ID: 1092286297

View in Genome Browser
Species Human (GRCh38)
Location 12:7130773-7130795
Sequence GGGGTGGGAAGGAGGTGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 840
Summary {0: 1, 1: 0, 2: 10, 3: 76, 4: 753}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092286284_1092286297 13 Left 1092286284 12:7130737-7130759 CCGAAAGAGGGGCGTCGGGCAGC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG 0: 1
1: 0
2: 10
3: 76
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092286297 Original CRISPR GGGGTGGGAAGGAGGTGTCG AGG Intronic
900428567 1:2591673-2591695 GGGGTGGCCAGGAGGGGTGGGGG + Intronic
900478328 1:2886652-2886674 GGGGTGGGAGGGAGCTGCCTGGG + Intergenic
900604062 1:3516065-3516087 GGGGTGGGTAGGAGCTGTGCTGG - Intronic
900636118 1:3666601-3666623 GAGGTGGGCAGGAGGTGGTGGGG - Intronic
900830160 1:4959980-4960002 GGGAAGGGAAGGAGGTGGAGAGG + Intergenic
900900288 1:5511235-5511257 GTGGTGGGACGGAGGGGTCCAGG + Intergenic
901039886 1:6357512-6357534 TGGGTGGGACAGAGGTGTCTGGG + Intronic
901324957 1:8360444-8360466 GGGGTGGGAGGCAGGGGGCGGGG + Exonic
901560423 1:10066032-10066054 GGGGAGGGAAGGAGGGGGGGAGG - Intronic
901745503 1:11370427-11370449 GGACTGGGAAGGAGGTGGCGTGG + Intergenic
902253123 1:15169055-15169077 TGGGTGGGAAGGTGGGGTCTTGG + Intronic
902385335 1:16072868-16072890 GGGGTGGGGAGGAGGATTAGGGG + Intronic
902453307 1:16513309-16513331 GGGGTGGGAAGGATGGGTCACGG + Intergenic
902473359 1:16665983-16666005 GGGGTGGGAAGGATGGGTCACGG + Intergenic
902485444 1:16741459-16741481 GGGGTGGGAAGGATGGGTCACGG - Intronic
902499175 1:16896941-16896963 GGGGTGGGAAGGATGGGTCTGGG - Intronic
902610732 1:17595722-17595744 GCGGAGGGAAGGAGGGGGCGGGG + Intronic
902691541 1:18112945-18112967 GGGGAGGAAAGGAGGTGGAGAGG - Intronic
903102231 1:21040560-21040582 GGGGTGGGAAGGCAGTCTAGAGG + Intronic
903435362 1:23344764-23344786 GGGGTGCGAGGGAGGACTCGGGG - Intergenic
904034624 1:27551991-27552013 CGGGTGGGAAGCAGGGGCCGGGG + Exonic
904491685 1:30864396-30864418 GGGGTGGGGAGGAGGTGAAGGGG + Intergenic
904610472 1:31723264-31723286 TGGGTAGGGAGGAGGTGTTGGGG - Intergenic
904850531 1:33455776-33455798 GGAGAGGGAAGGAGGTGGCTGGG + Intergenic
904940800 1:34164208-34164230 GGGATGGGAAGGAGGGGGTGGGG - Intronic
905257712 1:36695676-36695698 GTGGTGGGAGTGGGGTGTCGTGG - Intergenic
905596968 1:39215813-39215835 GGGGTGGGAGGGAGGAGTCATGG + Intronic
905644711 1:39617183-39617205 GGGGTGGGAAGGAGGTCAGTGGG + Intergenic
906478998 1:46188278-46188300 GGGGTGGGAAGGAAGTGGATGGG - Intergenic
906648008 1:47490088-47490110 AGGGTGGGGAGGAGCTGTCAAGG + Intergenic
907345888 1:53779937-53779959 GGGGTTGGAAGGAGGAATGGGGG - Intronic
907447610 1:54519063-54519085 GGGGTGAGAAGGAGCTTTCCAGG + Intergenic
907492286 1:54815900-54815922 GGGGAGGTAAGGAGGTGAGGCGG - Intronic
908354920 1:63319720-63319742 GGGGCGGGAAGGAGGCGAAGCGG - Intergenic
908561470 1:65310213-65310235 GGGGAGGGAAGGAGGAGGGGAGG + Intronic
909939380 1:81592774-81592796 GTGTGGGGAAGGAGGTGTAGGGG + Intronic
909945928 1:81663042-81663064 GGGGTGGGAGGGAGGGGTCGGGG - Intronic
910106645 1:83638461-83638483 GTGGTGGGAAGAAGGTGGGGAGG - Intergenic
910737807 1:90481254-90481276 GGGGTGAGAAGGTGTTGTCCAGG + Intergenic
912453596 1:109783275-109783297 GTGGTGGGGAGGGGGTGTCCTGG + Intergenic
912455460 1:109793649-109793671 GGGGCAGGAAGGGAGTGTCGGGG + Intergenic
912812150 1:112802604-112802626 GGGTAGGGATGGAGGTGTCAGGG + Intergenic
913210220 1:116576172-116576194 GGGGTGGGAGGGGGGTTTCCAGG - Exonic
913680594 1:121185199-121185221 GGGGCGGGAAGGAGAGGGCGCGG + Intronic
914001515 1:143698649-143698671 GGGGTGGGAAGCATGGGTCGGGG + Intergenic
914005407 1:143728598-143728620 GGGGTGGGAAGGATGGGTCGGGG + Intergenic
914032425 1:143972841-143972863 GGGGCGGGAAGGAGAGGGCGCGG + Intergenic
914096781 1:144550960-144550982 GGGGTGGGAAGGATGGGTCGGGG + Intergenic
914097887 1:144559857-144559879 GGGGTGGGAAGGATGGGTCGGGG + Intergenic
914157020 1:145095126-145095148 GGGGCGGGAAGGAGAGGGCGCGG - Intronic
914301104 1:146377756-146377778 GGGGTGGGAAGGATGGGTCGGGG - Intergenic
914517632 1:148387692-148387714 GGGGTGGGAAGGATGGGTCGGGG + Intergenic
914815329 1:151058731-151058753 GGGATGGGAAAGAGGTGCCAGGG + Exonic
915473494 1:156139151-156139173 GGGGTGGGCATGAGGTGAGGAGG - Exonic
915594568 1:156888725-156888747 GGAGTGGGAAGGAGGTTGTGAGG - Intergenic
915733717 1:158071638-158071660 GGGGTGGGAAGGTGGCCTCCCGG - Intronic
916674533 1:167054557-167054579 TGGGTGGGGAGGAGGTCTGGAGG - Intronic
917184307 1:172335794-172335816 GGGGAGGGAAAGAGGGGACGTGG + Intronic
918760097 1:188393241-188393263 CGGGGGGGACGGAGGTGTGGAGG - Intergenic
919693072 1:200544743-200544765 GGGGAGGGAGGGAGGCCTCGTGG + Intergenic
919756171 1:201067426-201067448 GTGATGGGAAGGAGGTGGAGAGG - Intronic
920191480 1:204196709-204196731 TGGGTGGGAAGAGGGTGTGGAGG - Intergenic
920467903 1:206203725-206203747 GGGGCGGGAAGGAGAGGGCGCGG + Intronic
920863972 1:209735960-209735982 GGATTGTGAAGGAGGTGTCTAGG + Intergenic
921270957 1:213469483-213469505 GGGGTAGGAAAGAGGTGCCCAGG + Intergenic
922174989 1:223189820-223189842 GGGAAGGGAAGGAGCTGTCCTGG + Intergenic
922486354 1:225976084-225976106 AAGGTGGGGAGGAGGTGGCGCGG - Intergenic
922616815 1:226965576-226965598 GGGGTGGAGAGGAGATGTGGGGG + Intronic
922810785 1:228414549-228414571 GGGGGAGGGAGGAGGTGTCCAGG - Intronic
923378280 1:233388611-233388633 TGGGTGGGTGGGAGGTGTCAGGG + Intergenic
924532005 1:244901473-244901495 GGGGTGGGGAGGAGGCATCTGGG - Intergenic
924726712 1:246678267-246678289 GGGGTGGGGAGGAGAGGTGGGGG - Intergenic
924796660 1:247297562-247297584 GGGGTGGGAGGGAAGGATCGAGG + Exonic
1062885177 10:1010901-1010923 GGGTGGGGAAGGTGGTGTAGGGG - Intronic
1063081833 10:2774841-2774863 GGTTTGAGAAGGAGGTGTCAGGG + Intergenic
1063167144 10:3473752-3473774 GGGGTGAGTAGGAGGTGAGGAGG - Intergenic
1063464978 10:6237134-6237156 GGGATGGGGAGGAAGTGTCGGGG - Intergenic
1064091856 10:12392353-12392375 GGAGAGGGAAGGAGGAGTTGTGG - Intronic
1065343070 10:24723964-24723986 GGGAGGGGAAGGAGGTGGAGTGG - Intergenic
1065343281 10:24724823-24724845 GGGGTGGGAAGGAGAGGCCGAGG - Intergenic
1066071584 10:31820030-31820052 GGGGTGGGCAGGGGGTGTATGGG - Intronic
1066135638 10:32443081-32443103 GTTGAGGGAAGGAGGTGTCCAGG - Intergenic
1066573767 10:36802694-36802716 GGGCTGGGAGGGAGGGGTGGAGG + Intergenic
1067048234 10:42997842-42997864 GGGGTGTGAAGGACGTGCCCAGG + Intergenic
1067216612 10:44309435-44309457 AGGGAGGGAAGGAGGTGGCGGGG + Intergenic
1067258580 10:44666563-44666585 GGGGTGGGGAGGGGGAGTGGTGG + Intergenic
1067288329 10:44923698-44923720 GGGCTGGCCAGGAGGTGTCTGGG - Intronic
1067474479 10:46556791-46556813 GGGTCGGGAAGGAGGGGTGGGGG - Intergenic
1067659611 10:48224451-48224473 GGGGTGGGGAGGGGGTGTCCAGG + Intronic
1067698291 10:48551079-48551101 GGGGTGGGAAGGAGGCAGAGGGG + Intronic
1067928637 10:50537601-50537623 GGGGCGGGCAGGGGGTGGCGGGG - Intronic
1068584408 10:58780613-58780635 GAAGTGGGAAGGAGGTTTAGGGG + Intronic
1068900841 10:62268315-62268337 GGATTGGGAAGGCGGTGCCGGGG - Intronic
1068942086 10:62690237-62690259 GGGAAGGGAAGGAGGTGCCGGGG - Intergenic
1068991851 10:63158775-63158797 GACCTGGGAAGGAGGTGTGGTGG + Intergenic
1069748509 10:70731346-70731368 TGAGTGGGAAGGAGGTTTCTGGG - Intronic
1069830103 10:71277705-71277727 GCAGTGGGAAGCAGGTGTCAGGG + Intronic
1070175846 10:73968545-73968567 GGGCTGGGAAGGAGGTAGAGAGG - Intergenic
1070364207 10:75720258-75720280 GGGGTGAAAAGGAGGCATCGTGG + Intronic
