTGCCCACAGTCCTGCCGG - Exonic
1150624348 17:66832109-66832131 CTCCCTGATCACAGACCTGAGGG + Intergenic
1151572752 17:74935477-74935499 CTACCTAGCCCCAGGCCTGGAGG - Intergenic
1151594632 17:75069907-75069929 CTGCATGGCCACAGTCCAGTTGG + Intergenic
1152271826 17:79329368-79329390 CATCCTGGCCACACTCCTGCCGG + Intronic
1152472545 17:80498474-80498496 CTTCCTGGCCACAGTTCGGGAGG + Intergenic
1152540332 17:80971464-80971486 GTCCCTGGCCTCAGCACTGGGGG - Intergenic
1152570819 17:81120556-81120578 GGCCCTGACAACAGTCCTGGGGG + Exonic
1152584371 17:81182417-81182439 GTGGCTGGCCACAGGCCTGGAGG + Intergenic
1152615186 17:81334590-81334612 TTCCCAGGCCACAGCCCTGGGGG - Intergenic
1153201898 18:2655716-2655738 CTCCTGCGCCACAGTCCCGGCGG + Exonic
1154125617 18:11689671-11689693 GGCCCTGGCCCCAGTCCGGGCGG + Exonic
1155332307 18:24730740-24730762 CTGCCTTGCCAGAGTGCTGGAGG + Intergenic
1156227886 18:35127155-35127177 CTCCCTTACCCCAGTCCTAGGGG - Intronic
1157834113 18:50883365-50883387 CTCCCTGGCCCCCTACCTGGAGG - Intronic
1158370609 18:56798440-56798462 ATCCCTGGCCTCTGTCCTAGTGG - Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160458911 18:79022740-79022762 CTGCCTGGCCACGGGCCGGGGGG - Intergenic
1161258081 19:3320738-3320760 CTTCCTGGCCACAGACCTCAGGG + Intergenic
1161480445 19:4507775-4507797 CTCCCCGTCCCCAGTCCTGAGGG - Intronic
1161801707 19:6419974-6419996 CTTCCTGTCCACAGTCCCCGTGG + Intronic
1161876308 19:6913727-6913749 CTCCCTGGCCACAGTCTTCCTGG + Exonic
1162023389 19:7879178-7879200 CTCCCTGGCAGCAGTATTGGAGG - Intergenic
1162064896 19:8119346-8119368 CTCCCTGCCCTGAGTCCTGGCGG - Intronic
1162895983 19:13764879-13764901 CGCCCCGGCCATAGCCCTGGTGG + Exonic
1163676493 19:18657985-18658007 CACCATGGCAACAGTACTGGGGG + Intronic
1165075669 19:33278771-33278793 CTCTCTGGCCAGACTCCTGTGGG - Intergenic
1165907677 19:39203703-39203725 CTCCCTAGAACCAGTCCTGGAGG - Intronic
1166077680 19:40423186-40423208 CTCCATGGCCAGCCTCCTGGAGG - Exonic
1166621679 19:44306619-44306641 GTCCGTGGCCACAGGCCTGGGGG + Intergenic
1166657979 19:44626239-44626261 CTCCCTGGCCAGGGTCCAGTGGG + Intronic
1166940140 19:46357850-46357872 CTCCCTGGACCCAGTCCTTTCGG + Intronic
1166956903 19:46470924-46470946 CTGCCTGCCCACAGTCCTCTGGG + Exonic
1167642255 19:50688235-50688257 CTCCCTGGCCCCAGGGTTGGGGG + Intronic
1168076404 19:53982776-53982798 CTCCTTGGCCAGGGTCCCGGGGG - Exonic
1168081941 19:54016456-54016478 CTCCCTGACCACACTCCGAGTGG + Intergenic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
925092452 2:1166654-1166676 GTCCATGGGCACAGGCCTGGGGG - Intronic
927084026 2:19656749-19656771 CTTCCTGGCCACACTACTGTGGG + Intergenic
928177466 2:29044559-29044581 CACCCTGGCCTCAGACCTGCAGG + Intronic
