ID: 1092284929

View in Genome Browser
Species Human (GRCh38)
Location 12:7123183-7123205
Sequence ACAGCCCAGAAGGGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092284929_1092284935 -1 Left 1092284929 12:7123183-7123205 CCAGCTCCACCCTTCTGGGCTGT 0: 1
1: 0
2: 0
3: 33
4: 356
Right 1092284935 12:7123205-7123227 TTTTCCAAGGCAGCAACTCTGGG 0: 1
1: 1
2: 3
3: 30
4: 277
1092284929_1092284934 -2 Left 1092284929 12:7123183-7123205 CCAGCTCCACCCTTCTGGGCTGT 0: 1
1: 0
2: 0
3: 33
4: 356
Right 1092284934 12:7123204-7123226 GTTTTCCAAGGCAGCAACTCTGG 0: 1
1: 0
2: 3
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092284929 Original CRISPR ACAGCCCAGAAGGGTGGAGC TGG (reversed) Intergenic
900112642 1:1015008-1015030 CCAGCCCAGGCAGGTGGAGCAGG - Intergenic
900285762 1:1899614-1899636 AGAGCCCACGGGGGTGGAGCAGG + Intergenic
900352511 1:2242286-2242308 ACAGCCGAGAAGAGTGCAGAGGG + Intronic
900511182 1:3061906-3061928 CCAGCACTGAAGGGTGGAGAGGG + Intergenic
901025606 1:6277282-6277304 ACAGCCCAGCTGGGGGCAGCCGG + Intronic
901207960 1:7508145-7508167 GGAGCCCAGAGAGGTGGAGCTGG + Intronic
902308930 1:15565517-15565539 GTAGCCCAGAGGGGTGGAGTAGG - Intronic
902637054 1:17741472-17741494 ACAGCTCAGAAGGGTGGTCCTGG + Intergenic
902985068 1:20149965-20149987 AGAGCCGGGAAGGGTGGAGAAGG + Exonic
903622202 1:24705952-24705974 ACAGACCAGAGAGGCGGAGCTGG + Intergenic
904035400 1:27556170-27556192 ACAGCCGGGGAGGGTGGGGCTGG - Intronic
904365255 1:30006947-30006969 ACAGTGCAGAAGAGTGCAGCAGG + Intergenic
905152362 1:35940814-35940836 ACAGCCAACAAGGTTGGAGGAGG - Intronic
905465692 1:38151510-38151532 CCAGCCCTGAAGAGGGGAGCTGG - Intergenic
905792003 1:40794830-40794852 ACAGCTCAGTGGGGAGGAGCCGG - Intronic
905803442 1:40860497-40860519 ACAGCCCAGGTGGGAGGAGGTGG - Intergenic
906299800 1:44673847-44673869 ACTGCCGAGAAGAGTGGAGAGGG + Intronic
906812594 1:48844139-48844161 AGGGCCCAGGAGGCTGGAGCAGG - Intronic
907374233 1:54022421-54022443 AGGGCCCAGCAGGGTGGAGGTGG - Intergenic
907643685 1:56219020-56219042 ACAGCCCAGAAGGGGAAAGAAGG + Intergenic
907907624 1:58798848-58798870 ACAGCCCAGCATGATGGGGCTGG + Intergenic
912462700 1:109847187-109847209 ACACTGCAGAAGGGTGCAGCAGG - Intergenic
914450655 1:147788448-147788470 GCAGCTCAGAAGGATGGAACTGG + Intergenic
914858562 1:151369346-151369368 AGGGCCAAGAAGGATGGAGCTGG + Intronic
916214174 1:162381984-162382006 AGAGCCCAGAGGGGCAGAGCCGG - Exonic
916673474 1:167045979-167046001 CCAGCCTAGAAGGGTGGAGTGGG + Intergenic
916810655 1:168302737-168302759 ACAGCACAGAAAGGGAGAGCTGG - Intronic
919156545 1:193773324-193773346 ACAGTCAGGAATGGTGGAGCTGG + Intergenic
919500952 1:198337506-198337528 ACAGCTTACATGGGTGGAGCAGG - Intergenic
919770877 1:201157804-201157826 GGAGCCCAGAATGGTGGAGAGGG + Intronic
919851969 1:201678989-201679011 GGAGCCCAGAAGGGAGGAGGTGG + Intronic
919861548 1:201741984-201742006 CCAGCCTACTAGGGTGGAGCTGG + Intronic
919974449 1:202601751-202601773 ACAGCCAGGCAGTGTGGAGCTGG + Intronic
920121477 1:203661906-203661928 ACAGGTGAGAAGGGTGGAGAAGG - Intronic
920569855 1:207008433-207008455 ACAGCCCAGAGGGTTGGAACTGG + Intronic
920657789 1:207889262-207889284 ACAGCATGGGAGGGTGGAGCAGG - Intronic
921925834 1:220709645-220709667 ACAGCCCAGAGAGGAGGTGCTGG + Intergenic
922732707 1:227959551-227959573 ACAGCCCAGGAAGGTGCAGCAGG - Intergenic
923995705 1:239491847-239491869 ACAACCCAGAAGGGTTTAGAAGG - Intronic
924458799 1:244239857-244239879 TGAGCCCAGATGAGTGGAGCAGG - Intergenic