1070712938 10:78696685-78696707 GGGGTGGGAAGGGGGTGGGGTGG + Intergenic
1070961344 10:80502234-80502256 GAGGTGGGAAGGAGATGCCGTGG + Intronic
1072089023 10:92108879-92108901 GGGGTCAGATGGAGGTGTTGTGG - Intronic
1072428059 10:95347088-95347110 GTGGAGGGATGGAGGTGTGGAGG - Intronic
1072623516 10:97096402-97096424 GGGGAGGGCAGGAGGGGTTGAGG - Intronic
1073077133 10:100831134-100831156 CTGATGGGAAGGAGGTGTCTAGG - Intergenic
1073125176 10:101144946-101144968 GGTCTGGGAATGAGGTGTGGAGG - Intergenic
1073301504 10:102473763-102473785 GGCATGGGATGGAGGTGTTGCGG - Intronic
1073329626 10:102661642-102661664 GGGGTGGGAGGCAGGAGACGAGG + Intergenic
1073802282 10:107055126-107055148 GGAGAGAGAAGGAGGTGTCTGGG + Intronic
1073967620 10:109009531-109009553 TGGGTAGGAAGGGGGTGTGGTGG - Intergenic
1074476743 10:113781186-113781208 TGTTTGGGAAGGAGGTGTCTGGG - Intronic
1074476747 10:113781201-113781223 GTGTTGGGAAGGAGGTGTTTGGG - Intronic
1074476771 10:113781286-113781308 GTGTTGGGAAGGAGGTGTTTGGG - Intronic
1074476779 10:113781315-113781337 TGTTTGGGAAGGAGGTGTTGGGG - Intronic
1074476791 10:113781360-113781382 GTGTTGGGAAGGAGGTGTCTGGG - Intronic
1074476812 10:113781433-113781455 GTGTTGGGAAGGAGGTGTTGGGG - Intronic
1074476830 10:113781484-113781506 GTGTTGGGAAGGAGGTGTTGGGG - Intronic
1074476861 10:113781584-113781606 GTGTTGGGAAGGAGGTGTTTGGG - Intronic
1074476869 10:113781613-113781635 TGTTTGGGAAGGAGGTGTTGGGG - Intronic
1074476881 10:113781658-113781680 GTGTTGGGAAGGAGGTGTCTGGG - Intronic
1074476907 10:113781746-113781768 GTGTTGGGAAGGAGGTGTTGGGG - Intronic
1074476924 10:113781797-113781819 TGTTTGGGAAGGAGGTGTTGGGG - Intronic
1074755858 10:116623742-116623764 GGGGTGGGAAGGGCGGGTGGGGG - Intronic
1075419750 10:122291881-122291903 GGTGTGGGGAGGAGGTGGTGGGG + Intronic
1076187065 10:128458360-128458382 ATGGTGGGAAGGAGCTGTCAGGG + Intergenic
1076425273 10:130363123-130363145 GGGGTGGGAGGGAGGATTCTGGG + Intergenic
1076732778 10:132446722-132446744 GGGGTGGGCAGGAGGAGGTGGGG + Intronic
1076821674 10:132942746-132942768 GGGGAGGGAAGGCGGCGTGGGGG + Intronic
1076879823 10:133234718-133234740 AGGGGGGCATGGAGGTGTCGGGG + Intergenic
1076888252 10:133272314-133272336 GGGGTGGGAGGGAAGTGGGGAGG - Intronic
1077723275 11:4648180-4648202 GGCCTGGGAAGGAGGTGCCTAGG - Intronic
1078250654 11:9614067-9614089 GGGGATAGAAGGAGGTGTTGGGG + Intergenic
1078390879 11:10934326-10934348 GGGGTTGGAAGGAGGGGTTGGGG + Intergenic
1078563818 11:12396412-12396434 AGCCTGGGAAGGAGGTGTCTGGG + Intronic
1079035197 11:17014426-17014448 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1079151366 11:17902584-17902606 GGGGAAGGTAGGAGGTGTCAGGG + Intronic
1079591782 11:22191778-22191800 GGGGTGGGCAGGAAGTGGAGGGG + Intergenic
1080321877 11:31019488-31019510 GGGGTGGGGAGGTGGTGCAGTGG + Intronic
1081565835 11:44260563-44260585 CGGATGGGAAGGAGATGTAGGGG - Exonic
1081807749 11:45899647-45899669 GGGATGGGAAGGAGACGCCGAGG - Intronic
1081871869 11:46386569-46386591 GGGGTGGGTAGGCCGTGTCTGGG + Exonic
1081873012 11:46391715-46391737 GGGGCGGGGACGGGGTGTCGAGG + Intergenic
1082792837 11:57359250-57359272 AGGGTGGGAAGGAGGGGATGGGG - Intronic
1082795649 11:57376420-57376442 GGGGTTGGAAGTAGGGGTAGGGG - Intergenic
1083039138 11:59669134-59669156 GCGGCGGGAAGGAGGTCCCGTGG + Intergenic
1083060675 11:59867543-59867565 GTGGTGGGAAGGAGATGCGGAGG + Intergenic
1083271386 11:61574637-61574659 GGGATGGTAAGGAGGTGTGCAGG + Intronic
1083307956 11:61770551-61770573 GGGGTGGGAAGGTGGGGTACAGG + Intronic
1083592669 11:63904606-63904628 GTGGTGAGAAGGAAGTCTCGTGG - Intronic
1083595622 11:63917251-63917273 GGGGTGGGAGGGAGGGCCCGGGG + Intergenic
1083797931 11:65028754-65028776 GGGGTGGGGAGGATGTGGCAAGG + Intronic
1084321965 11:68378101-68378123 GAGGTGGGATGGAGGTGTCCGGG + Intronic
1084429442 11:69103021-69103043 GAGCTGGGAAGGAGGAGTGGGGG + Intergenic
1084726082 11:70943089-70943111 GGGGTGGGAAGGAGTTCACCTGG + Intronic
1085319360 11:75564631-75564653 GAGCTGGGAGGGAGGTGTCTTGG + Intronic
1086107166 11:83158053-83158075 TGGGTTGGAAGGAGGTGAAGGGG + Intronic
1086328808 11:85732592-85732614 GGGGTGGGCAGGGGGTGGGGAGG + Intronic
1086928139 11:92663054-92663076 GGGGTGGGAAGCACGTGTTCCGG + Intronic
1087176328 11:95099427-95099449 GGGGTGGGAAGGAGGTGCCCAGG + Intronic
1088584863 11:111353466-111353488 GGGGTGGGAAGTGGGTGGCAGGG - Exonic
1088684344 11:112272404-112272426 GAGGTGAGAATGAGGTGTCAGGG - Intergenic
1089051405 11:115549018-115549040 GGGCTGGGAAGGTGGAGCCGGGG + Intergenic
1089290964 11:117437784-117437806 GGGTGGGGAAGGAGGGGTCCAGG - Intronic
1089309628 11:117549122-117549144 GGAGTGGGAAGGTGGTGATGGGG - Intronic
1089673879 11:120075969-120075991 GGGGTGGGGAGGAGGGGAGGTGG + Intergenic
1089774558 11:120827269-120827291 GGGGTGGGAGGAGGATGTCGAGG - Intronic
1089792142 11:120953035-120953057 GGGGTGGGGAGGAGGAGAGGGGG + Intronic
1090597836 11:128338218-128338240 GCGGTGGGAAGAAGGTGCAGAGG + Intergenic
1090748131 11:129723494-129723516 GGGTGGGGAGGGAGGTGTTGGGG - Intergenic
1090924624 11:131238592-131238614 GGGGTGGGAAGGAGGGGTCTTGG + Intergenic
1091100615 11:132869329-132869351 TTGGTGGGAAGGAGGAGGCGGGG - Intronic
1091240769 11:134050729-134050751 GGGGTGGGCAGGAGGCGGCGCGG + Intergenic
1091353517 11:134916176-134916198 AGGGTGGGGAGGAGGTTTCATGG - Intergenic
1091383682 12:78404-78426 GGGGCGGCTAGGAGGGGTCGGGG + Intronic
1091631047 12:2161262-2161284 GGGATGGGAAGGGGGTCTCTGGG + Intronic
1091793349 12:3283856-3283878 CGTGTGGGAAGGAGGGGGCGTGG + Exonic
1091817893 12:3453583-3453605 GGGCTGAGAATGAGGTGTCTGGG + Intronic
1092015053 12:5151688-5151710 GGGGTGGGATGACGGTGGCGGGG - Intergenic
1092056889 12:5514738-5514760 GGGCTGGGAAGGAGGCTTTGTGG + Intronic
1092104501 12:5912052-5912074 GGGGTTGGAAGGAGGTTTCTGGG - Intronic
1092205865 12:6613920-6613942 GGGGCGGGAAGGGGGGGTGGTGG - Intergenic
1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG + Intronic
1092763143 12:11827550-11827572 GAGGTGGACAGGAGGTGTGGGGG - Intronic
1092776475 12:11948707-11948729 GTGGTGGGAACGAGATGACGGGG - Intergenic
1092810228 12:12266249-12266271 GGGGTGGGGAGTGGGTGGCGGGG + Intronic
1092927009 12:13280438-13280460 GAGGTGGGAAGAGGGTGTTGAGG - Intergenic
1094839023 12:34335283-34335305 GGGGTGGCATGGGGGTGGCGAGG - Intergenic
1095096712 12:38153013-38153035 GGGGTGGGGGGTGGGTGTCGTGG + Intergenic
1095730976 12:45506401-45506423 GGGGTGGGAAGGGGCAGTCTTGG + Intergenic
1096124598 12:49110225-49110247 GGGGTGGGAGGGAGGGGCAGGGG + Intronic
1096512831 12:52141196-52141218 CGGGTGGGGAGGAGGAGTGGAGG - Intergenic
1096625252 12:52891350-52891372 GGTGTGGGATGCAGGTGTAGGGG + Intergenic
1096626105 12:52897135-52897157 GGGGTGGGAGGGAGGTGGTCAGG - Intergenic
1096785462 12:54014767-54014789 GCGGTGGGCAGGAGGGGTGGGGG - Intronic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1096868088 12:54577026-54577048 GGGGTGGTAGGGTGGTGTTGAGG + Intronic
1097007663 12:55931015-55931037 GGGGTGGGAAGAAGGGGGAGGGG - Exonic
1097013718 12:55970842-55970864 GGGGAAGGAAGGAGGGGGCGAGG + Intronic
1097602223 12:61706881-61706903 GGGGAGGGAGGGAGGGGTGGAGG + Intergenic
1097694805 12:62765738-62765760 GGGATGGGATGGAGGAGTCAGGG + Intronic
1098929743 12:76397338-76397360 GGGGTGGGGAGGGGGGGTGGGGG + Intronic
1100344182 12:93711029-93711051 GGGGTGGGAGGGTGGGGTGGAGG - Intronic
1100457580 12:94767407-94767429 GGGGTGGGACAGGGGTGGCGGGG + Intergenic
1101193226 12:102356230-102356252 GGGGTGGGAATGAGGTTTCTGGG - Intergenic
