ID: 1092286580

View in Genome Browser
Species Human (GRCh38)
Location 12:7132145-7132167
Sequence CTGAATTGGCTGGTGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092286580 Original CRISPR CTGAATTGGCTGGTGGTTGA AGG Intronic
900146478 1:1161006-1161028 CGGGATTGGCTGGTGGTGGGTGG - Intergenic
902101713 1:13996120-13996142 CTCCCTTGGCTGGGGGTTGAGGG - Intergenic
903696345 1:25210281-25210303 CAGAATTGATTGGTGGTTGGTGG - Intergenic
903739691 1:25551683-25551705 TGGAATAGGCTTGTGGTTGATGG + Intronic
905338106 1:37259338-37259360 CTGAATTGTGTGATGGTTGCAGG + Intergenic
906098095 1:43237768-43237790 CTGAAATGGTTGGTGGCTGAGGG + Intronic
906548017 1:46636028-46636050 CTGAATTGTGTGGTGGGTGGGGG + Intronic
909268698 1:73595600-73595622 CTGAATTGGAGGGTGGATGGAGG + Intergenic
910429353 1:87146045-87146067 ATGAATTGGCTTGTGCTTGTAGG + Intronic
910914087 1:92270756-92270778 CTAAATTGGGTGGTGAGTGAAGG + Intronic
911164382 1:94712053-94712075 CTGTATTGGTTGGTGGTCCAGGG - Intergenic
914921006 1:151847452-151847474 CTGAGATGGCTGGAGCTTGATGG + Intronic
914981469 1:152418419-152418441 CCTGATTGGCTGGTGGATGAAGG + Intergenic
917566426 1:176216921-176216943 CTGGATTGGCTGGAGGCTAATGG + Intergenic
920347048 1:205313262-205313284 CTGAATAGACTGGTGTTTGGGGG - Intronic
920569125 1:207002982-207003004 CAGAATGGGGTGGTGGTTGAAGG + Intergenic
921742618 1:218703686-218703708 CTGGAGTGGATGGTGCTTGATGG - Intergenic
923537616 1:234865076-234865098 CTGAATTGTTTGGTGACTGAGGG - Intergenic
923811080 1:237316889-237316911 GTGAATTGGTTTGTGGTTGTTGG - Intronic
1062988068 10:1788592-1788614 CTGAATTGGCTGCTCTTTGGAGG + Intergenic
1070716485 10:78725937-78725959 CTGAAATGGCTGGAAGTTGCAGG + Intergenic
1071198912 10:83194846-83194868 CTTGATTGGCAGTTGGTTGAAGG - Intergenic
1071717134 10:88108304-88108326 CTGAATTAGCTGTTGGGGGAGGG + Intergenic
1071792290 10:88967596-88967618 CTGATTTGGTTAGTGTTTGAAGG - Intronic
1072466204 10:95664744-95664766 ATGAATTGGTGGGTGGTGGAAGG - Intronic
1072581102 10:96740796-96740818 TCGGATTGGCTGATGGTTGAGGG - Intergenic
1073289209 10:102405127-102405149 CTGAGTTGGCTGGTGGGTGTGGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075581484 10:123621891-123621913 AGGAAGTGGATGGTGGTTGAGGG + Intergenic
1078435279 11:11320035-11320057 TGAAATTGGCTGGTGGTTGGTGG - Intronic
1078706012 11:13745047-13745069 CTGAAATGGCTGGAAATTGAGGG - Intergenic
1079313165 11:19384518-19384540 CTTAATTGGGTGCTGGTTGTTGG + Intronic
1079640996 11:22805527-22805549 CAGAAGTGGTTGGTGGGTGAGGG - Intronic
1080549524 11:33360287-33360309 CTTAATTGGCTGGTGGAGTAGGG - Intergenic
1081551856 11:44121013-44121035 CTGACCTGGCAGATGGTTGAAGG - Intronic
1081907968 11:46681169-46681191 CTGAACTGGGTGGGTGTTGAGGG - Intronic
1083782148 11:64924272-64924294 CTGAAGTGTCTGGTGGTTCTGGG + Intronic
1087042377 11:93814366-93814388 CTGAATTTCCTGGAGTTTGAAGG + Exonic
1090848064 11:130546845-130546867 CTGAACGTGCTGGTGGTTGTGGG - Intergenic
1091936539 12:4439350-4439372 CTGATCTGGATGGTGGTTAAGGG + Intronic
1092286580 12:7132145-7132167 CTGAATTGGCTGGTGGTTGAAGG + Intronic
1093164748 12:15791519-15791541 ATGAATTGGCTGATGGCTGGGGG + Intronic
1094232300 12:28120456-28120478 CTGAATTGGGTGGTTTTTAAAGG + Intergenic
1096675611 12:53224201-53224223 CAGAACTGTCTGGTGGTGGAGGG - Intronic
1098179754 12:67833226-67833248 CTGCATTGTCTGGTGGTGGGAGG - Intergenic
1098871034 12:75817286-75817308 CTGAATTGGATGCTGGTTCAGGG + Intergenic
1099719524 12:86342515-86342537 TTGAATTGGCTGAAGCTTGATGG - Intronic
1104378993 12:128290652-128290674 CTGACTTGTATGTTGGTTGATGG - Intronic