924511478 1:244731839-244731861 ACAGCCCTGGAGGGAGGGGCAGG + Intergenic
1062906956 10:1185852-1185874 ACAGTGCAGAAGGGTGGATGAGG + Intronic
1063172946 10:3526134-3526156 AGTTCCCAGAAGGGTAGAGCTGG + Intergenic
1063575740 10:7260445-7260467 TGAGCCCACAAGGGAGGAGCTGG - Intronic
1064867274 10:19895251-19895273 CCAGCCCAGCATGGTAGAGCTGG + Intronic
1067558656 10:47289307-47289329 TCAACCCTGAAGGGTAGAGCTGG + Intergenic
1067749690 10:48962590-48962612 AGAGCCCAGATGGGTGGCACTGG - Intronic
1069980459 10:72248828-72248850 CCAGCCCAGCAGGGTGGGGTGGG + Intergenic
1071092190 10:81931505-81931527 ACAACCCAAAATGGTGGACCAGG - Intronic
1071957543 10:90775615-90775637 AAAGCCCTGGAGGGTTGAGCAGG + Intronic
1072721129 10:97781676-97781698 ACAGGGCAGCAGGGTAGAGCTGG - Intergenic
1073109153 10:101050492-101050514 ACAGCCCATAAGGTTGGGGGTGG - Intergenic
1073181373 10:101585441-101585463 ACAGCCCAGCAAGGCAGAGCAGG - Exonic
1073323708 10:102630515-102630537 ACAGCCCAGCAGGAGGGAGGCGG + Exonic
1074124063 10:110514288-110514310 AGAGCCTAGAAGAGGGGAGCTGG - Intergenic
1074697126 10:116059619-116059641 CCAGCCCAGAGGGGTGGAGAAGG - Intronic
1075587587 10:123668804-123668826 ACAGCGGAGGAGGGTTGAGCTGG + Intronic
1076083446 10:127604661-127604683 ACAGCCTAGAAGGGTGGTTGTGG + Intergenic
1076200548 10:128554374-128554396 ATAGCCCAGAAGTGTGGGTCTGG - Intergenic
1076631827 10:131856291-131856313 AGAGCCCAGGAGGGTGAGGCTGG + Intergenic
1076930892 10:133531011-133531033 ACAGCTCAGAAGGGTGCAGTAGG + Intronic
1076983095 11:215666-215688 AGAGCCCAGGAGGGAGCAGCTGG + Exonic
1077319373 11:1934337-1934359 AAAGGCCAGAAGGGAGGAGGAGG + Exonic
1077321905 11:1946554-1946576 GCTGGCCAGAAGGGTGGAGAGGG + Intergenic
1077410491 11:2401636-2401658 ACAGTGCAGAAGGGTGTGGCTGG + Intronic
1077709285 11:4519806-4519828 AGAGCCCAGAAGCGGGGAGGTGG - Intergenic
1078361720 11:10674556-10674578 AAAGCCCAGAGGAGTGGTGCTGG - Intronic
1078478228 11:11652756-11652778 GCAGCCCAGAAGGTTGGATCAGG - Intergenic
1080587843 11:33697502-33697524 ACAGTCCAGATGGCTGGAGCAGG - Intergenic
1081574322 11:44309818-44309840 ACACCCCTGGAGAGTGGAGCTGG - Exonic
1081600347 11:44488430-44488452 CCAGCCCAGCGGGGTGGAGAGGG + Intergenic
1081970505 11:47195083-47195105 CCAGGTCAGAAGGGTGGAGTGGG + Intergenic
1082205733 11:49431726-49431748 TGAGCCCAGAAAGGTGGAGGTGG + Intergenic
1082912726 11:58395312-58395334 AGAGCTCAGAGGGGTGAAGCTGG + Intergenic
1083795927 11:65016682-65016704 ACAGCCCAGAAGTGTCAGGCAGG + Intronic
1083923636 11:65793427-65793449 ACAGGCCAGGTGGGTGGAACAGG - Intronic
1084274598 11:68044917-68044939 ACAGACCAGAACGGTGGCGGGGG - Intronic
1084310753 11:68314769-68314791 AGAGCCCAGAAGGGCTGAGTGGG + Intronic
1084427929 11:69095671-69095693 AAAGCCCAGGAGCATGGAGCTGG - Intergenic
1084862034 11:72025298-72025320 ACAGCCCAGGAGGCTGAGGCAGG + Intronic
1085276206 11:75301877-75301899 ACAGCCCAGGAGGGGGAAGGAGG + Intronic
1088756566 11:112890046-112890068 ACTGCCCAGAAGGGAAGACCAGG + Intergenic
1089472297 11:118730912-118730934 GCACCCCAGAAAGGTGGAGAAGG + Intergenic
1089656201 11:119948656-119948678 ACAGTCAAGAAGCATGGAGCAGG + Intergenic
1090189847 11:124760550-124760572 AGAGCCCAGAAGAGCGGAGCCGG + Intronic
1090361428 11:126175387-126175409 AGAGGCCAGAAGAGTGGAGATGG - Intergenic
1090457414 11:126862006-126862028 ACTGCCAAGAAGGGCAGAGCTGG - Intronic
1202804921 11_KI270721v1_random:1867-1889 GCTGGCCAGAAGGGTGGAGAGGG + Intergenic
1092284929 12:7123183-7123205 ACAGCCCAGAAGGGTGGAGCTGG - Intergenic
1092789495 12:12059294-12059316 GCACCCCAGAAAGGTGGAGAAGG - Intronic
