ID: 1092283105

View in Genome Browser
Species Human (GRCh38)
Location 12:7112247-7112269
Sequence CTGCTGGTATAGAGGACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092283091_1092283105 14 Left 1092283091 12:7112210-7112232 CCATGAAGCCAGTCCCTTGTGCC 0: 1
1: 18
2: 331
3: 675
4: 1353
Right 1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1092283097_1092283105 1 Left 1092283097 12:7112223-7112245 CCCTTGTGCCAAAAAGGGTGGGG 0: 1
1: 35
2: 1130
3: 1786
4: 1453
Right 1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1092283093_1092283105 6 Left 1092283093 12:7112218-7112240 CCAGTCCCTTGTGCCAAAAAGGG 0: 1
1: 21
2: 741
3: 1106
4: 961
Right 1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1092283090_1092283105 21 Left 1092283090 12:7112203-7112225 CCGTTTTCCATGAAGCCAGTCCC 0: 1
1: 0
2: 3
3: 23
4: 232
Right 1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1092283100_1092283105 -7 Left 1092283100 12:7112231-7112253 CCAAAAAGGGTGGGGACTGCTGG 0: 2
1: 89
2: 600
3: 1043
4: 1630
Right 1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 156
1092283099_1092283105 0 Left 1092283099 12:7112224-7112246 CCTTGTGCCAAAAAGGGTGGGGA 0: 1
1: 40
2: 1172
3: 1806
4: 1550
Right 1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092283105 Original CRISPR CTGCTGGTATAGAGGACAAG GGG Intergenic
901196997 1:7445794-7445816 CTGCTGCTACAGAGGGCCAGGGG + Intronic
904439481 1:30521187-30521209 CTGCCTGTTTAGAGGACAGGGGG - Intergenic
908065670 1:60401452-60401474 CTGCTTGTAGAGAGGAAAAGGGG - Intergenic
909394641 1:75156047-75156069 CTACTGGTATTTAGGACAAAAGG - Intronic
911976685 1:104506401-104506423 CTTCTGGTAAAGAAGAAAAGAGG + Intergenic
912959253 1:114180836-114180858 TTGGTGGTATAGACGAAAAGTGG + Intergenic
913068968 1:115283171-115283193 GAGCTGGAATAGAGGACAAAAGG - Intergenic
915365508 1:155313275-155313297 GAACTGGTATAGAAGACAAGGGG - Intronic
916166887 1:161972819-161972841 CTGCTGGAAGAGAGGGCTAGAGG + Intergenic
916916726 1:169415298-169415320 TTACAGGTATAGAAGACAAGAGG - Intronic
917379144 1:174384263-174384285 CTGGTGGTATTGACTACAAGAGG + Intronic
919047399 1:192470477-192470499 CTGCTGGGGTTGAGGACAGGTGG + Intergenic
919448140 1:197735895-197735917 CTGCTGATATAATGGCCAAGAGG + Intronic
919580680 1:199367980-199368002 CCGATGGTTTAGATGACAAGGGG - Intergenic
921826722 1:219680062-219680084 CTGCTGGTAAAAAGGCAAAGAGG - Intergenic
922548552 1:226476634-226476656 CTGATGGTGGTGAGGACAAGCGG + Intergenic
1063291823 10:4757549-4757571 GTGCTGGAATAGAAGACAAAGGG + Intergenic
1063661316 10:8036576-8036598 CTGCTGGAATAGGGGAAAGGGGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1069453867 10:68538366-68538388 GTGCTGGTATAGAAAACAAGAGG - Intergenic
1070326370 10:75392048-75392070 TTGCTGGTAATGAGGAAAAGAGG + Intergenic
1071472438 10:85993199-85993221 CAGCAGGTACAGAGGACAAGGGG + Intronic
1073625853 10:105096047-105096069 CTTCAGGTATAGAAGACAAGTGG + Intronic
1074904042 10:117844971-117844993 CTGCAGTTATAGAGCAAAAGGGG + Intergenic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1077848172 11:6047839-6047861 CTACTTGTATAGAAGAAAAGAGG + Intergenic
1079309759 11:19354854-19354876 CTCCTGGCACAGGGGACAAGTGG - Intronic
1083938549 11:65882973-65882995 CTACTGGGCTAGAAGACAAGAGG + Intronic
