ID: 1092282386

View in Genome Browser
Species Human (GRCh38)
Location 12:7108205-7108227
Sequence CTCCCTGGCCACAGTCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 1, 2: 3, 3: 53, 4: 354}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092282376_1092282386 3 Left 1092282376 12:7108179-7108201 CCGCCACTTCCCACAACCCCGGG 0: 1
1: 0
2: 2
3: 23
4: 395
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282380_1092282386 -7 Left 1092282380 12:7108189-7108211 CCACAACCCCGGGAATCTCCCTG 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282378_1092282386 0 Left 1092282378 12:7108182-7108204 CCACTTCCCACAACCCCGGGAAT 0: 1
1: 0
2: 1
3: 24
4: 246
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282370_1092282386 30 Left 1092282370 12:7108152-7108174 CCTCCTCCAGATGGGGGATTCAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282374_1092282386 24 Left 1092282374 12:7108158-7108180 CCAGATGGGGGATTCAGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282379_1092282386 -6 Left 1092282379 12:7108188-7108210 CCCACAACCCCGGGAATCTCCCT 0: 1
1: 0
2: 1
3: 14
4: 110
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354
1092282373_1092282386 27 Left 1092282373 12:7108155-7108177 CCTCCAGATGGGGGATTCAGGGC 0: 1
1: 0
2: 2
3: 11
4: 128
Right 1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG 0: 1
1: 1
2: 3
3: 53
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092282386 Original CRISPR CTCCCTGGCCACAGTCCTGG CGG Intronic