1096752275 12:53768364-53768386 AAAGGCCAGGAGGGTGGATCAGG + Intergenic
1102391259 12:112550638-112550660 AGAACACAGAAGGGTGGAGATGG + Intergenic
1102792450 12:115658629-115658651 AGAGCCCATAATGGTGGAGCTGG + Intergenic
1103119723 12:118371602-118371624 GCAGCGCAGACGAGTGGAGCGGG - Intronic
1103188856 12:118983307-118983329 ACAGGCCAGTAGGGTGTAGCAGG + Intronic
1104156424 12:126137070-126137092 ACAGCAGAGAAGAGTGAAGCTGG - Intergenic
1104918436 12:132278359-132278381 ACAGCACAGCAGGCTGGAACAGG + Intronic
1104949232 12:132431553-132431575 ACAGGGCAGAAGGCTGCAGCCGG + Intergenic
1105882900 13:24618971-24618993 ACAGCTCACATGTGTGGAGCTGG - Intergenic
1106364088 13:29060468-29060490 ACAGCGGAGAGGGGTGAAGCTGG - Intronic
1107860837 13:44659779-44659801 TCAGCCCAGCTGGATGGAGCAGG + Intergenic
1107960121 13:45549949-45549971 ACAGTCTAGAAGGGAGGATCCGG - Exonic
1114669644 14:24402334-24402356 AAAGGGGAGAAGGGTGGAGCAGG - Intronic
1118257194 14:64215568-64215590 ACAGGCCTGAAGGGAGGAGAGGG - Intronic
1119187399 14:72652440-72652462 AGAGACCAGAAGGATGGTGCTGG + Intronic
1119323472 14:73745118-73745140 AGAGCCCAGAAGTCAGGAGCAGG - Intronic
1119450574 14:74706326-74706348 GCAGCCCAGTCGGGTGGAACTGG + Intronic
1119769633 14:77212433-77212455 CCAGCCCAGCAGGGCGTAGCGGG - Intronic
1121437819 14:93930517-93930539 ACAACTAAGAAGGGTGCAGCAGG + Intergenic
1121861252 14:97320931-97320953 GCATCTCAGAAGGGTGGAACTGG - Intergenic
1122042362 14:98997881-98997903 ACAGTCCACAAGTGTGGAGGTGG + Intergenic
1122287232 14:100659090-100659112 ACAGCCCTGAGTGGTGAAGCGGG - Intergenic
1122453614 14:101832688-101832710 ACAGAGGAGCAGGGTGGAGCGGG + Intronic
1122511039 14:102267808-102267830 ACAGCCCACCATGCTGGAGCTGG + Intronic
1122589440 14:102836169-102836191 ACAGCACAGGAGGCTGGGGCTGG + Intronic
1123998911 15:25738298-25738320 CCAGAGCAGAAGGGTGGATCGGG - Intronic
1124420151 15:29514015-29514037 AGAGCCCAGATAGGGGGAGCAGG + Intronic
1126728348 15:51655691-51655713 ACAGACCAGAAGAGTGCAGTTGG + Intergenic
1127112105 15:55685353-55685375 ACTTCCCAAAAGGGTGGAGTGGG + Intronic
1127578704 15:60317153-60317175 TCAGCTCAGAAGGGTGGGGCTGG - Intergenic
1128096300 15:64959090-64959112 ATAGCCCAGAGGTGTGGAGAGGG + Intergenic
1128388019 15:67164512-67164534 TCAGCCCAGAGGTGTGGAGAGGG - Intronic
1128538073 15:68505443-68505465 ACAGCCCAGCTCGGTGAAGCTGG - Intergenic
1128866825 15:71120571-71120593 AAGGGCCAGGAGGGTGGAGCAGG - Intronic
1129567410 15:76637467-76637489 GCAGCCAAGAAGGGAGGATCAGG + Intronic
1129706748 15:77798686-77798708 ACAGCCAAGGAGGGTGGAGGGGG + Intronic
1129710210 15:77817028-77817050 AGAGCCAACAAGGGAGGAGCAGG + Intronic
1130169171 15:81494165-81494187 ACAGCTGATAAGAGTGGAGCTGG + Intergenic
1130861411 15:87894195-87894217 ACAGCCAAGCAAGGTGGAACAGG - Intronic
1130893053 15:88149694-88149716 CCTGCTCAGAAGGGTGGAGCTGG + Intronic
1131656290 15:94462189-94462211 ACATCCCAGAAGGTGGGTGCAGG - Intronic
1132279824 15:100602875-100602897 ACAGCCGAGAAGGCAGGAGGTGG - Exonic
1132306591 15:100819342-100819364 AAAGCTCAGAATGATGGAGCTGG + Intergenic
1132457302 16:31227-31249 ACAGCCCAGCAGGGAGGGGAGGG + Intergenic
1133143080 16:3762601-3762623 ACAGCCCTGCCGCGTGGAGCAGG - Intronic
1133225873 16:4340131-4340153 ACAGCCCAGAAGGGCCGGGCTGG - Intronic
1133885937 16:9827696-9827718 AAAGCACAGAAAGGTGGGGCTGG + Intronic
1134742617 16:16561286-16561308 TCAGCCCAGCATGGTGGTGCAGG + Intergenic
1135790199 16:25387167-25387189 ACATCTCAGAAGGGTGGATTTGG + Intergenic