1084171767 11:67404383-67404405 ATGCTGGGACAGAGGACAGGGGG + Intronic
1085265649 11:75236462-75236484 CTGCTGGGACAGAGGACAAAGGG + Intergenic
1085457799 11:76675084-76675106 GTGCTGGCATAGAGGAGGAGAGG + Intergenic
1085598517 11:77832803-77832825 CTGCTGTTACAGAGCACAAATGG - Intronic
1087077953 11:94142873-94142895 CTCCTGGTATAAAGGCCATGTGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089891026 11:121880864-121880886 CTGCTGGGATAAAGGGCAACTGG + Intergenic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1093328675 12:17809843-17809865 ATGCTGGGATAAAGAACAAGAGG + Intergenic
1095323184 12:40854932-40854954 GTGCTGGTATAGGGGAACAGTGG + Intronic
1096240555 12:49957693-49957715 CTTCTGGTAGTGAGGCCAAGTGG - Exonic
1097746619 12:63310600-63310622 CAGCTGGTAGAGAGGAGAAGTGG - Intergenic
1098022558 12:66170810-66170832 CAGCTGGTGTAGGGGACAGGTGG + Intergenic
1098237457 12:68431282-68431304 GTGCTAGCATAGAGGAGAAGAGG + Intergenic
1105773732 13:23637563-23637585 CTGCTGGCATAGAGGATAGCAGG + Intronic
1108570303 13:51743037-51743059 CTTCTGGGTTAGAGGACAGGTGG + Intronic
1108830276 13:54469219-54469241 CTGCTTGTGGAGAGGACATGTGG + Intergenic
1109793408 13:67278956-67278978 CAGCTGGCAGAGAGGAGAAGCGG + Intergenic
1109883018 13:68506817-68506839 CAGCTGGTACAGGGGAGAAGAGG + Intergenic
1109903787 13:68810512-68810534 GTGGTGGGATACAGGACAAGAGG + Intergenic
1110266611 13:73544534-73544556 CTGATGATAAAGAGGAAAAGAGG - Intergenic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1115777969 14:36737020-36737042 TTGCTGGTATTCATGACAAGTGG - Intronic
1115851011 14:37590560-37590582 CTGTGGGTAGAGAGGACAAAGGG + Exonic
1118720385 14:68589765-68589787 CTGCTGGGACAGAGGAAGAGAGG - Intronic
1118836538 14:69482334-69482356 CTGCTGGTGATGAGGACTAGTGG - Intergenic
1121025535 14:90613517-90613539 CTCCTAGAATACAGGACAAGGGG + Intronic
1122251618 14:100444066-100444088 CTGCTGGTCTCAAGGCCAAGTGG - Intronic
1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG + Intronic
1132387741 15:101412161-101412183 CTGTTGCTGCAGAGGACAAGGGG - Intronic
1132896434 16:2231515-2231537 CTGCTCATAAAGATGACAAGTGG - Intronic
1137571378 16:49568446-49568468 CAGCTGGTCTAGGGAACAAGGGG - Intronic
1139682115 16:68573152-68573174 CTCCTGGGAAGGAGGACAAGTGG + Intronic
1140893664 16:79306479-79306501 CTCCTGGTAGAGAGGAAGAGAGG + Intergenic
1144100787 17:11940488-11940510 CTGCTGGGGTAGAAGACAAATGG - Intronic
1146749084 17:35361309-35361331 CTGCTGGCATAGAGCATAATGGG + Intronic
1153355595 18:4131606-4131628 CTCCTGCTTTAGAGGACTAGAGG + Intronic
1156061926 18:33088583-33088605 TTGCTGGTATATAGAACAATTGG + Intronic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1157848569 18:51026959-51026981 CTGCCGGTTTAGAGGAGGAGGGG + Intronic
1159831972 18:73288050-73288072 GTGCTGGAATAGAGGAGAAGAGG - Intergenic
1161125030 19:2550989-2551011 CTGCTGGGAGGGATGACAAGAGG - Intronic
1161253309 19:3293049-3293071 CAGCTGGTATAGGGGCCAGGTGG - Intronic
1161673149 19:5625421-5625443 CTGCTGGTAAAGATGAGATGTGG + Intronic
1162759202 19:12878572-12878594 CTGCTTGCCTGGAGGACAAGGGG + Exonic
1164142860 19:22488770-22488792 CTTCTGGTAAAGAGGGCAGGAGG + Intronic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
928106621 2:28474593-28474615 CTGCTAGGAGAGAGAACAAGGGG - Intronic