928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG + Exonic
928537987 2:32258451-32258473 GTCCGTGGGCACAGGCCTGGGGG + Intronic
929238023 2:39626879-39626901 CTCCCTGTGCACAGGCCTGTCGG + Intergenic
929832185 2:45356135-45356157 GTCCCTGGCCCAGGTCCTGGTGG - Intergenic
929878199 2:45814457-45814479 ATCCCTGGCAACACTGCTGGGGG + Intronic
930290836 2:49491029-49491051 CTCTCTGGTCACTGTCCTGGGGG + Intergenic
931246876 2:60499307-60499329 CTTCTGGGCCACAGTGCTGGAGG + Intronic
932576465 2:72964967-72964989 GTCCGTGGGCACAGGCCTGGGGG - Intronic
933656242 2:84889210-84889232 CTCCACAGCCACAGTGCTGGTGG + Intronic
934176287 2:89582518-89582540 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
934286597 2:91656879-91656901 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
937097563 2:119245619-119245641 CTCCCTGGCCACACGCCTGGTGG + Exonic
938103447 2:128513619-128513641 CACACAGGCCACAGTGCTGGAGG - Intergenic
941493076 2:166166634-166166656 CCCACTGGACACAGGCCTGGAGG - Intergenic
942224692 2:173804938-173804960 CTCCCTGGCCACTGTGTTGAAGG - Intergenic
944743874 2:202636092-202636114 CTTCCTGGCCTTACTCCTGGAGG + Intronic
946491422 2:220152714-220152736 CACCCTGGCCTCAGTCCAGTAGG + Intergenic
947536674 2:230944039-230944061 CTCCCTGGCCCTAGCCCAGGAGG + Intronic
947911952 2:233807449-233807471 CACCTTGGCCACAGGCCTGGAGG + Exonic
1168956555 20:1838436-1838458 CTCCCAGGCCTCAGTCCTGCTGG + Intergenic
1169195521 20:3680392-3680414 AGCCCTGGCCTCAGTCCTGCTGG + Intronic
1169427758 20:5509860-5509882 CACCCTGGCCACTGACCTGCAGG + Intergenic
1171251592 20:23653160-23653182 CTCCCTCACCATAGTGCTGGAGG - Intergenic
1173106876 20:40145097-40145119 CTCCTTGGCCAATCTCCTGGGGG + Intergenic
1173176794 20:40770959-40770981 CTCCCTGGCCACAGACCACCTGG - Intergenic
1173647061 20:44639950-44639972 CTCTCTGGCCACAGTTCTGTAGG - Intronic
1174048008 20:47747670-47747692 CTGCCCAGCCACAGGCCTGGTGG + Intronic
1175239800 20:57538685-57538707 CTCCTTGCCCACAGTCCTTCTGG - Intergenic
1175367621 20:58466833-58466855 CTCCCCGGCCCCTGTCCTCGTGG - Intronic
1175764746 20:61584566-61584588 GTACCTGGCCACAGCCTTGGAGG + Intronic
1176033059 20:63023148-63023170 TTCCCAGGTCTCAGTCCTGGCGG + Intergenic
1176248874 20:64110546-64110568 CTCCCTGGCCCCTGCCCTAGGGG - Intergenic
1176410638 21:6447851-6447873 CCCCCTGCACACAGGCCTGGTGG + Intergenic
1177882324 21:26708941-26708963 CTCCCTGGCAATAATCCGGGGGG - Intergenic
1178615008 21:34124904-34124926 CCCCCTGGCTACAGTTTTGGTGG + Intronic
1179686132 21:43056173-43056195 CCCCCTGCACACAGGCCTGGTGG + Intronic
1179954527 21:44730860-44730882 CTCCCTGCCCAAAGCCTTGGGGG - Intergenic