1102004015 12:109577396-109577418 GGAATGGGAAGCAGGTGTCAAGG - Intronic
1102042713 12:109810824-109810846 GGGGTGGGGAGGAGGGCTTGCGG + Intronic
1102471389 12:113161781-113161803 GGGGCGGGGAGGAGGGGGCGGGG - Intronic
1102561656 12:113766581-113766603 ACGGTGGGAAGGAGGTGCCCTGG + Intergenic
1103136462 12:118512029-118512051 GGGGTGTGCAGGAGATGTCTGGG + Intergenic
1103238990 12:119397953-119397975 GGGGGAGGAAGGGGGTGGCGTGG + Intronic
1103321671 12:120095929-120095951 GGGAGGGGAATGAGGTGTCCGGG + Exonic
1103359487 12:120345536-120345558 GGGGTGGGCAGGTGGTGGGGTGG - Intronic
1103623190 12:122201027-122201049 GGGATGGGGAGGAGGTGGTGGGG + Intronic
1103856427 12:123973432-123973454 GGGGTGGGAAGGAGGTGGAGTGG + Exonic
1103927710 12:124433030-124433052 GGGGTGGGGCTGAGGTGTCTGGG - Intronic
1103937835 12:124485949-124485971 GGAGTGGGAGGGAGGTGGGGTGG - Intronic
1104678106 12:130729452-130729474 GGGGTGGGGAGGAGGGGTGGGGG - Intergenic
1105605888 13:21926223-21926245 AGGGTGGGATGGAGGTATGGGGG + Intergenic
1105755701 13:23461867-23461889 TGGGTGGGAATGAGGTGCCCAGG - Intergenic
1106353468 13:28956748-28956770 CTGGTGGGAAGGAAGTGTGGCGG + Intronic
1106353508 13:28956928-28956950 CTGGTGGGAAGGAAGTGTTGGGG + Intronic
1106729073 13:32520320-32520342 CGGGTGGGAAGGTGGGGACGAGG + Intronic
1107149080 13:37091161-37091183 GAGGTGGGAAGGCGGTGGGGAGG + Intergenic
1107758492 13:43651261-43651283 GGGGAGGGAAGGAGGAGAAGAGG + Intronic
1108001804 13:45911045-45911067 GGGCTGGGAAGGAGGGGGCCTGG - Intergenic
1108495379 13:51019474-51019496 GGGGTGGGTTGGAGTTGTGGAGG - Intergenic
1108624116 13:52210811-52210833 GTGGTGGGTAGGGGGTGTCCTGG - Intergenic
1108661939 13:52595610-52595632 GTGGTGGGTAGGGGGTGTCCTGG + Intergenic
1109370835 13:61417096-61417118 GGGGTGGGGAGGAGGTGGAGTGG - Intronic
1110092853 13:71475553-71475575 AGGGTGGGAAGAACGTGTTGGGG - Intronic
1110355723 13:74564809-74564831 GGGGTGGGGTAGAGGAGTCGGGG - Intergenic
1111437346 13:88227425-88227447 GGGGTGGGAAGGGGGTGTGTGGG + Intergenic
1112181974 13:97091929-97091951 GGGGAGGGAAGGAGGAGGAGAGG + Intergenic
1112506622 13:99980022-99980044 GGGCGGGGAAGGCGGTGTCTGGG + Intergenic
1114417976 14:22556855-22556877 TGGGAGGGAAGGAGGTGGGGAGG + Intronic
1114626885 14:24136111-24136133 GGGGTCGGATGGAGGAGGCGGGG - Intergenic
1114652570 14:24295477-24295499 TGGGTGGGCAGGAGGTGCTGGGG + Intronic
1115754782 14:36519863-36519885 GGGGAGGGCAGGAGGTGGGGTGG + Intronic
1115761548 14:36582185-36582207 GGGGTGGGAGGTAGGAGGCGTGG - Intronic
1116501934 14:45634462-45634484 GGGGAGGGAAGGAGGAGGGGAGG - Intergenic
1117253110 14:53954537-53954559 GGTGGGGGAAGGAAGTGGCGGGG - Intronic
1117791066 14:59342848-59342870 GGGCCGGGAAGGTGGTGTCAAGG + Intronic
1118348287 14:64955595-64955617 GGGGTGGGGAGGGGGTGCCCTGG - Intronic
1118480174 14:66156816-66156838 GGGGTGGGAGGGGGGTGGGGGGG - Intergenic
1118698420 14:68409008-68409030 GGGCAGGGAATGAGGTGTTGGGG + Intronic
1118739576 14:68729921-68729943 GGAGTGGGAAGGGGATGTTGGGG - Intronic
1118979592 14:70705751-70705773 GGGGTGGGCAGGAGATGAAGTGG - Intergenic
1119172311 14:72544742-72544764 GGGGATGGAAGGAGGGGGCGAGG - Intronic
1119657175 14:76425509-76425531 GGGGGAGGAAGGAGGTGAGGAGG - Intronic
1119723261 14:76905922-76905944 GGGGTGGGGAGGCGGTGTTTTGG + Intergenic
1119862805 14:77948790-77948812 GGGGAGGGAAGGAGGGGGTGGGG - Intergenic
1121438139 14:93932335-93932357 GGGGTGAGTGGGAGGTGTAGGGG - Intergenic
1121887924 14:97561737-97561759 GGGGTGGGGAGGAGCTGGCTGGG - Intergenic
1122061094 14:99137212-99137234 GGGCTGGGAAGAAGGGGTGGAGG - Intergenic
1122410865 14:101525571-101525593 AGGGTGGGCAGGAGCTGGCGGGG + Intergenic
1122572752 14:102718583-102718605 TGGGTGGGAGGGTGGTGTCTAGG + Intronic
1122606101 14:102948344-102948366 GGGGTGGGGGGTAGGTGTGGAGG + Intronic
1122611334 14:102985288-102985310 GGGGTGGTATGGAGGTGAGGAGG + Intronic
1122803489 14:104244862-104244884 GGGGTGGGAAGGGGGCTTGGAGG + Intergenic
1123004263 14:105314133-105314155 GAGGTGGCAAGGAGGTGGCCGGG - Exonic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124507913 15:30294741-30294763 GGGGTGGGATGGGAGTGTGGCGG - Intergenic
1124735642 15:32243916-32243938 GGGGTGGGATGGGAGTGTGGCGG + Intergenic
1125817992 15:42602841-42602863 GGGGTGGGATGAAGGAGTTGGGG - Intronic
1125887672 15:43240731-43240753 GGGGTGTGGAGGAGGTGAAGGGG + Intronic
1126197747 15:45950743-45950765 GGGGAGGGCAGGAGGTGAGGCGG - Intergenic
1126464711 15:48951233-48951255 GGGGTAGGAAGGATGTGGCTGGG - Intronic
1127224858 15:56918531-56918553 GGGGCGGGGAGGAGCTGTCGGGG - Intronic
1127526025 15:59792473-59792495 GGGCGGGGAGGGAGGTGTCGGGG + Intergenic
1127822624 15:62672775-62672797 GGGGTTGGGGGGTGGTGTCGGGG + Intronic
1128028629 15:64460722-64460744 GGGGTGGGGGGGAGGGGCCGCGG + Intronic
1128090410 15:64915290-64915312 GGGGTTGGAAGAAGGGGTGGAGG + Intronic
1128114769 15:65098274-65098296 GAGGTGGGAAGGAAGTGTTTGGG - Intronic
1128283344 15:66415491-66415513 GGGGAGGGAGGGAGGAGTTGAGG - Intronic
1128758419 15:70198546-70198568 AGGGTGGGGAGGAGGTGGGGTGG + Intergenic
1129179793 15:73866891-73866913 GAGGTGGGAATAAGGGGTCGTGG + Intergenic
1129181958 15:73883220-73883242 GGGGTGGGACGGGGGTGTGAGGG + Intronic
1129208886 15:74054097-74054119 GGGGTGGGGAGGCGGCGTGGAGG + Intergenic
1129465376 15:75721737-75721759 GGGGTGGGTGGCAGGTGGCGAGG + Intergenic
1129596429 15:76967803-76967825 GGGGTGGGGAGGGGGTGAGGAGG - Intergenic
1129675310 15:77630156-77630178 GCGGTGGGTAGTAGGTGTGGTGG - Intronic
1130433004 15:83868022-83868044 GGGGAGGGAGGGAAGTGTTGAGG - Intronic
1130510858 15:84588078-84588100 GGGGTGGGGAGGCGGGGTGGTGG + Intergenic
1130569211 15:85025425-85025447 GGGGTGGGTAGGGGGTGTGGGGG + Intronic
1131062296 15:89411429-89411451 GCGGGGGGAAGGGGGTGGCGGGG + Intergenic
1132062530 15:98704250-98704272 GGGGAGGGAGGGAGGAGTTGGGG + Intronic
1132571174 16:644798-644820 GGCGCGGGAGGGGGGTGTCGGGG + Intronic
1132871678 16:2118218-2118240 GGTGGGGGCAGGAGGTGGCGGGG + Exonic
1133020786 16:2966114-2966136 CGGGTGGGAGGGAGGTGGTGGGG - Intronic
1133137333 16:3721007-3721029 GGGGTGGGTGGGGGGTGTCTCGG + Intergenic
1133297883 16:4764082-4764104 GGGGCTGGAAGGAGGTGGAGAGG + Intronic
1133520142 16:6549156-6549178 GGGGGGGGAAGGAGGAGGAGGGG + Intronic
1133552488 16:6870731-6870753 GGGGTGGGGAGGAGTTTTGGTGG - Intronic
1133597090 16:7303813-7303835 GGGGTGGGACGGAGGTAGAGAGG - Intronic
1133621591 16:7531875-7531897 GGGATGGGAAGGATGTGTGTGGG - Intronic
1134071441 16:11262429-11262451 GGGGTGGGGTGGGGGTGTCAAGG - Intronic
1134200292 16:12192283-12192305 GGAGTGGGAAGGAGTTGGCAAGG + Intronic
1134668388 16:16036636-16036658 GGAGTGGAAAGGAGGTGACCAGG - Intronic
1134802034 16:17093617-17093639 GGGGTGGGCAGGGGGTGATGTGG + Intergenic
1135390941 16:22092680-22092702 GGGGTGGTGAGAGGGTGTCGGGG + Intronic
1135459294 16:22627586-22627608 GGGGTGGGGAGGGGGTTGCGGGG + Intergenic
1136034786 16:27531004-27531026 GGGATGGGAAGAAGGTGGCGAGG - Intronic
1136128317 16:28201476-28201498 GGAGTGGGAAGGAGGAGGAGTGG + Intronic
1136350166 16:29701533-29701555 GGGGTGGACAGGATGGGTCGGGG - Intergenic
1136350174 16:29701553-29701575 GGGGTGGATAGGATGGGTCGGGG - Intergenic
1138144243 16:54594938-54594960 GGGGAGGGGGGGAGGTGGCGGGG - Intergenic
1138347984 16:56331610-56331632 TGGGTGGGCAGGAGGCATCGAGG - Intronic
1139701387 16:68710110-68710132 GGGGCGGGAAGGAGGGGAAGTGG + Intronic
1139744782 16:69065500-69065522 GGGGTGGAAAGGAGATGAGGCGG - Intronic
1140887808 16:79259854-79259876 GGGGTGGGAAGGGGGAGTTAGGG + Intergenic