929203720 2:39266202-39266224 CAGCTGGTTTAGAGCAAAAGAGG - Intronic
929591456 2:43150226-43150248 CAGCTAGTAAAGAGCACAAGTGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933755768 2:85637208-85637230 CTGGTGGTATATAGTACAAAAGG + Intronic
934095551 2:88599754-88599776 CTACTGCTTTAGAGGAAAAGAGG - Intronic
934754880 2:96817783-96817805 CTGGGGGATTAGAGGACAAGCGG - Intronic
935871207 2:107451964-107451986 CTGCTGGGATAGAGGTGGAGGGG + Intergenic
938972976 2:136449084-136449106 CTGCTGTTATTGAAGGCAAGTGG + Intergenic
942091449 2:172495486-172495508 CAGCTGGGATTGAGAACAAGGGG - Intronic
948756464 2:240162310-240162332 CTGCTGGTCTGGAGGGCATGGGG + Intergenic
1169197039 20:3688932-3688954 CGGCTGGCTTAGAGGACTAGGGG - Intronic
1170100107 20:12689593-12689615 CTGCTGGCATATATGACATGGGG - Intergenic
1172993993 20:39056531-39056553 CTGCTGGTATTTGGGACAATTGG + Intergenic
1173046419 20:39517115-39517137 GTGGTGGTAAAGAGGAGAAGGGG - Intergenic
1173242775 20:41312581-41312603 GTGCTGAGATAGAGGACAATGGG + Intronic
1177667842 21:24184941-24184963 TTCCTGGTAGAGAGGAGAAGTGG - Intergenic
1178989917 21:37344293-37344315 CTGCTGGTAGGAAGGTCAAGAGG + Intergenic
1181347443 22:22230238-22230260 TTCCTGGTATAGAAGGCAAGAGG + Intergenic
950129408 3:10531742-10531764 AGGCTGGTAGTGAGGACAAGGGG + Intronic
950136969 3:10588326-10588348 TTGCTGGTCTAGAGGAGGAGAGG + Intronic
950939546 3:16879439-16879461 CTGCTGATATTGAGAACTAGTGG + Intronic
953316611 3:41933272-41933294 CTGCTGGTCCAGAGGACCACTGG + Intronic
957980296 3:87500919-87500941 CTGCGAGTATAGAGGAGAAGAGG - Intergenic
961111004 3:124282911-124282933 CTGCTGGAAGAGGGGAGAAGGGG + Intronic
961382966 3:126508004-126508026 CTGCTGGGAAAGAGGCCAAGTGG + Exonic
961624773 3:128254348-128254370 GTGCTGGTATAGACGACTGGTGG + Intronic
961814622 3:129543138-129543160 CTGCTGGTATATAAGCCTAGTGG + Intergenic
964004292 3:151810465-151810487 TTGGTGGTATAGAGAACAAAGGG - Intergenic
964159681 3:153632014-153632036 CAGCAGGTAGAGAGGACCAGTGG + Intergenic
964307556 3:155357252-155357274 TGGCTGGTAGAGAGGAGAAGTGG - Intergenic
968032661 3:195514341-195514363 CTCCTGGTATCCAGGGCAAGTGG + Intergenic
968150541 3:196334763-196334785 CTTATGGTAAAGAAGACAAGGGG + Intronic
970021240 4:11571803-11571825 CTGCAGCTATTGAGCACAAGAGG + Intergenic
970592345 4:17570405-17570427 CTGCAGATAGAGAGGAAAAGGGG - Intergenic
973789072 4:54362146-54362168 TTTCTGGGACAGAGGACAAGAGG - Intergenic
976390894 4:84502461-84502483 CTGCAGGTAGAGAGGTCAAGTGG - Intergenic
979017585 4:115453752-115453774 CTGCTGGTATAAAAAAGAAGGGG - Intergenic
981987205 4:150872212-150872234 CTTCTGGTACAAAGAACAAGAGG + Intronic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
982724314 4:158889385-158889407 CTGCTGGAATAAGGGCCAAGAGG - Intronic
986584927 5:9305837-9305859 CTGCTGATATATTGGACCAGGGG - Intronic
987386868 5:17338345-17338367 CTCCTGGTACAGAGTAGAAGGGG + Intergenic
989240185 5:39194618-39194640 CTGCTGGGATAGGAAACAAGAGG + Intronic
992086202 5:73280579-73280601 CTGCTGGTTTAGACAACAAGTGG + Intergenic
995954481 5:117759449-117759471 CTGCTGGTAGTGAGGCCAACAGG - Intergenic
998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG + Intronic
1008065508 6:47043646-47043668 CAGCTGGTGTGGAAGACAAGTGG - Intergenic