1138304961 16:55966030-55966052 ACAGCCCTGTGGGGAGGAGCTGG - Intergenic
1139132112 16:64158984-64159006 ACACCCAAGATGGGTGGAGGAGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1139876872 16:70153216-70153238 ACAGCCCAGGAGTGATGAGCTGG - Intronic
1140430283 16:74897133-74897155 TCATCGTAGAAGGGTGGAGCTGG - Intronic
1140556646 16:75929209-75929231 ACATCCCAGTAAGATGGAGCAGG - Intergenic
1140723063 16:77788460-77788482 ACAGGAAAGAAGGGTGGGGCGGG + Intergenic
1140778333 16:78271422-78271444 ACAGCCCAGCAAGGTGATGCAGG - Intronic
1141558983 16:84854224-84854246 ACACCCCAGGAGGGAAGAGCTGG - Intronic
1141730584 16:85820400-85820422 ACAGCCAATAAAGCTGGAGCTGG + Intergenic
1142118671 16:88375064-88375086 ACAGGCCCGAAGGCTGCAGCAGG + Intergenic
1144784391 17:17823716-17823738 GCAGCCCCGAAGGGCGGGGCGGG - Intronic
1145909868 17:28536244-28536266 CCAGTCCAGAAGTGGGGAGCAGG + Intronic
1146965386 17:37024212-37024234 GCATCCCTCAAGGGTGGAGCAGG - Intronic
1148906419 17:50915229-50915251 CCAGCCCAGAAGGGTGACCCTGG - Intergenic
1149017428 17:51924659-51924681 GCAACCCCTAAGGGTGGAGCTGG - Intronic
1150098871 17:62404098-62404120 ACAGCCAGGAATGGTGGTGCAGG + Intronic
1150120745 17:62599600-62599622 GCAGGCCAGAAGGGAGGAGATGG - Intronic
1150387714 17:64774339-64774361 AAGGCCCAGGTGGGTGGAGCTGG - Intergenic
1150789454 17:68189974-68189996 ACAGCCCAGAAGACTTGTGCTGG - Intergenic
1151155220 17:72119630-72119652 AGAGCCCAAAAGGGTGGGGGGGG + Intergenic
1151333623 17:73426189-73426211 AAAGCCCAGCATGGTGGTGCAGG - Intronic
1151662553 17:75526263-75526285 ACAGCCCAGATGGCAGGGGCAGG - Intronic
1151666082 17:75545796-75545818 ACAGCCCAGAAGGAAGGGACTGG + Intronic
1151966332 17:77433608-77433630 ATAGGCCAGAGGGGTGGGGCTGG + Intronic
1151978535 17:77495941-77495963 ACAGTGCATAAGGCTGGAGCGGG - Intronic
1153225157 18:2894231-2894253 GCAGCTCAGGAGGGTGGAGAGGG + Intronic
1153584617 18:6608351-6608373 ACAGAGCAAAAAGGTGGAGCAGG - Intergenic
1153837383 18:8976222-8976244 GCAGCCCAGGAGGCTGCAGCAGG + Intergenic
1154167106 18:12023869-12023891 ATAGCCCAGTAGGGTTGAGGGGG + Intronic
1156349825 18:36294708-36294730 AGAGCCTAGAAGGGAGGAGAGGG + Intergenic
1156486991 18:37472660-37472682 ACAGCTCAGAGTGGTGGAGCTGG + Intronic
1157307028 18:46524974-46524996 AGGTCCCAGAAGGGTGGGGCTGG - Intronic
1158962883 18:62601220-62601242 AGAGCCCAGAAGTGTGGAGGTGG - Intergenic
1159184441 18:64950368-64950390 ACAGCCCACAAGTGTGGCTCTGG - Intergenic
1160050795 18:75431453-75431475 AAATCACAGAAAGGTGGAGCTGG - Intergenic
1161296565 19:3523282-3523304 AAGGCCCAGAGTGGTGGAGCTGG + Intronic
1161457802 19:4378322-4378344 ACAGCCCCGAACGGCAGAGCTGG - Intronic
1161693947 19:5754800-5754822 GCAGCTCAGAAGGATGGAGGAGG - Intronic
1161786449 19:6329204-6329226 ACAGTTCAAAAGGGTGGAGTGGG - Intronic
1162176370 19:8832832-8832854 ACAGCCCTGGAGGTTGGGGCTGG + Intronic
1162178669 19:8851337-8851359 ACAGCCCAGAAGGGAAGGTCTGG + Exonic
1162375866 19:10305066-10305088 GCAGCTCAGCAGGGTGAAGCTGG + Exonic
1163438617 19:17310141-17310163 AGGGCCCAGAATGGTGGAGGTGG - Intronic
1163446365 19:17348827-17348849 ACCGCCCAGACGGGCTGAGCTGG - Intergenic
1163591965 19:18198893-18198915 TCAGCCCGTCAGGGTGGAGCTGG - Intronic
1163809432 19:19421360-19421382 ACAGGCCAGAAGGGGTGAGGAGG - Intronic
1165114835 19:33522463-33522485 ACAGCCGAGAAGGGTTTAGGAGG + Intergenic
1165300066 19:34963227-34963249 ACAGCTCAGAACGGCAGAGCTGG - Intronic
1165906642 19:39198291-39198313 ACAGTGAGGAAGGGTGGAGCAGG - Intronic
1166376032 19:42327523-42327545 GGAGCCCAGAAGGGTAGGGCTGG - Intronic