1180452770 22:15482232-15482254 ATCCCTGGCCTCAGTACTGTAGG + Intergenic
1180481647 22:15760756-15760778 CTCCCGGGCCATAGTCTAGGGGG + Intergenic
1181051588 22:20240613-20240635 CTCCCCAGCCACTGCCCTGGCGG + Intergenic
1181182919 22:21079748-21079770 CTCCCTCGGCACTTTCCTGGAGG + Intergenic
1181277213 22:21694659-21694681 CTCCCTGGGCACAGACCTTAGGG - Exonic
1182088858 22:27580469-27580491 TGCCCTGGCCTCAGCCCTGGCGG + Intergenic
1183273351 22:36875777-36875799 CTCCCAGGCCACAGACTTGATGG - Exonic
1184248149 22:43245985-43246007 CCCCCATGCCACAGTCCTGCAGG - Intronic
1184283151 22:43450288-43450310 CTGCCTGGCCACATGCCTGCTGG + Intronic
1184377603 22:44124543-44124565 CTCCCTGGGGGCTGTCCTGGAGG + Intronic
1185066312 22:48633281-48633303 CTCCCAGGCCACAGCCATGCTGG - Intronic
1185335639 22:50269911-50269933 CTCCCAGGCCTCAGGCCTGGTGG + Intronic
1185346272 22:50312159-50312181 CTCCCTGCCCAAAGACCTGCAGG - Exonic
949859801 3:8494751-8494773 CTTCCTGGGCACAGAGCTGGAGG + Intergenic
950501284 3:13365496-13365518 CTCTCTGACCCCAGTCTTGGAGG + Intronic
950892108 3:16413322-16413344 CAACCAGGCCACAGCCCTGGAGG - Intronic
951133677 3:19077977-19077999 CTCCCTGGCCACTGCCCCTGTGG + Intergenic
952298839 3:32085995-32086017 CTCCTTGGGCACAGGCCTGGAGG + Intergenic
953251224 3:41247134-41247156 ATCCTGGCCCACAGTCCTGGTGG + Intronic
953461316 3:43083403-43083425 TTCCCAGGCACCAGTCCTGGAGG + Intronic
953876855 3:46671487-46671509 CTTCCTGCTCACAGCCCTGGAGG - Exonic
954292022 3:49654827-49654849 CACCCTGGCCAAAGTCAAGGCGG - Exonic
954366317 3:50148033-50148055 CTGTGTGGCCACAGTCCTGGGGG - Intergenic
954467281 3:50663407-50663429 CCCACTTGCCACAGTGCTGGTGG + Intergenic
954710783 3:52504195-52504217 CTCCCTGCCAACTGTGCTGGGGG - Intronic
955216609 3:56989509-56989531 CCCCCTGGGCACAGACCTGCTGG - Intronic
956637690 3:71382479-71382501 CTCCCTGGCCACAGGGAGGGTGG + Intronic
957136503 3:76295324-76295346 CTCTATGGGCATAGTCCTGGTGG - Intronic
959106579 3:102071577-102071599 CCCCCAGGCCACAGACCTGTAGG - Intergenic
961135668 3:124508284-124508306 CTCCCTGGTCACAACCCTGGAGG + Intronic
961478634 3:127164813-127164835 CTCCCAAGCCACAGGGCTGGAGG - Intergenic
961913191 3:130342616-130342638 CTCCCTAGCCACAGTTCTTTGGG - Intergenic
962095182 3:132285535-132285557 GTCCGTGGGCACAGGCCTGGGGG + Intergenic
962291112 3:134137023-134137045 CTCACTGGCCTCAGTCCTTTTGG + Intronic
966502333 3:180657324-180657346 CTCCCTGGTCACATTCATAGTGG - Intronic
967994349 3:195155302-195155324 CTCCCTGCCGACCTTCCTGGAGG - Intronic
968655481 4:1776740-1776762 CTCACTGGCCACTGTGCAGGTGG + Intergenic
968760054 4:2438077-2438099 CTACCTAGCCACATTCCTGCTGG + Exonic
969444156 4:7234635-7234657 CTCCCTGGCCATTGTCCTCTAGG + Intronic