1140942768 16:79737286-79737308 GGGTTGGGGAGGAGTTGTCCAGG - Intergenic
1141181189 16:81754282-81754304 GGCGAGGGAAGGAGGTGGGGAGG - Intronic
1141181205 16:81754320-81754342 TGGGCGGGAAGGAGGTGACAGGG - Intronic
1141181223 16:81754362-81754384 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181234 16:81754383-81754405 GGGGAGGGGAGGAGGTGGGGAGG - Intronic
1141181245 16:81754404-81754426 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181256 16:81754425-81754447 GAGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181261 16:81754436-81754458 GTGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181267 16:81754450-81754472 GGGGTGGAAATGAGGTGGTGGGG - Intronic
1141520726 16:84577125-84577147 GTTGTGGGAGGGAGGTGTAGGGG - Intronic
1141607350 16:85162001-85162023 GGGGTGCGCTGGAGGTGTTGAGG + Intergenic
1141617945 16:85220925-85220947 GGGGTGGGCAGGAGGGGTGGGGG - Intergenic
1141635388 16:85311513-85311535 AGGGAGGGAAGGAGGTGCCGGGG + Intergenic
1141899787 16:86983714-86983736 GGGGAGGGAAGCAGGGGTGGAGG + Intergenic
1142051331 16:87960039-87960061 GGTGGGGGTAGGAGGTGCCGGGG - Intronic
1142066134 16:88064163-88064185 GGCTGGGGCAGGAGGTGTCGGGG + Intronic
1142154878 16:88528364-88528386 AGGCAGGGAAGGAGGTGACGTGG + Intronic
1142958095 17:3534978-3535000 GGGGCTGGGAGGAGGTGTTGGGG - Intronic
1143013475 17:3879223-3879245 GGGATAGGAAGGAGGTGGGGTGG - Intronic
1143125444 17:4638809-4638831 TGGGTGAGAGGGAGGTGTCCTGG - Intronic
1143174221 17:4947488-4947510 GGGGGGGGAAGGGGGTTTCCGGG - Intronic
1143403024 17:6658003-6658025 TGGGTGAGAGGGAGGTGTCCTGG + Intergenic
1143444343 17:6998615-6998637 GGGGTGGGACAGTGGTGGCGGGG - Intronic
1143539107 17:7558979-7559001 GGGGTAGCAAGGAGGTGGCGGGG - Exonic
1144078870 17:11744243-11744265 GGTGTGGGAAGGAGCTGTAGTGG - Intronic
1144128577 17:12224376-12224398 TGAGTGGGAAGGAGGTCTCCAGG + Intergenic
1144579572 17:16450769-16450791 GGGGTGGACAGGAGGTGGAGAGG + Intronic
1144775153 17:17781581-17781603 GGGCTGGGAGGGAGGGGTCTGGG + Intronic
1146147817 17:30437120-30437142 GGGGTGGGGAGTAGGGGTTGGGG + Intronic
1146208146 17:30922233-30922255 GGTGTGGGTGGGAGGGGTCGGGG - Intronic
1146928447 17:36761572-36761594 AGGGTGGGGAGGAGGGGACGAGG - Intergenic
1147036424 17:37684959-37684981 GTGGTGGGAGGAAGGTGTGGGGG + Intergenic
1147110398 17:38257233-38257255 GGGTTGGGAAGGAGGCGGTGCGG + Intergenic
1147242685 17:39100865-39100887 GGGGAGGGCAGGAGGGGTCGTGG + Intronic
1147422915 17:40331418-40331440 GGGGTGGGAAGGGACTGTGGAGG + Intronic
1147646026 17:42034374-42034396 GGCTTGGGAAGCAGGGGTCGGGG + Intronic
1147905138 17:43817883-43817905 GGGGTGGGAAGTAGGAGGTGGGG - Intronic
1148048597 17:44758718-44758740 GGGGAGGGAAGCAGGGGACGGGG - Intergenic
1148194218 17:45701644-45701666 GGAGAGGGAAGGGGGTGTGGAGG - Intergenic
1148333268 17:46824831-46824853 GGGGTGGGTTGGAGTTGTAGGGG - Intronic
1148419112 17:47531198-47531220 GGGCTGGGAAGGAGGCGGTGCGG - Exonic
1148899959 17:50867607-50867629 GGGGAGCGAAGGAGGGGACGGGG + Intronic
1149866549 17:60154238-60154260 GGGGTGGGTGGGAGGGGTGGGGG + Intronic
1150640331 17:66945369-66945391 GGGGTGGGATGGGGGTGGAGGGG + Intergenic
1151200875 17:72467331-72467353 GTGATGAGAAGGAGGTGTCTGGG + Intergenic
1151491028 17:74432429-74432451 GGGGTGGGAGGGACGCGGCGCGG - Intronic
1151635462 17:75344837-75344859 GGGGTTGGGAGGGGGTGTGGGGG - Intronic
1151698643 17:75731023-75731045 AGGGTGGGCAAGAGGTGTCTTGG + Intronic
1151782788 17:76258481-76258503 TGGGTGGGAAGCAGATGTAGAGG - Intergenic
1152317627 17:79590117-79590139 GGGGTGGGGAGGCGGTGTTGGGG - Intergenic
1152336947 17:79703959-79703981 GTGGGGGGTAGGAGGTGGCGTGG + Intergenic
1152344190 17:79741678-79741700 GGACTGGGAGGGAGGGGTCGTGG - Intronic
1152472672 17:80499141-80499163 GGGTTGGGTAGGAGATGGCGAGG - Intergenic
1152572529 17:81127051-81127073 GGGGTGGGGGGCAGGTCTCGGGG + Intronic
1152853056 17:82648733-82648755 GGGGCGGGGAGGAGGGGGCGGGG + Intergenic
1152906050 17:82971533-82971555 AGGCTGGGAAGGAGGCGTGGGGG + Intronic
1153190082 18:2528490-2528512 GGGGAGGGATGGGGGTGTCAAGG - Intergenic
1153715205 18:7840072-7840094 GGGGTGGGGTGGAGGTGGGGGGG + Intronic
1153720434 18:7896304-7896326 GGGGTGGGAAACAGGAGGCGGGG - Intronic
1154329607 18:13418824-13418846 AGGGTGGGAACCAGGTGTGGCGG - Intronic
1155096442 18:22560121-22560143 AGGTTGGGAAGGAGGCGTGGAGG + Intergenic
1155243460 18:23885141-23885163 GGGTAGGTAGGGAGGTGTCGGGG - Intronic
1155407008 18:25500132-25500154 GGGGTGGGATGGAGGGGGTGGGG + Intergenic
1155457304 18:26031823-26031845 TGGGTGTGAAGGAAGTGTAGTGG + Intronic
1156036836 18:32773574-32773596 GGGGTGGGGGGGAGGTGTGGGGG - Exonic
1156229612 18:35140657-35140679 GGGGTGGGAAAGAGTTGTTCTGG - Exonic
1156483573 18:37450884-37450906 GGAGTGGGAAGGAGGGGACCTGG + Intronic
1157152668 18:45233768-45233790 GGTGGGGGAAGGGGGAGTCGGGG - Intronic
1157491948 18:48129762-48129784 GGGGTGGGGAGGTGGGGTGGAGG - Intronic
1157610485 18:48952115-48952137 GGGGCGGGGAGGAGGCGGCGCGG - Intergenic
1157790004 18:50523305-50523327 GGGGAGGGAAGGAGGGGCTGAGG - Intergenic
1158137509 18:54223984-54224006 GGGGCGGGGAGGGGGTGGCGGGG - Intronic
1159662687 18:71118415-71118437 GGGGTGGGGAGGAGGGAGCGGGG - Intergenic
1160170974 18:76554083-76554105 GGGGTGGGGAGGAGAGGTTGGGG + Intergenic
1160451783 18:78971422-78971444 GGCCTGGGAAGGACGTGTCTCGG + Intergenic
1160996294 19:1883608-1883630 GTGGGTGGAAGGAGGTGTCAAGG - Intronic
1161250634 19:3278143-3278165 GGGGTGGGAAAGGGGTGAGGGGG + Intronic
1161251705 19:3284410-3284432 GGGGAGGGAAGAAGTTGTCCAGG - Intronic
1161455004 19:4365693-4365715 AGGGTGGGGAGGAGATGTGGGGG - Intronic
1161642487 19:5432905-5432927 GGGGAGGGTGGGAGGTGTCGAGG + Intergenic
1161983129 19:7640839-7640861 GGTGGGGCAAGGAGGTGTGGGGG + Intronic
1162850836 19:13429998-13430020 GAGGGGGGAAGGGGGAGTCGGGG + Intronic
1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG + Exonic
1163262997 19:16202483-16202505 GGGGTGTGAAGAAGCTTTCGGGG - Intronic
1163369853 19:16896066-16896088 GGGGCGGGGCGGAGGAGTCGGGG + Intronic
1163489165 19:17606801-17606823 GGGGTGGGCTGGGGGTGTGGGGG - Intronic
1163520375 19:17788235-17788257 GGGGTGGGGAGGAGGGGTACGGG - Intronic
1163637823 19:18445541-18445563 GGGGTGGGGAGGGGGTGGGGGGG + Intronic
1163861101 19:19743317-19743339 GGAGTGGCAAGGAGGTGACATGG + Intergenic
1164458296 19:28426999-28427021 GGGGAAGGAAGGAGGTGGGGAGG + Intergenic
1164574164 19:29396085-29396107 GGGGAGGGAGGGAGGAGTTGTGG - Intergenic
1164730745 19:30502401-30502423 GGGGTGGGATTGAGGTGACCAGG + Intronic
1164845924 19:31432540-31432562 GGGGTGTGAAGGAAGTGCTGTGG - Intergenic
1164946163 19:32294940-32294962 GGGGTGGGCAGGAGGTCAAGAGG + Intergenic
1165434332 19:35788122-35788144 GGGGTGGGCAGGAGGGGAAGAGG - Exonic
1165742003 19:38210302-38210324 GGGGTGAGAAGGAGGTTTAACGG - Intergenic
1165760115 19:38316040-38316062 GGGGGGGGCTGGAGGGGTCGGGG - Intronic
1166061467 19:40328346-40328368 TGGGTTGGTAGGAGGTGTTGGGG - Intronic
1166323543 19:42034861-42034883 GGGGCGGGAAGGAGGGGACAAGG + Intronic
1166762882 19:45235651-45235673 GGAGGGGGGTGGAGGTGTCGAGG - Intronic
1166837663 19:45677291-45677313 GGGGTGGGGGGGCGGGGTCGGGG + Intronic
1166885854 19:45960681-45960703 GGGGAGGGAGGCAGGTGTCAGGG - Intronic
1166966078 19:46530076-46530098 GGGTTGGGCAGGAGGTGGCAGGG - Intronic
1167331795 19:48860612-48860634 GGGGGCGGAAGGAGGTGGAGGGG - Intronic
1167411517 19:49346986-49347008 AGGGTGGGTTGGAGGTGTCTGGG - Intronic
1167636690 19:50659758-50659780 GGGGGGGGGAGGAGAGGTCGGGG - Intronic