1167193589 19:48009811-48009833 AAATCCCAGAAGGGTGCATCTGG + Intronic
1167213092 19:48145888-48145910 ACAGCTGAGAGAGGTGGAGCTGG + Intronic
1167443627 19:49524754-49524776 GCAGCCCCTCAGGGTGGAGCTGG + Exonic
1168471470 19:56643715-56643737 ACAGCTCAGAAGAGTGGGGGCGG - Intronic
924998271 2:384026-384048 CCAGCCCTGCAGGGTGGGGCTGG - Intergenic
925119018 2:1403197-1403219 ACACCCCAGAAGAATGGAGCTGG - Intronic
926208267 2:10849391-10849413 ACATCCTACAAGGCTGGAGCAGG + Intronic
926698132 2:15784849-15784871 ACAGCCCAGAAGGAGGGACAGGG - Intergenic
927576155 2:24203577-24203599 ACAGCCCACAAGGCTGGGGCTGG - Exonic
928211338 2:29326194-29326216 ACTGCCCTGAAGCTTGGAGCTGG + Intronic
928338654 2:30422088-30422110 ACAGCCCTGCAGGGTGGACTCGG - Intergenic
928408119 2:31030789-31030811 ACAGCCAAGAAGGGCAGAGACGG + Intronic
930492309 2:52091527-52091549 ACAGGCCAGAAGAGAGTAGCAGG - Intergenic
931019913 2:58032481-58032503 TCAGATCATAAGGGTGGAGCAGG - Intronic
931666748 2:64615255-64615277 ACAGCCCAGCAGCGTGGAGAAGG - Intergenic
932601512 2:73129881-73129903 ACATGCCCGAAAGGTGGAGCAGG + Intronic
933978331 2:87529682-87529704 GCAGCCCAGAAGGCTGTAGAGGG - Intergenic
935880067 2:107556487-107556509 AGAGACCAGATGGGTGGAACAGG - Intergenic
935984080 2:108655288-108655310 ACAGCCAAGAACGCTGGACCTGG - Intronic
936136516 2:109898942-109898964 ACAGCCAAGAACGCTGGACCTGG - Intergenic
936208181 2:110472543-110472565 ACAGCCAAGAACGCTGGACCTGG + Intronic
936315501 2:111421119-111421141 GCAGCCCAGAAGGCTGAAGAGGG + Intergenic
937119261 2:119430793-119430815 ACCGCCAAAAAGGGTGGAGGTGG - Intronic
937430080 2:121831011-121831033 ACATCCCAGGTGGATGGAGCAGG + Intergenic
937875359 2:126821122-126821144 TAAGCCCAGGAGGGAGGAGCTGG + Intergenic
937914511 2:127092357-127092379 ACAGCCCATTAGGGTGGGGCTGG - Intronic
937936388 2:127249109-127249131 AGAGGCCATAATGGTGGAGCAGG - Intergenic
938711614 2:133980158-133980180 AAAGCCCAGAAGGGTAAAGTAGG + Intergenic
940613247 2:156017503-156017525 ACAGCCCAGATTAGTGCAGCTGG - Intergenic
943141895 2:183993210-183993232 TCTGCACAGAAGGGTGGGGCAGG + Intergenic
946010154 2:216558043-216558065 ACAGCTCTGAAGGCAGGAGCTGG + Intronic
946147627 2:217742979-217743001 CCAGCCCCGGAGGGTGGAGGAGG + Intronic
946339793 2:219059897-219059919 ACAGCCCAGCAGGTTGGCGGCGG - Intronic
948625437 2:239265473-239265495 AAAGCACAGAGGGGTGGTGCTGG - Intronic
948835124 2:240622744-240622766 ACAGCCCAGCGGGGTGAAGTGGG + Intronic
949037480 2:241822487-241822509 GGAGCCCAGAAGGCGGGAGCAGG - Intergenic
949080103 2:242089289-242089311 ACGGCCCAGGAGGGTGGGGGCGG - Intergenic
1168799430 20:634778-634800 CCACCCCAGAAGGCTGGCGCTGG - Intergenic
1169394941 20:5220731-5220753 AGAGTCCTGAAGGGTGGGGCTGG - Intergenic
1169429834 20:5526400-5526422 ACAGCCCAGATGTGATGAGCAGG - Intergenic
1170102209 20:12714747-12714769 ACAGCCCAGAAGTATAGAGGAGG + Intergenic
1170118350 20:12885622-12885644 ACAACCCAGAAGGGTAAGGCAGG - Intergenic
1170474311 20:16699819-16699841 ACAACCCAGCAGGGTGGACTCGG - Intergenic
1170567022 20:17613258-17613280 ACACCCCAGGAGGGTGGGCCAGG - Intergenic
1173168135 20:40700549-40700571 CCAGCCCAGGAGAGTGGGGCAGG + Intergenic
1174554061 20:51381512-51381534 ACATCCCAGCAGGGTGCAGAGGG - Intergenic
1175319009 20:58072390-58072412 ACAGCACAGAAGGGGGGAAAAGG + Intergenic
1175336543 20:58199905-58199927 AGAGGCCAGAAGGGAGGAGAGGG + Intergenic
1175918465 20:62438578-62438600 TGATCCCAGAAGGGTGGGGCCGG - Intergenic
1176112984 20:63418941-63418963 ACAGCCCAGCAAGGTGGAGGTGG - Intronic