969724684 4:8912115-8912137 TGGCCTGGCCACAGGCCTGGCGG + Intergenic
969808290 4:9627712-9627734 CTACCTAGACAGAGTCCTGGGGG + Intergenic
969866229 4:10078633-10078655 CTCACTGTCCACAGTCTTGTGGG + Intronic
974250690 4:59379045-59379067 GTCCCTGGGCAGAGGCCTGGGGG + Intergenic
979472140 4:121111406-121111428 TTCCCTGTCCAGTGTCCTGGTGG - Intergenic
981020746 4:140025575-140025597 TTTCCTGGCCTCAGTCCTAGGGG - Intronic
985280982 4:188285144-188285166 TTCCCTGACCCCAGTCATGGTGG - Intergenic
985822646 5:2170483-2170505 TCCCCTGGCCACGGTGCTGGAGG + Intergenic
986314346 5:6576318-6576340 CTCCCTGGAGACACTCCTGTGGG - Intergenic
986530085 5:8726890-8726912 CTCTCTAGCCACAGGCCCGGAGG - Intergenic
987524515 5:19030397-19030419 GTCCCTGGGCACAGTCCCGAAGG + Intergenic
988038160 5:25853799-25853821 GTCCCTGGGCACAGGCCAGGAGG + Intergenic
990792419 5:59496413-59496435 GTCCGTGGGCACAGGCCTGGGGG + Intronic
992229698 5:74651948-74651970 CTACCTGACCACAGGCCAGGAGG - Intronic
994705954 5:103206877-103206899 CTCCCTGTCCGCAGTCCTTGAGG - Intronic
996566107 5:124881024-124881046 GTCCCTGGGCACAGGGCTGGGGG + Intergenic
997615252 5:135241785-135241807 CTCCCTGGTCACTTTCCTGGTGG + Intronic
998205690 5:140155454-140155476 AACCCTGGCCCCAGCCCTGGGGG - Intergenic
999251943 5:150188016-150188038 CTCCATCCCCACAGCCCTGGTGG - Intergenic
999307883 5:150532389-150532411 TTCCCTTGCCAGAGGCCTGGCGG + Intronic
999928518 5:156405786-156405808 CTCCCTGGCTATAGGCCTGGGGG + Intronic
1001181096 5:169521596-169521618 GTCCCTGGGCACAGGCCTGGAGG - Intergenic
1001716991 5:173824452-173824474 CTCCCTGTAAACAGTCCAGGGGG - Intergenic
1002557347 5:180053259-180053281 ATGCCTGGCCACTGTCCTGTGGG - Intronic
1002643702 5:180642627-180642649 CTCCTGGGCTCCAGTCCTGGAGG + Intronic
1002649611 5:180681886-180681908 TTCCCTGGCGACAGTGCTGCCGG + Intergenic
1002705875 5:181160665-181160687 CGACCTGGCCCCAGCCCTGGGGG - Intergenic
1003809964 6:9768314-9768336 GTCCATGGGCACAGGCCTGGGGG + Intronic
1003979530 6:11376967-11376989 AGCTCTGGCCACAGTTCTGGAGG + Intronic
1004143730 6:13045764-13045786 CTGCCTGTCCACAGTGCAGGAGG + Intronic
1005461139 6:26071302-26071324 GTCCCTGGGCACAGGCCTGGGGG - Intergenic
1005952580 6:30642754-30642776 CTCCCTGTCCCCAGTTCTGAAGG + Exonic
1005970338 6:30756028-30756050 CTCCCTGCCCAGACTCCTTGTGG + Intergenic
1006171677 6:32096805-32096827 CGCCCTCGCCACAGTCCCAGGGG + Intronic
1006297044 6:33174299-33174321 CTCCCTGGCCACTGCCTTTGTGG - Intronic
1006410769 6:33872070-33872092 CTTCCTCTCCACAGCCCTGGAGG - Intergenic
1007074970 6:39060545-39060567 CTCTGTGGCCACAGCCCTGCTGG - Intronic
1007119346 6:39367312-39367334 GTCCCTGGCCAGAGTCCCCGTGG - Intronic