1168073375 19:53964764-53964786 GGGCTGGGAAGCAGGAGTCTTGG + Intronic
1168279346 19:55296136-55296158 GGAGTGGGGAGGAGGAGTGGGGG - Intronic
1202705547 1_KI270713v1_random:21047-21069 GGGGTGGGAAGGATGGGTCACGG + Intergenic
924979691 2:208151-208173 GGGGTGTTGAGGAGGTGACGAGG + Intergenic
925313750 2:2906652-2906674 GGGGGTGGAGGGAGGTGTAGGGG - Intergenic
925313819 2:2906834-2906856 GGGGGTGGAGGGAGGTGTAGGGG - Intergenic
925313839 2:2906880-2906902 GGGGGTGGAGGGAGGTGTAGGGG - Intergenic
925313855 2:2906926-2906948 GGGGGTGGAGGGAGGTGTAGGGG - Intergenic
925474757 2:4200602-4200624 AGGGTTGGAGGGTGGTGTCGGGG + Intergenic
926079503 2:9972955-9972977 GGTGTGGGAAGGTGGTGCTGAGG + Intronic
926934797 2:18076053-18076075 GGGCTGAGAAGGAGGAGTCGGGG - Intronic
927810019 2:26175483-26175505 GGCGTGGGGAGGGGGTGTCAAGG + Intronic
927845901 2:26472845-26472867 CCGGTGGGAGGGAGGTGGCGGGG + Intronic
928145439 2:28770384-28770406 GGGGGGGGAGGGGGGTGTGGGGG + Intronic
928332721 2:30369917-30369939 GGGGTGAGAAGGAGGGCTAGGGG + Intergenic
928944639 2:36761355-36761377 GGCCTGGGATGGGGGTGTCGGGG + Intronic
929520656 2:42647520-42647542 GGGGTGGGAGGCAGGTGGGGTGG - Intronic
929592895 2:43158424-43158446 TGGGTGGGAAGGAGCTATCTGGG + Intergenic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
929781922 2:44962577-44962599 GGGGTAGGAAGGAGGGGCTGTGG - Intergenic
930189186 2:48440764-48440786 GGGGTGGGAGGAAGGTGGAGTGG - Intronic
931285304 2:60827259-60827281 GGGATGGGTAGGAGGTGACCAGG - Intergenic
932015403 2:68021864-68021886 GGGGTGGGAAGAAGTGGGCGGGG - Intergenic
932073749 2:68644593-68644615 GGGGTGGGGAGGTGGGGTCCTGG + Intronic
932448643 2:71795780-71795802 GGGGTGAGAAGCAGGTGGCAAGG + Intergenic
932457241 2:71857591-71857613 GGGGTAGGAGGGAGGGGTGGTGG - Intergenic
932573331 2:72949816-72949838 GGGGTGAGAGGGAGGTGTTGAGG + Intronic
933636666 2:84715648-84715670 GGGGAGGGAAGGGGGTATTGTGG + Intronic
933989289 2:87622205-87622227 AGGGTGGGAAGGAGAGGTGGTGG - Intergenic
934489919 2:94755431-94755453 GGACTGGGAAGGAGGGGTCTGGG + Intergenic
934618755 2:95791484-95791506 GTGGTGGGAAGGAGGGGCTGAGG + Intergenic
934642138 2:96033073-96033095 GTGGTGGGAAGGAGGGGCTGAGG - Intronic
934900466 2:98155752-98155774 GGTGTTGGAAGATGGTGTCGGGG + Intronic
934928489 2:98399327-98399349 GGGGTTGTCAGGAGGTGTAGAGG + Intergenic
936026059 2:109031895-109031917 GGGAGGGGAAGAAGGTGGCGGGG - Intergenic
936304554 2:111328621-111328643 AGGGTGGGAAGGAGAGGTGGTGG + Intergenic
937065121 2:119011803-119011825 GGGGTCGGAAGGAGAGGGCGAGG - Intergenic
938119597 2:128624343-128624365 GGGGTGGGAAGGAGGGGAGCTGG - Intergenic
938374896 2:130798701-130798723 TGGGTGGGAGGGTGGTGGCGCGG - Intergenic
938650325 2:133376385-133376407 CGGGGGAGAAGGAGGAGTCGAGG - Intronic
938702053 2:133888288-133888310 GTGGGGGGAAGGAGGTGAGGCGG + Intergenic
938734797 2:134176202-134176224 GGATTGGGAAGGGGGTGTGGAGG + Intronic
939019052 2:136937285-136937307 GGTGAGGGAAGGAGGTGATGTGG - Intronic
939898594 2:147823203-147823225 GGGGAGGGAAGGAGCTATAGTGG + Intergenic
940515447 2:154678519-154678541 GGGATGGGAAGGAGGGGGCTTGG + Intergenic
942052662 2:172155197-172155219 GGGGTGGTAACGAGGTGTTGGGG - Intergenic
942568005 2:177285576-177285598 GGGGTGGGATGAAGGTTTGGTGG - Intronic
943682879 2:190786387-190786409 GGGGTGGGGAGGAGGGGCGGGGG - Intergenic
944070123 2:195658011-195658033 CGGGTGGGCCGGAGGTGGCGCGG + Intronic
945404069 2:209423983-209424005 GGGGCGGGGAGGAGGGGCCGAGG + Intergenic
946208842 2:218130951-218130973 GGGGTGGGCTGGAGGTGTATGGG - Intronic
946248159 2:218398712-218398734 GGGGAGGGGAGGAAGTGCCGAGG + Intronic
946345629 2:219108088-219108110 GGGCAGGGGAGGAGGTGTGGGGG - Intronic
946372839 2:219290938-219290960 GGGGAGGGACGGAGGAGGCGAGG + Intronic
947451440 2:230212555-230212577 GGAGTGGGAAGCAGGTGTTCTGG + Intronic
947703725 2:232257491-232257513 AGGGTGGGAGGGAGGTGGAGTGG - Intronic
948266359 2:236637931-236637953 GAGGAGGGAAGGAGGTGGAGAGG - Intergenic
948313420 2:237007799-237007821 GGGGTGGAGAGGGGGTGTAGCGG + Intergenic
948843591 2:240672396-240672418 GGGTGGTGAAGGAGGTGTCGCGG - Intergenic
948954033 2:241272995-241273017 GGGTGGGGAAGGCGGTGCCGAGG + Intronic
1168790879 20:574841-574863 GGGGAGGGCAGGAGGGGTGGGGG + Intergenic
1169206191 20:3741664-3741686 GGGGTGGGGAGGTGGTGTCCTGG - Intronic
1169365777 20:4991060-4991082 CGGGTGGGAGGGAGGTGTGAGGG + Intronic
1171879783 20:30610197-30610219 GGGATGGGAGGGAGGGGTCTGGG + Intergenic
1172035826 20:32010301-32010323 GGGGAGGGCAGGGGGTGTGGAGG - Intergenic
1172502804 20:35439009-35439031 GGGGTAGGGAGGGGGTGTAGTGG - Intronic
1172599102 20:36171442-36171464 TGGGTGGGGAGGAGGTGATGGGG + Intronic
1173103566 20:40110260-40110282 GTTCTGGGAAGGAGGTGTCAGGG + Intergenic
1173915892 20:46708847-46708869 GGGGTGGGAAGGAGCTTATGGGG - Intergenic
1174031523 20:47632273-47632295 GGGGTGGGGATGAGGTTTGGAGG + Intronic
1174049742 20:47759301-47759323 GGGCTGGAAAGGAGAGGTCGAGG - Intronic
1174063619 20:47849365-47849387 GGGGTGAGGAGGAGGTGGGGAGG + Intergenic
1174197611 20:48784769-48784791 GGAGTGGGAAGGAGCTGCTGTGG - Intronic
1174216498 20:48920614-48920636 GGTGTAGGAAGGAGGTGAAGGGG - Intergenic
1174400329 20:50272386-50272408 GGGGTGGGGAGCAGGAGTCTGGG + Intergenic
1174444111 20:50579021-50579043 GGGCTGGGTGGGAGGTGTCTGGG - Intronic
1174650385 20:52119869-52119891 TGGGTGGGGAGGAGGTGTGAAGG + Intronic
1174804498 20:53593881-53593903 AGGGAGGGAGGGAGGCGTCGCGG + Intronic
1175277798 20:57783664-57783686 AGGGGGGTAAGGAGGTGACGGGG - Intergenic
1175462254 20:59160345-59160367 GGGGGAGGAAGGATGTGGCGAGG + Intergenic
1175491589 20:59384052-59384074 GTGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491667 20:59384342-59384364 GAGGGGGGAAAGAGGTGGCGGGG + Intergenic
1175491673 20:59384358-59384380 GGCGGGGGAAGGAGGTGATGGGG + Intergenic
1175491759 20:59384620-59384642 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491777 20:59384679-59384701 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491795 20:59384738-59384760 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491830 20:59384856-59384878 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491848 20:59384915-59384937 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491866 20:59384974-59384996 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491884 20:59385033-59385055 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175491902 20:59385092-59385114 TGGGGGGGAAGGAGGTGATGGGG + Intergenic
1175498908 20:59435478-59435500 GGGTGGGGAAGGAGGTGAAGAGG - Intergenic
1175828752 20:61950929-61950951 AGGGTGGGAAGGAGGGGCCCAGG - Intergenic
1175828786 20:61951003-61951025 AGGGTGGGAGGGAGGTGCCCAGG - Intergenic
1175952053 20:62588796-62588818 GGGGTGGGCAGGTGCTGTGGTGG - Intergenic
1176041923 20:63070243-63070265 GGGGTGGGGAGGAGGAGCAGGGG - Intergenic
1176088837 20:63310021-63310043 AGGCTGAGAAGGGGGTGTCGAGG + Intronic
1176091189 20:63319318-63319340 TGGGTGGGAGGCAGGTGTCCCGG + Intronic
1176096749 20:63347789-63347811 GGGATGGGAGGGATGTGCCGCGG + Intronic
1176112759 20:63418026-63418048 GGGGAGGGAAGGACATGTCCAGG - Intronic
1176151804 20:63595279-63595301 GGGGTGGGAGGGAGGGGGCCGGG + Intronic
1176160474 20:63645157-63645179 GGAGTGGGAAGGAGGAGGAGGGG - Intronic
1176281472 20:64316314-64316336 GGGGCGGCTAGGAGGGGTCGGGG - Intergenic
1176733485 21:10521897-10521919 AGGGAGGGAGGGAGGCGTCGCGG - Intronic
1177513991 21:22123689-22123711 GGAGTGGGAAGGTGGAGTTGCGG - Intergenic