1178321768 21:31611314-31611336 GAAGCCCAGAAGGTTGGAGCTGG + Intergenic
1178360997 21:31948503-31948525 ACAGCCCAGAGGGTTCCAGCAGG - Intronic
1178865059 21:36320308-36320330 GCAGCCGCGAGGGGTGGAGCGGG + Intronic
1180652230 22:17387516-17387538 ACACGCCAGCAGGCTGGAGCCGG - Intronic
1181085851 22:20439002-20439024 ATAGCCCCGAAGGGTGGGGCTGG + Intronic
1181177025 22:21043748-21043770 GCAGCTGAGAAGGGTGGAGGAGG + Intergenic
1182712011 22:32329043-32329065 ACATCCCTGAAGGATGGGGCTGG - Intergenic
1182719638 22:32386828-32386850 ACAGCACAGATGGCTGGGGCTGG + Intergenic
1183566493 22:38619189-38619211 AGAGCCCAGGAGGTTGGAGAAGG + Intronic
1184990029 22:48161147-48161169 AGAGCCCAGAGTGGTGGAGAGGG + Intergenic
951589533 3:24248515-24248537 AGAGCAAAGAAGGGTGGATCTGG - Intronic
951656048 3:25009713-25009735 ACAGCCCAGAAAGCTGGAAAGGG - Intergenic
952944868 3:38472575-38472597 AGTGCCCACAAGGGTGGGGCTGG + Intronic
953801512 3:46027504-46027526 CCTGCCCAGAAGGCTGGAGGAGG + Exonic
954701369 3:52452583-52452605 ACAGGTGAGAAGGCTGGAGCTGG + Intronic
954982849 3:54761730-54761752 CCAGGCCAGGAGGGTGGGGCAGG + Intronic
957011422 3:75010023-75010045 AGAGTACAGAAGGGAGGAGCAGG - Intergenic
958560634 3:95743990-95744012 ACAGCCTACATGGCTGGAGCAGG + Intergenic
960044869 3:113186889-113186911 ACAGTCAAGAATGGAGGAGCAGG + Intergenic
960053754 3:113261749-113261771 GCAGGCCAGAAGGGAGGAGTGGG - Intronic
960509114 3:118526768-118526790 GCAGCCCAGAAGTGTGTATCAGG + Intergenic
960715140 3:120567768-120567790 ACACCCCAGAATGTTAGAGCTGG - Intergenic
961573510 3:127817015-127817037 GCAGCTCAGACCGGTGGAGCTGG + Intronic
961786099 3:129347783-129347805 ACAGCCCTGAGGGATGGAGGGGG + Intergenic
961825630 3:129597686-129597708 TCAGCCGAGCAGGGTGGAGCAGG + Intronic
963310838 3:143708415-143708437 ACATCCCAGGATGGTGGTGCAGG - Intronic
964624802 3:158748780-158748802 ACAGCCAGGAAGGGTAGAGCTGG + Intronic
965613205 3:170566162-170566184 AGCACCCAGAGGGGTGGAGCTGG - Intronic
966506214 3:180704693-180704715 ACAGCCCAGTAGAGTGGGGATGG - Intronic
966926077 3:184645432-184645454 TGAGCCCAGAAGCCTGGAGCAGG - Intronic
967441463 3:189513836-189513858 ACAGGGCAGAAGGGAGGAACTGG + Intergenic
967885726 3:194332201-194332223 ACACCTCAGACGGCTGGAGCAGG + Intergenic
968392524 4:205186-205208 GGAGCCCCGCAGGGTGGAGCTGG - Intergenic
968502136 4:955726-955748 ACACGCCAGGAGGGTGGAGCTGG - Intronic
968548063 4:1208544-1208566 AGAGGCAAGAGGGGTGGAGCTGG - Intronic
968813473 4:2810291-2810313 CCAGCCCAGAGGAGAGGAGCAGG - Intronic
968936694 4:3614732-3614754 GCTGCCCAGGAGGCTGGAGCTGG - Intergenic
969122273 4:4919288-4919310 ATAGCTCAGAATGGTGAAGCTGG - Intergenic
969333469 4:6493261-6493283 AAAGCCCAGAAAGGGGGACCAGG - Intronic
969805863 4:9608389-9608411 ATAGCCCACAAGGGCTGAGCCGG - Intergenic
971342166 4:25780562-25780584 ACATTCCAGAAGGAAGGAGCAGG - Intronic
973001811 4:44961289-44961311 AGTGCCCAGAGGTGTGGAGCTGG + Intergenic
973639338 4:52887566-52887588 AGTCACCAGAAGGGTGGAGCGGG + Intronic
977303298 4:95293412-95293434 TCAGCCCAGAAGGCTGAGGCAGG - Intronic
979010714 4:115365543-115365565 AGAGGCCAGATGGCTGGAGCAGG - Intergenic
981719448 4:147786862-147786884 ACAGCAGAGAACTGTGGAGCAGG - Intronic
982224500 4:153153454-153153476 ACAGCCCGGAAGGCTGCAGACGG + Intronic
984177614 4:176438513-176438535 ACAGCACAGTTGGGTGGAGATGG - Intergenic
984184118 4:176521495-176521517 ACAGCACTGAAGGGTAGAGATGG + Intergenic
985652955 5:1115534-1115556 CCAGCCCAGAAGGATGCAGATGG - Intergenic