1007389286 6:41541048-41541070 CAGCCTCGCCCCAGTCCTGGGGG + Intergenic
1007606952 6:43124137-43124159 TTCCCAGACCACAGTCCTGGGGG + Intronic
1007798143 6:44367906-44367928 CTGCATGGCCCCAGTCCTTGAGG + Intronic
1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG + Intergenic
1009742735 6:67768528-67768550 CTTCATGGCCAGATTCCTGGGGG - Intergenic
1010496364 6:76537714-76537736 CTCTCTTGCCCCAGTTCTGGTGG + Intergenic
1011398667 6:86937142-86937164 CTTGCCGGCCACAGCCCTGGCGG - Intergenic
1011916363 6:92511382-92511404 CTCCCTGATCTCAGGCCTGGAGG + Intergenic
1016563376 6:145423494-145423516 CCCCCTGGCCACAGTGCTTGTGG + Intergenic
1017175018 6:151494315-151494337 GTCCCAGGCCACAGCCCTCGCGG - Intronic
1017771495 6:157648312-157648334 TGCCCTGGACACAGTCATGGTGG - Intronic
1018669273 6:166166554-166166576 CTCGCTGGTCCCAGACCTGGCGG + Intronic
1018794472 6:167175136-167175158 GTCCCTGGGCACAGGCCCGGGGG + Intronic
1018821847 6:167379931-167379953 GTCCCTGGGCACAGGCCTGGGGG - Intronic
1019054589 6:169213913-169213935 CTCCACGGCCACAGCCCTGTGGG - Intergenic
1019180799 6:170186420-170186442 CTGTCTGGCCACACCCCTGGGGG + Intergenic
1019367888 7:644650-644672 CTCCCTGTCCGGAGGCCTGGGGG - Intronic
1019481746 7:1270157-1270179 CGACCTGGGCACGGTCCTGGGGG + Intergenic
1019601489 7:1885911-1885933 ATCTCTGGCCCCAGCCCTGGGGG + Intronic
1022589779 7:31650635-31650657 CTGCTTAGTCACAGTCCTGGAGG - Intronic
1022805957 7:33823000-33823022 CTCCCTGACCACAGGCCTAGTGG + Intergenic
1024297568 7:47857690-47857712 CTTGCTGGGCACAGTCCTGCTGG - Exonic
1024367938 7:48544531-48544553 CTCCCTGAACACAGTTTTGGGGG - Intronic
1025176605 7:56805346-56805368 CTCGCTGGACACAGTCCTGTGGG - Intergenic
1025251824 7:57356521-57356543 CTCCATTGCCACAGAACTGGGGG + Intergenic
1025695187 7:63771040-63771062 CTCGCTGGACACAGTCCTGTGGG + Intergenic
1026624332 7:71979058-71979080 TTGCCTGACCTCAGTCCTGGAGG - Intronic
1026847488 7:73706070-73706092 CTCTCGGGGCAGAGTCCTGGGGG - Intronic
1030058875 7:105607324-105607346 CTCCCTGCACACAATCCTGAGGG + Exonic
1030934051 7:115562596-115562618 ATGCCTGGCCACAATGCTGGAGG + Intergenic
1032080308 7:128855308-128855330 CACCCTGGGCACAAACCTGGAGG - Exonic
1032399124 7:131611426-131611448 CTCCCTGGACACAGGGATGGGGG + Intergenic
1033940399 7:146645431-146645453 CCCCCTGGCCACAGTGCCAGTGG + Intronic
1034405000 7:150897188-150897210 ATCCCTGGCCACACCCCTTGGGG + Intergenic
1034465375 7:151225208-151225230 ATTCCTGGCCACAGTAGTGGAGG - Intronic
1035048251 7:155983258-155983280 CTCCCTGGGGTCAGTCCTGGAGG + Intergenic
1035570001 8:666592-666614 GTCCCTGGTCACGCTCCTGGTGG + Intronic
1035611485 8:968460-968482 CTCCCTGCCCACATTCCTCCAGG + Intergenic