1008601864 6:53104235-53104257 CTGCTGGGATAGAGGCAATGTGG - Intergenic
1009848730 6:69167836-69167858 TTGCTAGTGTAGGGGACAAGGGG + Intronic
1018741546 6:166732931-166732953 CTGCTGGCTTAGAGGAAATGAGG + Intronic
1019017620 6:168891313-168891335 CTGCTGCCATCCAGGACAAGAGG + Intergenic
1019300481 7:300667-300689 CTGCTGGTCCTGGGGACAAGTGG - Intergenic
1019727134 7:2609264-2609286 CCACTGGTATAGAGGGCAGGAGG - Intronic
1021859071 7:24887841-24887863 ATGCTGGCATAGAGGGCGAGAGG + Intronic
1022174559 7:27860966-27860988 CTGCTGGGACAGTGGAGAAGGGG - Intronic
1024407550 7:48999861-48999883 TTGCAGGTGTAGGGGACAAGTGG - Intergenic
1026544582 7:71310847-71310869 CTGCTGGTGTAGAAGAGAATGGG + Intronic
1027615963 7:80424459-80424481 GTTCTGGTAAAAAGGACAAGAGG + Intronic
1027846953 7:83392211-83392233 CAGCTGGTAGAGAGGACATGGGG + Intronic
1031961553 7:127994618-127994640 CCGCTGGTATTTAGGACAGGTGG + Intronic
1031976341 7:128095917-128095939 CTACTGGGATAGAAGTCAAGAGG - Intergenic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1033610417 7:142959213-142959235 CAACTGGTATAGAGGCAAAGAGG + Intronic
1035061525 7:156073024-156073046 CTGCTGGCACAGAGGGCAGGCGG + Intergenic
1035766688 8:2112135-2112157 CTGCTGGTGTATTGGCCAAGTGG - Intronic
1038861287 8:31391671-31391693 CTGCTGGTGTCAAGGACAACAGG + Intergenic
1040423128 8:47259582-47259604 CTCCTGGTGGAGATGACAAGCGG + Intergenic
1042478848 8:69280723-69280745 TTGCTGGGACAGAGCACAAGGGG + Intergenic
1044827557 8:96212740-96212762 CTGGTAGTATAGAAGACATGGGG + Intergenic
1047138419 8:122107473-122107495 CTGCTTGAAGAGAGGAGAAGTGG - Intergenic
1047556443 8:125936674-125936696 TTCCTGGTACAGAGGTCAAGAGG + Intergenic
1048009835 8:130446650-130446672 CTCCTGGTAGAGAGGAGAAAGGG - Intergenic
1048896272 8:138995219-138995241 CTGCTGGCCTAGAGGTCTAGAGG - Intergenic
1049388857 8:142357960-142357982 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388872 8:142358020-142358042 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388887 8:142358080-142358102 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388901 8:142358140-142358162 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388916 8:142358200-142358222 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1049388931 8:142358260-142358282 CTGCTGGGTTTCAGGACAAGGGG + Intronic
1052216416 9:25972000-25972022 CAGCTGGTAGAGATGAGAAGTGG + Intergenic
1052348876 9:27437968-27437990 CTGCTGGACTAGATGAAAAGGGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053658118 9:40241107-40241129 CTGCACGTATAGTGGATAAGGGG + Intronic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054370240 9:64387382-64387404 CTGCACGTATAGTGGATAAGGGG + Intronic
1054526478 9:66135114-66135136 CTGCACGTATAGTGGATAAGGGG - Intronic
1054677870 9:67877138-67877160 CTGCACGTATAGTGGATAAGGGG + Intronic
1059397582 9:114047938-114047960 CTGCTGTTGTAGAAGAGAAGTGG + Exonic
1059868086 9:118539252-118539274 CATCTGGTATGGAGTACAAGGGG - Intergenic
1060242031 9:121912251-121912273 CTTCTGGTATGGAGGCCATGTGG + Intronic
1061978812 9:134087998-134088020 CTGCAGGTACACAGGAAAAGAGG - Intergenic
1189164276 X:38844950-38844972 CTGCTGGAATGAAGGACAATGGG - Intergenic
1201589050 Y:15593567-15593589 CTGCTGGTAAAGAGGAGCTGTGG - Intergenic