988503108 5:31799628-31799650 ACAGCCCAGCAGGGAAGAGTGGG + Exonic
989783484 5:45298749-45298771 ACAGCCCACAAGTAAGGAGCGGG - Intronic
992431537 5:76715769-76715791 ACATCCCAGGAGGGTCGAGACGG + Intergenic
997235677 5:132270830-132270852 ACAGCACAGCAGGGTGGGGGTGG + Intronic
997676012 5:135713976-135713998 GCAGCCCCAAAGGCTGGAGCAGG + Intergenic
997690877 5:135826759-135826781 ACAGCCGGGAACTGTGGAGCTGG + Intergenic
998112354 5:139511958-139511980 ACAGCTCAGAAAGGTAGTGCGGG - Intergenic
999140358 5:149357608-149357630 ACCACCTAGAAAGGTGGAGCAGG + Intergenic
999273214 5:150310334-150310356 ACAGCTAGGAAGGGTGGAGCTGG - Intronic
999427400 5:151499911-151499933 GCAGGCCAGAAGGGAGGGGCAGG - Intergenic
1000210145 5:159100755-159100777 ACGTCCCAGAACGGCGGAGCAGG - Intergenic
1002043428 5:176529904-176529926 AGAGCCCAGAACGTTGCAGCGGG + Intronic
1002613996 5:180439115-180439137 ACAGCCCAGAATAATGGAGGAGG - Intergenic
1004159936 6:13204410-13204432 ACAGCACAGCAGGGAGGAGTAGG - Intronic
1005818532 6:29577440-29577462 ACAGCAGAGCAGGGCGGAGCTGG + Intronic
1006084589 6:31587000-31587022 CCATCCCAGAAAGGTGGAGCTGG - Intronic
1007126634 6:39431352-39431374 ACAGTCCTGAGGGGTGCAGCGGG - Intronic
1007778587 6:44237984-44238006 ACAGCCGAGAACCGTGGGGCTGG + Intergenic
1008602595 6:53110475-53110497 ACAACCCAGATGGATGCAGCTGG + Intergenic
1010404920 6:75493861-75493883 ACAGCTGAGAAGTTTGGAGCCGG + Intergenic
1011058976 6:83241252-83241274 ACTGCCCAGAAGTTTGGATCTGG + Intronic
1012858093 6:104527044-104527066 AGTGCCCTGAAGGGTGGGGCTGG - Intergenic
1013330413 6:109094908-109094930 TCAGCCCAGAGGGCGGGAGCAGG + Intergenic
1014925722 6:127267369-127267391 ACGGCCCAGAGGGGAGGAGAGGG - Intronic
1016269346 6:142270514-142270536 ACAGGGAAGAAGGGTGGAGAGGG + Intergenic
1017657629 6:156645382-156645404 ACAGCTCAGGAGGGAGGAGTGGG + Intergenic
1017770378 6:157639692-157639714 ACAGCTCAGTAGGGAGAAGCAGG + Intronic
1017888428 6:158620149-158620171 ACAGCCCAGAGGGGAGGCGTGGG + Intronic
1018717016 6:166541249-166541271 ACCGCCCAGAGGTGTGGGGCAGG + Intronic
1019397011 7:826442-826464 GCTGCCCAGCCGGGTGGAGCAGG + Intronic
1021897999 7:25255695-25255717 TCAGCCAAAAAGGGTGGGGCGGG + Intergenic
1022044695 7:26613613-26613635 ACAGCAGAGAAGGGGGCAGCTGG + Intergenic
1022445781 7:30469674-30469696 TCAGCAGAGAAGGGAGGAGCTGG - Intronic
1022598160 7:31732089-31732111 ACAGCCCAGATGCGAGGTGCGGG + Intergenic
1022956839 7:35389036-35389058 TCACCACAGAAAGGTGGAGCTGG + Intergenic
1023932266 7:44713104-44713126 ACAGCCCTGAAGAGACGAGCAGG - Intergenic
1023969699 7:44981701-44981723 GCCTCCCAGAAGGATGGAGCGGG - Intergenic
1024062496 7:45709499-45709521 ACTTCCCAGATGGCTGGAGCTGG - Intronic
1024236597 7:47403262-47403284 ACATACCAGAAGGGAGGAGAAGG + Intronic
1025143399 7:56484075-56484097 GCAGCCCAGGAGGGTTGGGCAGG + Intergenic
1026733182 7:72929118-72929140 ACAGCCCAAAGGGGTGGTGGTGG + Intronic
1027110850 7:75438478-75438500 ACAGCCCAGAGGGGTGGTGGTGG - Intronic
1027269960 7:76513715-76513737 GCAGCCTAGAAGGTAGGAGCAGG + Intronic
1028391742 7:90325116-90325138 ACTGCCCAGAAGGCTGCGGCAGG + Intergenic
1029254899 7:99263025-99263047 ACAGCCCAGGAGAGAGTAGCAGG + Intergenic
1030651396 7:112119672-112119694 AGGCCACAGAAGGGTGGAGCTGG - Intronic
1031075840 7:117211461-117211483 AAAGCCCAGCAGGGTTGAACGGG + Intronic
1032166673 7:129550774-129550796 TCAGCCCAGAAGTGTGAAGTTGG + Intergenic
1032462358 7:132121597-132121619 AAAGCCCAGAAGATTGGGGCAGG - Intergenic
1033131881 7:138751839-138751861 ACAGTCTAGCAGAGTGGAGCTGG + Intronic