1036749639 8:11435626-11435648 CTGCCTCTCCACAGGCCTGGGGG - Intronic
1037893231 8:22635162-22635184 ATCCCTGGGCAGAGTCCTGAAGG - Intronic
1038333594 8:26628831-26628853 CTCAGTGGCCACAGCCCTGCAGG - Intronic
1038547567 8:28437419-28437441 CTCCCTGGGAAGAATCCTGGGGG - Intronic
1040588236 8:48764586-48764608 CTCCTTGTCCACAGCCCCGGGGG + Intergenic
1040830520 8:51671660-51671682 GTCTGGGGCCACAGTCCTGGGGG - Intronic
1047160113 8:122368964-122368986 CTCTCTTGCCACAGTCCTATAGG - Intergenic
1047779731 8:128101368-128101390 CCCACTGGCAACAGGCCTGGAGG + Intergenic
1048450122 8:134525722-134525744 CTTCCTGGCCCCAACCCTGGTGG + Intronic
1049361816 8:142215624-142215646 CTCCCTGCCCTCACACCTGGAGG + Intronic
1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG + Intronic
1049614964 8:143572059-143572081 CACCCTGTCCTCAGCCCTGGAGG - Exonic
1051666358 9:19470277-19470299 CACCCTGGCCACATCCCTGGAGG + Intergenic
1052162041 9:25274799-25274821 CACCCTGGCCACAATGGTGGGGG + Intergenic
1052452537 9:28650536-28650558 TTCCCTAGCCAAAGTCCTGTGGG + Intronic
1053089792 9:35264665-35264687 CCCCCTCACCACAGACCTGGGGG + Intronic
1055054439 9:72010862-72010884 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1056592174 9:87972629-87972651 CTCCATAGCCACAGTCCGGAGGG - Intronic
1057091644 9:92263550-92263572 ATCCCTGACCACTGTCCTGGGGG + Intronic
1057184940 9:93052192-93052214 CTACCTGGCCACAGTGATGAGGG + Intergenic
1058944893 9:109846996-109847018 CCCACTGGCCACATTGCTGGTGG - Intronic
1059467373 9:114477564-114477586 CCCACTGGCTACAGTCTTGGTGG + Intronic
1060238368 9:121882621-121882643 CTCCCTGCCCACAGTCTTCCTGG + Intronic
1060915189 9:127384712-127384734 CTCACTTGCCATAGTCCTGTGGG - Intronic
1061485333 9:130917746-130917768 CTTCCCCGCCACAGCCCTGGAGG + Intronic
1061925445 9:133803934-133803956 CCCCCTGAGCACAGTCCTGCAGG - Intronic
1062110170 9:134777832-134777854 CTCCCTGCCCTGAGTCCTGGGGG - Intronic
1187138458 X:16570810-16570832 GTCCGTGGGCACAGGCCTGGGGG - Intergenic
1187276014 X:17817191-17817213 CACCCTGTGCACAGTGCTGGGGG + Intronic
1187365375 X:18661982-18662004 GTCCGTGGGCACAGGCCTGGGGG + Intronic
1192154286 X:68732328-68732350 ATCCCTGGCCATAACCCTGGAGG - Intergenic
1192183666 X:68931475-68931497 ATCCTTGGTCAGAGTCCTGGGGG + Intergenic
1194536415 X:95109523-95109545 CTCCATGGGGACAGGCCTGGGGG + Intergenic
1195742230 X:108076553-108076575 TTCCCTGGGCACTGTCCTTGTGG - Intronic
1198588850 X:138153599-138153621 CTCCCTCGACACAGTACTGAAGG - Intergenic
1199991043 X:152987970-152987992 CCCTCTGGCCACAGTGCTGAAGG + Intergenic
1200000454 X:153057133-153057155 CATCCTCGCCACAGTCCTCGGGG - Exonic
1200099995 X:153685553-153685575 CTCCTGGGACAGAGTCCTGGAGG + Intronic