1177993240 21:28063906-28063928 GGAGTGCGAAGGAGGTGGCACGG - Intergenic
1179495583 21:41769426-41769448 GAGGTGGGAAGGAGGAGTTGGGG + Intergenic
1179714292 21:43279858-43279880 GGGGAGGGGAGGAAGTGTCGAGG + Intergenic
1179929651 21:44558719-44558741 GGGGTGGGGAGGAGGTGAGCTGG + Exonic
1179939153 21:44627146-44627168 GGGGTGGGGAGGAGGTGAGCTGG - Exonic
1179942000 21:44646433-44646455 GGGGTGGGGAGGAGGTGAGCTGG - Exonic
1180035390 21:45245619-45245641 GGGGTGGGGATGAGGGGTGGGGG + Intergenic
1180049395 21:45324418-45324440 GGAGTGGGAGGGAGGTGAGGGGG + Intergenic
1180059878 21:45379326-45379348 GGGCTGGGGAGGAGGTTCCGAGG - Intergenic
1180065150 21:45408706-45408728 GGGGTGGGAGGGTGTTGTGGGGG - Intronic
1180560398 22:16610276-16610298 AGGGAGGGAGGGAGGCGTCGCGG + Intergenic
1181107229 22:20582538-20582560 GCGGTGGGCAGGTGGTGTGGAGG + Intronic
1181169764 22:21001510-21001532 GGGGTCGCAGGGAGGTCTCGTGG - Intronic
1181373079 22:22433076-22433098 GGGGAGGGAATGAGGTGACAAGG - Intergenic
1181487214 22:23238872-23238894 GGGGTGGGGGGCAGGTGGCGGGG + Intronic
1182024676 22:27108861-27108883 GGGGCGGGGGGGGGGTGTCGGGG - Intergenic
1182351956 22:29704360-29704382 GGGGTGGTCAGGAGGTGGTGGGG - Intergenic
1182351976 22:29704402-29704424 GGGGTGGTCAGGAGGTGGTGGGG - Intergenic
1182831747 22:33309827-33309849 GGGGTGAGATGAAGGTGTCAGGG + Intronic
1183314075 22:37127687-37127709 GGGGAGGGAAGGAGGAGGCTGGG + Exonic
1183335414 22:37243504-37243526 GGGTTGGGGAGGATGTGTGGGGG - Intronic
1183380338 22:37487485-37487507 GGGCTGGGAAGGAGGCGGCGAGG - Intergenic
1183706978 22:39480272-39480294 GTGGTGGGAAGGAGCTGGAGAGG + Intronic
1183895623 22:40966302-40966324 GGGCTGTAAAGGAGGTGTCAGGG - Intronic
1184230631 22:43156535-43156557 GGGGTGGGAGGGAGGGGGAGGGG + Intronic
1184561631 22:45267240-45267262 GGGGTGGGATGGGGGTGGGGTGG + Intergenic
1184716040 22:46282331-46282353 GGGGAGGCAAGGTGGTGTCCAGG + Intronic
1184808340 22:46811234-46811256 GGAGTGGTAAGGAGCTGTCAGGG + Intronic
1185151733 22:49167643-49167665 GGGGCGGGGAGGGGGTGTGGAGG + Intergenic
1185206315 22:49541194-49541216 GGGGTGAGAAGGGGGTGACTGGG + Intronic
1185294325 22:50045898-50045920 AGCGTGGGAAGAAGGAGTCGGGG + Exonic
949090894 3:27798-27820 GGGGTGGGAGGGTGGTGGTGAGG - Intergenic
950500890 3:13362915-13362937 GAGCTGGAAAGGAGGTGACGGGG - Intronic
950656800 3:14441583-14441605 GGGAGAGGAAGGAGGTGTGGGGG + Intronic
950672810 3:14537345-14537367 GGAGTGGAGAGGAGGTGTGGAGG - Intronic
950896442 3:16455952-16455974 GCGGTGGGAGGGAGGTGTCGGGG - Intronic
953030693 3:39177954-39177976 GGGGTGGGAAGGGGGTGGGAAGG + Intergenic
953194338 3:40718178-40718200 GGGGTGGGGAGGAGATGGGGAGG + Intergenic
953661471 3:44894300-44894322 GGGGTGGGAGAGAGCTGTGGCGG - Intronic
953769032 3:45764794-45764816 GGGGTGTGAAGGAACTGTCTAGG + Intronic
954329330 3:49881136-49881158 GGGGTGGGAGGGAGGTGGCAAGG + Intergenic
954969702 3:54640972-54640994 GAGGTGGGAAGGAAGAGTCTAGG - Intronic
955073087 3:55588259-55588281 GGGGCTGGAAGGAGGGGTTGGGG - Intronic
955081362 3:55660465-55660487 GGGGTGGGGCGGGGGTGGCGTGG + Intronic
955238974 3:57163794-57163816 GGGGGGGGAAGGGGGTGGCGGGG + Intronic
956205163 3:66747955-66747977 GGGGTGGGAAGGGGTGGTGGAGG - Intergenic
956321946 3:68007597-68007619 GGGGAGGGAGGGAGGTGGGGTGG - Intronic
956550924 3:70458652-70458674 AGGGTGGGAAGGAGGGTTAGTGG + Intergenic
957055143 3:75436552-75436574 GGGGTGGGATGGGGGGGTGGTGG + Intergenic
960162419 3:114365102-114365124 GGGGTGGGTAGGAGGAGGCTGGG - Intronic
960702394 3:120451103-120451125 GGGGTCGGAAGGAGGGGGAGCGG - Exonic
961323027 3:126091415-126091437 GAAGTGGGCAGGAGGGGTCGGGG + Intronic
961516404 3:127440194-127440216 GGGTGGGGAAGGAGGTGGCTTGG - Intergenic
961795425 3:129405343-129405365 GGGTTGGGAAGGGGCTGTGGAGG + Intronic
962791072 3:138812193-138812215 AGGGTGGGAGGGAGGTGACTGGG + Intronic
962960604 3:140308034-140308056 GGGGTGGGGAGGAGGTGCTGTGG - Intronic
963282453 3:143398101-143398123 GTGGTGGTAAGGTGGTGGCGGGG - Intronic
963308329 3:143679037-143679059 GGGGTGGGAAAGAGGTGAGGGGG + Intronic
963512652 3:146268180-146268202 GGAGTGGGGAGGAGGGGACGTGG + Intergenic
965513628 3:169596998-169597020 GGGGTTGGAAGGAGGTGAAGAGG + Intronic
967904081 3:194486729-194486751 GGTGAGGGAAGGAGGCGCCGCGG + Intronic
967994931 3:195159427-195159449 GGAGTGGGTTGGAGGTGACGGGG - Intronic
968024906 3:195433079-195433101 GGGGTGGGCAGGGGGAGTCCTGG - Intronic
968205143 3:196793125-196793147 GGGGTGTAAAGGAGGAGTCCTGG - Intronic
968449215 4:667297-667319 GGGGTGGGTAGGATGGGGCGGGG - Intronic
968518244 4:1023719-1023741 GGGGTGAGCAGGGGGTGACGGGG + Exonic
968544936 4:1193775-1193797 GGCGTGGGAAGGACGTGGGGGGG + Intronic
968544946 4:1193799-1193821 GGCGTGGGAAGGACGTGGGGGGG + Intronic
968544956 4:1193823-1193845 GGCGTGGGAAGGACGTGGGGGGG + Intronic
968609685 4:1551312-1551334 GAGGTGGGAAGGGGGTGTCACGG + Intergenic
968613843 4:1568677-1568699 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613854 4:1568702-1568724 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968903520 4:3441833-3441855 GAGGTGGGCAGCAGGTGTGGGGG + Intergenic
969398760 4:6939746-6939768 GGGGTGGGGTGGTGGTGTGGAGG + Intronic
970316824 4:14835877-14835899 GGAGTGGGAAGGATTTGTAGTGG - Intergenic
971218110 4:24680675-24680697 AGGGAGGGAAGGAGGTGTTAAGG + Intergenic
971485585 4:27156756-27156778 GGGGTGGGGGTGAGGTGTTGGGG + Intergenic
973613730 4:52659470-52659492 GAGCTGGGAAGGAGGCGGCGCGG - Intergenic
974639189 4:64607314-64607336 GGGGTGGGAAGTTGGTATGGGGG + Intergenic
975736869 4:77389513-77389535 AGGGAGGGAAGGAGGTGCCTAGG - Intronic
976832344 4:89329776-89329798 GGGGTGGGCAGGAAGTGCTGTGG + Intergenic
976897353 4:90128015-90128037 GGGGTGGGAAGGAGGCGGGCGGG + Intronic
977264080 4:94833624-94833646 GGCAGGGGAAGGAGGTGTTGGGG - Intronic
978826874 4:113035196-113035218 GGGTTGGGAAGGGGGTGTTCTGG + Intronic
980113977 4:128661706-128661728 GGAGTGGGGAGGAGGTAACGAGG - Intergenic
981073488 4:140568920-140568942 AGGGTGGGTAGGAGGGGACGCGG - Intergenic
982510327 4:156274729-156274751 GGGGTGGGATGGAGGGGATGGGG + Intergenic
982750201 4:159151933-159151955 GCAGTGGGAAGGAGCTGTTGAGG + Intronic
983535841 4:168855991-168856013 GGGGAGAGAAGGAGGTGGGGAGG - Intronic
985486132 5:151716-151738 GGGGTAGGAAGTAGGTTTCCAGG - Intronic
985861173 5:2471669-2471691 GGGCTGGGAAGGAGGAGCCCTGG + Intergenic
986233556 5:5887165-5887187 GGGGTGGGAAGGGGTGGTGGTGG + Intergenic
986255551 5:6100299-6100321 GGGGTGAGAAGGAGGTCCCCGGG - Intergenic
986322215 5:6641262-6641284 GGGTCGGGAAGAAGGTGTCTGGG - Intronic
987075726 5:14380266-14380288 GGGGCGCGAAGGAGGAGGCGGGG - Intronic
987075732 5:14380285-14380307 GGGGCGCGAAGGAGGAGGCGGGG - Intronic
987075738 5:14380304-14380326 GGGGCGCGAAGGAGGAGGCGGGG - Intronic
988813347 5:34806595-34806617 GGGGTGAGGAAGAGGGGTCGGGG + Intronic
988832925 5:35004785-35004807 AGGGTGGGTAGGAAGTGTGGAGG - Intronic
989100064 5:37814980-37815002 GGGGTGGGAAGAAGTTGGCTAGG - Intronic
990339102 5:54804844-54804866 GGGGTGGGAAGGCCGTGATGGGG - Intergenic
991932332 5:71765966-71765988 GCGGTGAGAAGGAGGTGGTGTGG + Intergenic
992127131 5:73653770-73653792 GGGCTGGAAAGGAGCTGTAGGGG - Intronic
992169651 5:74089139-74089161 TGAGTGGGAAGCAGGTGTTGAGG - Intergenic
992205588 5:74427577-74427599 GGGGAGAGAAGGAGGTGTGATGG - Intergenic
993022862 5:82612590-82612612 GGGGTGGGAGGGTGGTGGAGAGG + Intergenic
993084774 5:83349901-83349923 GGGAAGGGAAGGAGGGGTCATGG - Intronic