1033661530 7:143406317-143406339 AAAGCCCAGAAGGATGGGGTTGG + Intronic
1034901034 7:154907911-154907933 GCAGCCCAGGAGGTGGGAGCAGG - Intergenic
1035538146 8:407552-407574 ACGGCCCAGGAGGGTGGGGGCGG - Intronic
1035650085 8:1257440-1257462 TCTGCCCAGAAGGATGGGGCGGG - Intergenic
1036259332 8:7227996-7228018 CCGGCCCAGAAGGGAGGAGGAGG - Intergenic
1036311374 8:7686566-7686588 CCGGCCCAGAAGGGAGGAGGAGG - Intergenic
1036983004 8:13492214-13492236 ACAGCCCATAAGGCTGGCTCTGG + Intronic
1037348587 8:17924716-17924738 ACAGCTTTGAAGTGTGGAGCGGG + Exonic
1037675974 8:21050983-21051005 TCATCCCAGAAGGATGGTGCTGG + Intergenic
1039416320 8:37397427-37397449 ACAGCCCAGGAGGCTGCAGCAGG + Intergenic
1039957562 8:42218987-42219009 ACAGACCAGAAAGGAGGATCGGG + Intergenic
1040342660 8:46448741-46448763 AGGGCCCACAAGGGTGGAGTTGG - Intergenic
1042655256 8:71088776-71088798 ACAGCCAGGAAGAATGGAGCTGG - Intergenic
1042832948 8:73051453-73051475 GCAGCCCAGGAGGGTGTGGCTGG + Intergenic
1043883873 8:85575688-85575710 AGAGATCAGAAGGCTGGAGCAGG + Intergenic
1044831037 8:96249399-96249421 ACAGCCAAGAAGACTAGAGCTGG + Intronic
1048342706 8:133553165-133553187 ACAGCAAAGCAGAGTGGAGCAGG - Intronic
1049309808 8:141927855-141927877 ACAGCCCAGAGATGGGGAGCTGG + Intergenic
1049537557 8:143189442-143189464 AGAGCCCAGAGGGGTGGGGATGG - Intergenic
1051431429 9:16984433-16984455 ACAGCCCAGAAGAGTCCATCAGG - Intergenic
1052927639 9:34030816-34030838 ACAACCCAGAAGGCTGAGGCAGG + Intronic
1053103224 9:35389160-35389182 ACAGCCCAGAAAAGTGAAGTAGG - Intronic
1053179931 9:35960154-35960176 ACAGCACAGAAGGGTGTTCCTGG + Intergenic
1053290774 9:36878482-36878504 TCAGCCCTGAAGGGTGTTGCTGG + Intronic
1056509088 9:87285681-87285703 AGAGCCCAGAGGGGTTGAACTGG - Intergenic
1057759429 9:97860622-97860644 TCAGCCCAGAAGGGTTAACCAGG + Intergenic
1058413748 9:104763942-104763964 AGGGCCCAGAAAGGTGGGGCAGG + Intergenic
1059213757 9:112539970-112539992 ACAGCCCAGCACGGTGGCTCAGG - Intronic
1060146947 9:121261183-121261205 TGAGCCCAGAAGAGTGGGGCTGG + Intronic
1060547162 9:124468360-124468382 AAGGCCCCGAATGGTGGAGCGGG + Intronic
1060991958 9:127854485-127854507 CCACCCCAGAAGGCTGGAGCAGG - Exonic
1061265359 9:129501703-129501725 AAAGCCCAGAAGGAAGGAGTGGG - Intergenic
1061423447 9:130484449-130484471 ACTGCCAAGAAAGGTGCAGCGGG - Intronic
1061855254 9:133438422-133438444 ACAGCCCAGAGCGTTGGTGCAGG + Intronic
1062530349 9:136996878-136996900 ACAGGCCAGAAGGGTGCAGGGGG + Intergenic
1185893341 X:3838614-3838636 ACAGCCTGGCAGGGAGGAGCGGG - Intronic
1185898455 X:3877038-3877060 ACAGCCTGGCAGGGAGGAGCGGG - Intergenic
1185903570 X:3915467-3915489 ACAGCCTGGCAGGGAGGAGCGGG - Intergenic
1186455600 X:9707791-9707813 AGAGCCCGGGAGGGTGGAGGGGG - Intronic
1186512697 X:10142343-10142365 ACAGACCAGGAGGGTGGCGGAGG + Exonic
1187161818 X:16772495-16772517 ACATTCCACAAGGCTGGAGCAGG + Intergenic
1187281666 X:17861628-17861650 AGAGCCCAGAAGGGAGGAAGTGG + Intergenic
1187477955 X:19628469-19628491 ACAGCCAGGAACAGTGGAGCTGG + Intronic
1196285611 X:113876052-113876074 ACAGGACAGAAGGATGGAGAGGG + Intergenic
1198581161 X:138066277-138066299 GCTGCCCAGAATGATGGAGCTGG - Intergenic
1198732559 X:139748094-139748116 ACAGCTCTGAAGGCTGGAGGAGG + Intronic
1198815634 X:140587145-140587167 AGAGCGCAGGAGGGTGGAGGTGG + Intergenic
1198822778 X:140666530-140666552 AAGGCCCAGAATGGTGGTGCTGG + Intergenic
1200399056 X:156008158-156008180 ACAGCCCAGCAGGGAGGGGAGGG - Intronic
1201290008 Y:12413892-12413914 AGGACCCAGAGGGGTGGAGCTGG - Intergenic