994120717 5:96109644-96109666 GAGGTGGGAAGGAAGTGTTCTGG + Intergenic
994839840 5:104909239-104909261 GGGTTGGGGAGGGGGTGTGGGGG - Intergenic
995553085 5:113299774-113299796 GGTGTGGGCAGGAGGTGGCAGGG + Intronic
995754110 5:115484361-115484383 GGGGTGGGAAAGAGGTACAGTGG - Intergenic
996571398 5:124935977-124935999 GGGGAGGGAAGGGGGGGTCTAGG - Intergenic
997022476 5:130017442-130017464 GTGGTGGGATGGAGGGGTCTGGG + Intronic
997292181 5:132745590-132745612 GGGGAGGGAAGGAGGGGACAAGG - Intergenic
997586846 5:135048476-135048498 GAGCTGGGAAGGAGGTCTCCTGG + Intronic
998531956 5:142893261-142893283 GGGGTGGGAGTCAGGTGCCGTGG - Intronic
999506252 5:152200280-152200302 GGGATGGGAAGGATGAGTTGAGG + Intergenic
999694826 5:154179478-154179500 GGGGTGGGGAGAAGGTGCGGAGG + Intronic
1000173271 5:158725282-158725304 ATGGTGGGAAGGAGGGGTTGTGG - Intronic
1001315250 5:170637228-170637250 GGGGTGGGTAGAGGGTGTCAAGG - Intronic
1001406429 5:171480496-171480518 GGGGAGGGGAGGAGGGGTCAGGG - Intergenic
1001747415 5:174102331-174102353 GGGGTGGGAAAGAGATGGCATGG + Intronic
1001799330 5:174529686-174529708 GGGGAGTGGAGGAGGTGTCTAGG - Intergenic
1001960684 5:175878875-175878897 GGGGTGGGAAGGAGAGGGCGGGG - Intronic
1002094971 5:176825248-176825270 GGGGTGGAAAGGAGGATTCAGGG + Intronic
1002415096 5:179116253-179116275 GGGGTGGGGGGGGGGTGCCGTGG - Intronic
1003020471 6:2504992-2505014 GGGGTGGGGAGGAGATGAGGAGG - Intergenic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1003165056 6:3670317-3670339 GGGGTGGGGAGGGGGTGGGGGGG + Intergenic
1003181830 6:3798694-3798716 GGGGTGGGAAGGAAGTGGCCTGG - Intergenic
1003270840 6:4606480-4606502 GGGGTGAGAAGCAAGTGTCTCGG - Intergenic
1003364225 6:5457238-5457260 GGGGTGGGAGGTGGGTGTGGTGG - Intronic
1004074941 6:12336523-12336545 GGCGTGGGATGAAGGTGTGGAGG - Intergenic
1004159100 6:13197772-13197794 GGGCTGGGAAGGAGGTGCAGAGG - Intronic
1004193728 6:13486601-13486623 GGGGTGGGACGGAGGATGCGGGG + Intronic
1004367991 6:15028088-15028110 GGGGAGGGTAGGAGGTGAGGTGG + Intergenic
1006173337 6:32107916-32107938 CAGGTAGGAAGGAGGTGTCAGGG + Intronic
1006173563 6:32108948-32108970 GGGGTGGGCAGTATGTGTCAGGG - Intronic
1006337054 6:33426290-33426312 GGGGTGGGGAAGAGGTCTGGGGG - Intronic
1006434443 6:34018968-34018990 GGGATGGGAAGGGGGAGCCGTGG + Intronic
1006901863 6:37507824-37507846 GGTGTGGGTAGGTGGTGTTGGGG + Intergenic
1006946501 6:37787952-37787974 GGGTAAGGAAGGTGGTGTCGTGG + Intergenic
1007088881 6:39169577-39169599 GGGGTGGGAGGCGGGTGTCCGGG + Intergenic
1007341570 6:41194192-41194214 GGGGTGGGGAGGAGGGGCAGGGG - Intronic
1008537491 6:52517901-52517923 GGGGGTGGGAGGAGGTGGCGAGG + Intronic
1010717705 6:79248762-79248784 TGGGCGGGAAGGAGATGTCAGGG - Intergenic
1011970094 6:93211512-93211534 GGGGAGGGAGGGAGGGGTGGAGG + Intergenic
1012509817 6:99990845-99990867 AGGGTGGGAAGGAGGAGAGGTGG - Intronic
1013048342 6:106509757-106509779 GGGGTGGGCAGGAGGCGACTTGG + Intergenic
1013350205 6:109298772-109298794 GTGGTGGGAAGGAGGAGAGGTGG - Intergenic
1014551876 6:122798464-122798486 GGGCTGGGAGGGAGGTGTGGTGG - Intronic
1015149304 6:130020093-130020115 GGGGAGGAAAAGAGGGGTCGGGG + Intronic
1016575406 6:145564775-145564797 GGGGGGGGCAGGGGGTGTGGAGG + Intronic
1016802650 6:148182373-148182395 AGGGAGGGAAGGAGGTAGCGAGG + Intergenic
1016940735 6:149481190-149481212 GGGGAGGGATGGAGGTGGCTGGG - Intronic
1018158204 6:161009859-161009881 GTCGGGGGAAGGAGGTGGCGGGG + Intronic
1018651530 6:165995762-165995784 GGGGTGGGAGGGAGATGGAGTGG - Intergenic
1018937176 6:168281112-168281134 GGGGAGGGAAGGCGGTCTCATGG + Intergenic
1019272658 7:159169-159191 GGGGAGGGAAGGTGGTCTAGTGG - Intergenic
1019475910 7:1244151-1244173 GGGCCCGGAAGGAGGGGTCGGGG - Intergenic
1019650472 7:2154968-2154990 GGGGTGGGGAGGAGGAGCCCAGG + Intronic
1020014069 7:4820865-4820887 GTGGTGAGAGGGAGGTGGCGGGG - Intronic
1020410940 7:7890798-7890820 GGAGTGGGAAAGAGGTGGGGAGG - Intronic
1020535466 7:9390897-9390919 GGAGTGGGGAGGAGTTGTAGGGG + Intergenic
1021998288 7:26201508-26201530 GGGGAGGGAAGGGGGAGGCGGGG - Exonic
1022197484 7:28082878-28082900 GAGCTGGGAATGAGGTGTCCAGG - Intronic
1022541473 7:31139780-31139802 GGGGTGGGCAGGAGGGGGAGGGG - Intergenic
1022600034 7:31749295-31749317 GGGGTGGGCAGGAGAGGTGGTGG + Intergenic
1022957221 7:35392153-35392175 TGGGTGGGAATGAGCTGTCCTGG - Intergenic
1023101439 7:36722272-36722294 AGGGTAAGAAGGAGGTGTTGGGG - Intronic
1023854694 7:44175590-44175612 GGGCCTGGAAGGAGGTGTCTGGG - Intronic
1023873515 7:44275113-44275135 GGGGAGGGGAGGAGTTGTCACGG - Intronic
1023995372 7:45156319-45156341 GGGGTGGGCAGCAGGTGTAGGGG - Intergenic
1024257546 7:47549917-47549939 GGGGTGGGAGGGCGGGGACGTGG - Intronic
1025035417 7:55590277-55590299 GGGGCAGGAAGGAGGAGTCATGG - Intergenic
1026207487 7:68270825-68270847 GGGGTGGGAAGGAAGTAACCAGG + Intergenic
1026451953 7:70537171-70537193 CTGGTGGGAAGGAGGTGGAGGGG - Intronic
1026490218 7:70856710-70856732 GGGGAGTGCAGGAGGTCTCGAGG + Intergenic
1026896957 7:74014836-74014858 GTAGTGGGAAGGGGGTGTCTGGG + Intergenic
1027443900 7:78249706-78249728 GTAGTGGGAAGGAGGGGTAGGGG + Intronic
1027761585 7:82285533-82285555 GGGGTGATAAGGAGGTGTCAGGG + Intronic
1029453313 7:100654958-100654980 ATGGTGGGAAGGAGGTGCAGTGG + Intronic
1029459847 7:100688267-100688289 GGGGTGGGGAGGAGGGGACCTGG + Exonic
1029490694 7:100868505-100868527 GCGGTAGGCAGGAGGTGGCGGGG - Exonic
1030196605 7:106859177-106859199 GGGCTGGGAAGTGGGTGTTGGGG - Intergenic
1030435184 7:109508941-109508963 GGGGTGGGGTGGAGGTGGTGGGG - Intergenic
1031084218 7:117286468-117286490 GGGGGGAGAAGGAGGTGAGGAGG - Intronic
1031101583 7:117486875-117486897 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1031133710 7:117862313-117862335 GGGGTGGGGGGGCGGTGTGGTGG + Intronic
1032076586 7:128838904-128838926 GGGGTGGGATGGAGGACTCAGGG - Intronic
1032538430 7:132683908-132683930 GGGATGGGAAGGAGGCACCGGGG - Intronic
1033120811 7:138664993-138665015 GGGGTCGGGGGGAAGTGTCGGGG - Intronic
1033229059 7:139582662-139582684 GGGTTAGGAAGTAGGTGGCGGGG + Intronic
1034195143 7:149240389-149240411 GGGCTGGGAGGGGGGTGTTGGGG - Intronic
1034299519 7:150002906-150002928 AGGGTGGGAAGGACGCGTGGCGG + Intergenic
1034503636 7:151468186-151468208 GAGCTGGGAAGGTGGTGTGGTGG - Intronic
1034514805 7:151567506-151567528 GGGGTGGGAAGGATGTATTCAGG - Intronic
1034671493 7:152862241-152862263 CGGGTGCGAAGGAGGCGCCGAGG + Intergenic
1034972251 7:155426642-155426664 GGGGTGGGACAGAGGGGTCGTGG + Intergenic
1034974818 7:155441926-155441948 GAGGGGGGAGGGAGGTGTCCTGG - Intergenic
1034989448 7:155538790-155538812 GGGGTGGGCAGGAGGTGAATAGG - Intergenic
1035263105 7:157674168-157674190 GGGGAGGGAAGGAGGAGGCGGGG + Intronic
1035448739 7:158960564-158960586 AGTGTGGGAAGTAGGTGGCGAGG + Intergenic
1035522081 8:283225-283247 GGGGTTGCAGGGAGGTGTTGGGG - Intergenic
1036448720 8:8846265-8846287 GGGGGGGGAAGGAGGAGGAGGGG + Intronic
1036625630 8:10469362-10469384 AGGGAGGGAAGGAGGGGGCGAGG - Intergenic
1036625641 8:10469386-10469408 AGGGAGGGAAGGAGGGGGCGAGG - Intergenic
1036625652 8:10469410-10469432 AGGGAGGGAAGGAGGGGGCGAGG - Intergenic
1036784647 8:11677792-11677814 GAGATGGGAAGGAGGCGTGGGGG + Intronic
1037316456 8:17604001-17604023 GGAGTGGGAAGGAGGTTAGGAGG + Intronic
1037804244 8:22050314-22050336 AGGCTGGGAAGGAGGTGTGTTGG + Intronic
1037811712 8:22090307-22090329 GGGTTGGGGAGGAGGTGGTGGGG - Intronic
1037952818 8:23029769-23029791 GGGGTGGGGAGGAAGGGTCAAGG - Intronic
1038267170 8:26046188-26046210 GGGGAGGGACGGGGGAGTCGTGG + Intergenic
1038372352 8:27006833-27006855 GGGGTGGGGAGGAGGCCTGGAGG + Intergenic
1038425291 8:27460663-27460685 GGGGAGGGAAGGAGGGGTGAAGG + Exonic
1039781714 8:40792701-40792723 GGGGAGGGGAGGAGGTGGGGAGG + Intronic
1039794201 8:40898091-40898113 GGTGGGGGAAGGAGGTGGAGGGG + Intergenic
1040069086 8:43174895-43174917 GGGGAGGGAAGGAGGGGGCGTGG - Intronic
1040388819 8:46932764-46932786 CAGGTGGGAAGGAGGTGGCGAGG - Intergenic
1040696203 8:50001976-50001998 AGGCTGGGAAGGAGGTTTTGGGG + Intronic
1041007319 8:53508031-53508053 GGGGTGGGAAGTGGGTGGTGGGG - Intergenic
1041102650 8:54412224-54412246 GGGGTGGGGAGAAGGTGTGCAGG - Intergenic
1041166863 8:55100698-55100720 GGGGTGGGTGGGGGGTGTCATGG + Intergenic
1041857517 8:62475352-62475374 GGGCTGGGATGGAAGTGTCGTGG - Intronic
1042137379 8:65645071-65645093 GGAGGGGGCAGGAGGTGTAGGGG - Intronic
1042484634 8:69336771-69336793 AGGGTGGGCTGGAGGTGTCCAGG + Intergenic
1042719282 8:71809501-71809523 GGGGTGGGAATGAGGGTTTGAGG - Intergenic
1044171375 8:89056546-89056568 AGGCTGGGAAGGATGTGTCAAGG - Intergenic
1045277751 8:100722371-100722393 GGGGTGGGGAGGACGGCTCGCGG + Exonic
1045799912 8:106090268-106090290 GGAGAGGGAAGGAGGGGTCAAGG - Intergenic
1046141032 8:110092473-110092495 AGGGTGAGATGGAGGTGTCAGGG + Intergenic
1047061802 8:121235644-121235666 GGGGAGGGAAGGAGGAGGGGAGG - Intergenic
1047061809 8:121235660-121235682 GGGGAGGGAAGGAGGAGGGGAGG - Intergenic
1047177238 8:122553457-122553479 GGTGGGGGAAGGAGGGGTTGAGG + Intergenic
1047692472 8:127370421-127370443 AGGGTGGGAAACAGGTGTCAGGG + Intergenic
1048013474 8:130477389-130477411 AGGGAGGGAAGGAGGTGGGGAGG - Intergenic
1049038380 8:140094437-140094459 GTGGTGGGCAGGAGGTGTGAGGG - Intronic
1049351690 8:142168000-142168022 GGGATGGTGAGGAGGTGACGAGG - Intergenic
1049468725 8:142765471-142765493 GGGGTGGGGAGGAGGTGGAGGGG + Intronic
1049536141 8:143183357-143183379 GTGGTGGGGAGCAGGTGTTGGGG + Intergenic
1049609962 8:143550331-143550353 GGGGTGGGGTGGAGGGGTGGTGG - Intergenic
1051726181 9:20089684-20089706 GTGGTGGGCAGGGGGTGGCGGGG - Intergenic
1053378325 9:37627261-37627283 GGGGAGGCAAAGAGGTGTCTTGG - Intronic
1053433537 9:38059723-38059745 GGGGTGGTGTGGAGGTGGCGTGG - Intronic
1053917678 9:42955381-42955403 GGACTGGGAAGGAGGGGTCTGGG - Intergenic
1054451138 9:65404193-65404215 TGTGGGGGAAGGAGGGGTCGGGG - Intergenic
1054687902 9:68300565-68300587 GCGCTGGGGAGGAGGTGTCTGGG + Intergenic
1055292280 9:74794865-74794887 GGGGTGGTCAGGGGGTGTGGGGG - Intronic
1057258529 9:93569841-93569863 GGGGTAGGAGGAAGGTGTCAGGG + Intergenic
1057822330 9:98342250-98342272 GGGGTGGAAAGGGGGTGTTCTGG + Intronic
1058781394 9:108339529-108339551 GGGGTGGGAGGGAGGGGGTGGGG + Intergenic
1058782378 9:108351293-108351315 GGGGTCAGAAGGTGGTGTTGTGG - Intergenic
1059883875 9:118722752-118722774 GGGGTAGGAGGCAGGTGTGGTGG - Intergenic
1059999693 9:119946992-119947014 GGGGTGGGGAGGGGGTGGGGAGG + Intergenic
1060184962 9:121558643-121558665 GGGGTGGCAGGGAGGTGTGGAGG - Intergenic
1060206251 9:121684510-121684532 TGAGCGGGAAGGAGCTGTCGTGG - Intronic
1060392841 9:123292505-123292527 GGGGTGGCAAGGAGAGGTGGAGG + Intergenic
1060513510 9:124251142-124251164 GGGCTGGGGAGGAGGTGGAGAGG - Intergenic
1060513865 9:124253659-124253681 GGGCTGGGGAGGAGGTGGAGAGG + Intergenic
1060863400 9:126974949-126974971 GGGGTGGGAAGTATGGGTAGGGG - Intronic
1060947546 9:127579083-127579105 GAGGTGGGAGGGAGGTGGTGGGG - Intergenic
1061192158 9:129088176-129088198 GGGGTGGGAGGGTGTTGTGGGGG + Intronic
1061289882 9:129644655-129644677 GGAGTAGGAAGGAGGGGTGGGGG + Intergenic
1061709624 9:132478646-132478668 GGCGTGGGCTGGAGGTGACGAGG + Intronic
1061726416 9:132584475-132584497 GGGGTGGGGTGGGGGTGTTGGGG - Intronic
1062070103 9:134550792-134550814 GGGGGCCGAAGGAGGTGTCCGGG - Intergenic
1062127374 9:134870807-134870829 GGGGTGGGAGGGAGGTGGGAGGG + Intergenic
1062149071 9:135008100-135008122 GGGCTGGGAGGGAGGTGCCTTGG - Intergenic
1062166570 9:135110752-135110774 GTGGTGGGAAAGAGGTGGGGGGG - Intronic
1062414631 9:136442052-136442074 AGGGTGGCCAGGAGGTGCCGTGG + Intronic
1062540683 9:137040436-137040458 GCTGTGGGAAGGAGGAGGCGAGG + Exonic
1062599127 9:137312212-137312234 GGGGTGGGGTGGAGGTGCCCAGG - Intronic
1062615422 9:137393942-137393964 AGGGTGAGAAGGGGGTGCCGGGG - Intronic
1062640568 9:137516052-137516074 GGGGTGGGGAGGAGGGATTGGGG - Intronic
1185927985 X:4168609-4168631 GGGTTGGGAAGGAGGAGTGAGGG - Intergenic
1186047496 X:5552276-5552298 GGCGTGAGAAGGTGGAGTCGGGG - Intergenic
1186136071 X:6522479-6522501 GGGGTGGGAGGAAGGTGAGGTGG + Intergenic
1186306177 X:8261026-8261048 GAAGTGGGAAGGATGTGGCGGGG + Intergenic
1186506641 X:10098868-10098890 GGGAAGGGAAGGAGGGGTAGAGG - Intronic
1187484929 X:19694451-19694473 GGGGGGGAAACGAGGTGTCTTGG - Intronic
1187518019 X:19990536-19990558 GGGCCGGGAAGGCGGTGTCCGGG - Intergenic
1188584275 X:31753156-31753178 GGGGTGTGAGGGAGGTGGCGAGG + Intronic
1188811276 X:34656765-34656787 GGGGCGGGAGGCAGGGGTCGCGG + Intronic
1189002113 X:36958156-36958178 GGGGCGGGAGGCAGGGGTCGCGG - Intergenic
1189067239 X:37823411-37823433 GGGATGGGAAGAAGGGGTAGGGG + Intronic
1189318706 X:40074303-40074325 TGGGTGGGAAGGTGGACTCGGGG + Exonic
1189493858 X:41492080-41492102 GGGCTGGGCAGGAGGGGTTGGGG + Intergenic
1190212886 X:48461564-48461586 GGGGTGGCCAGGAGGTCTTGGGG - Intronic
1190914651 X:54802152-54802174 GGGGTGGGAGGGAGATGGGGAGG + Intergenic
1191101047 X:56729174-56729196 GGGGTAGGGAGGAGGGGTGGAGG + Intergenic
1192370627 X:70509859-70509881 TGGGTGGGAGGGTGGTGTGGGGG + Intergenic
1195130456 X:101845729-101845751 GGGGTGGGAACCAGGTTTCTTGG + Intronic
1195174902 X:102305833-102305855 GGGGTGGGTGGGGGGTGCCGGGG + Intergenic
1195175806 X:102314512-102314534 GGGGTGGGAACCAGGTGTCTTGG - Intronic
1195183058 X:102372581-102372603 GGGGTGGGAACCAGGTGTCTTGG + Intronic
1195183963 X:102381260-102381282 GGGGTGGGTGGGGGGTGCCGGGG - Intronic
1195338326 X:103878885-103878907 GGGGCTGGAAGGAGGTCCCGAGG - Intergenic
1195491218 X:105472061-105472083 GGGGTGGGATGGAGGGGTGGTGG + Intronic
1196147933 X:112340587-112340609 GGGGTGGGGAGGCGGGGTGGCGG + Intergenic
1196197216 X:112848842-112848864 GGGGTAGGAAAGGGGTGCCGGGG - Intergenic
1196479504 X:116130375-116130397 AGGTTGGGAAGGGGGTGTAGTGG - Intergenic
1196866716 X:120077337-120077359 GGTGTTGGAAGGAGGTGGTGAGG + Intronic
1196876383 X:120158944-120158966 GGTGTTGGAAGGAGGTGGTGAGG - Intronic
1197170346 X:123426932-123426954 GGGGGTGGAAGGGGGTGTGGAGG + Intronic
1197749790 X:129956811-129956833 GGGGTGGGGGGGAGGTGGGGAGG - Intergenic
1198243557 X:134807740-134807762 GCGGTGGGGAGGAGGTGTTCGGG + Intronic
1198368977 X:135973366-135973388 AAGGTTGGAAGGAGGTGTCTGGG - Intronic
1198867242 X:141137303-141137325 GGGGTGAGAATGAGGTGGCAAGG + Intergenic
1199207829 X:145169589-145169611 AGGGAGGGAAAGAGGTGTCTTGG - Intergenic
1199570137 X:149259129-149259151 GGGGTGGGGAAGAGGTTTCCAGG - Intergenic
1199610255 X:149606677-149606699 GAGATGGGAAGGAGGAGTTGAGG - Intronic
1200062238 X:153488797-153488819 GAAGTGGGCAGGAGATGTCGGGG - Intronic
1200088942 X:153625520-153625542 GGGCTGGGGAGGAAGAGTCGGGG + Intergenic
1200108357 X:153726482-153726504 GGGGCGGGCAGGAGCTCTCGAGG - Intronic
1200129978 X:153836456-153836478 GGAGTGGGGAGGTGGTGTTGGGG - Intergenic
1200774786 Y:7160525-7160547 TGGGGGGGAGGGAGGTGGCGGGG + Intergenic
1201549999 Y:15209437-15209459 GGGGAGGGAAGGAGGGGAGGAGG + Intergenic
1201712463 Y:17007746-17007768 GTGGTGGGATGGAGGTGGGGGGG - Intergenic