1107403002 13:40087291-40087313 CCGAAATGGCAGGTGGTTGGCGG + Intergenic
1113087746 13:106585679-106585701 CTGAAGTGGCTGGGGGATTAGGG - Intergenic
1113813993 13:113159185-113159207 GTGAAGTGGCTGGTGGTAGAAGG - Exonic
1116570098 14:46505507-46505529 CTGACTTGTCTGGCAGTTGATGG - Intergenic
1122080864 14:99266781-99266803 TTGAATTGGCTTTTGGTTGATGG - Intronic
1125192604 15:37010754-37010776 CTTAATTGAATGGGGGTTGAGGG + Intronic
1126536493 15:49771317-49771339 CTGAATTCTCTGGGGGATGATGG + Intergenic
1130030780 15:80311432-80311454 CTGAAGTGGCTGGTGGGAAAGGG + Intergenic
1131026827 15:89149895-89149917 CTCCATTGGCGGGTGGATGATGG + Intronic
1131286397 15:91062317-91062339 CTGAGGTGGCTGCTGGGTGAGGG - Intergenic
1131991743 15:98099573-98099595 GTGAATTTGCTGGTTGTTCAAGG - Intergenic
1132227626 15:100154769-100154791 GTGAATTTGCTGGGGGATGAGGG - Intronic
1133414426 16:5595278-5595300 CTGTATTGGATGATGTTTGATGG + Intergenic
1138571777 16:57878889-57878911 CTGAAATGACCAGTGGTTGAAGG - Intergenic
1143674514 17:8422104-8422126 CTGCAATGGCTGGGGGTGGAGGG + Intronic
1147608483 17:41787164-41787186 CTGAGTTGGCTGGCCGGTGAAGG - Intergenic
1148240331 17:45996145-45996167 GGGTATTGGATGGTGGTTGATGG + Intronic
1151758702 17:76088895-76088917 CTGGATGGGCTGATGCTTGAAGG - Exonic
1151996660 17:77613750-77613772 CTGCATTGCCTGGTGCGTGAGGG - Intergenic
1152193682 17:78903653-78903675 CTGTGTGGGCAGGTGGTTGACGG - Intronic
1156733220 18:40221645-40221667 CTGATTTGAGTGGTGGCTGAAGG + Intergenic
1157873582 18:51251751-51251773 CAGAACTGGCTGTTGGTTCAGGG - Intergenic
1159029770 18:63218874-63218896 CAGAATTGGCAGTTGATTGAAGG - Intronic
1166467129 19:43042460-43042482 CCGAATTAGCTGGGGTTTGATGG - Intronic
1167135971 19:47615728-47615750 CTTAATTGGCAGGTGTTGGATGG + Intronic
1168269735 19:55242970-55242992 CAGAATAGTCTGGTGGTTGCCGG + Intronic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926089969 2:10043436-10043458 ACGAATTGGCTGGTGGTGGCCGG + Intronic
930843528 2:55875617-55875639 ATGAATTGGCTTGTGGTTGACGG + Intronic
932916312 2:75862367-75862389 CTGGATTGGCTGAGAGTTGAAGG + Intergenic
934038759 2:88110433-88110455 CTGCATGGGCTGGTTGTTCAGGG - Exonic
942680532 2:178474021-178474043 CTGGATTGGCGGGTGGTGGGGGG - Intronic
944187507 2:196965803-196965825 CTGAATTGGCTGCTTTTTCACGG - Intergenic
947344986 2:229181131-229181153 CAGAATTAGCTGGAGGGTGAAGG - Intronic
1169581362 20:7026813-7026835 CTGAATAGGCTGTTGTTTAAAGG + Intergenic
1170610363 20:17907784-17907806 ATGAAAGGGCTGGAGGTTGAAGG - Intergenic
1171127885 20:22620507-22620529 CTGGGCTGGCTGGTGTTTGACGG - Intergenic
1171227147 20:23451344-23451366 ATGATTTGACTGGTGGGTGAGGG - Intronic
1171503171 20:25610509-25610531 CTGGATGGGCTGTTAGTTGAGGG - Intergenic
1179449829 21:41460838-41460860 CTGATTTGGGTGGTGGTGGAAGG - Intergenic
1179619797 21:42606369-42606391 GTGTGATGGCTGGTGGTTGATGG - Intergenic
1180957259 22:19746590-19746612 CTGCATGGGGTGGTGGTCGAGGG - Intergenic
1181537059 22:23551853-23551875 ATGAATGGGAGGGTGGTTGAAGG - Intergenic
1184243619 22:43224452-43224474 CTGACTTGTCTTGTGTTTGATGG + Intronic
1184860268 22:47169500-47169522 CTGCATGGCCTGGAGGTTGACGG - Intronic
952007744 3:28861465-28861487 TTTAATTGGCTTGTGGTTCAAGG + Intergenic
953141617 3:40234436-40234458 CTGAAGTGCCTGCTGGTTGTAGG - Intronic
953302102 3:41787515-41787537 CTGAATTGGCAGGGGGAAGAAGG - Intronic
957392683 3:79598332-79598354 CTGAATTTGGTGTAGGTTGAAGG - Intronic
959672341 3:108993278-108993300 ATTAATTGGCTCGTGGTTGCTGG + Intronic
961239685 3:125399890-125399912 CTGATTTTGTGGGTGGTTGATGG - Intergenic
963859794 3:150297374-150297396 TTGAGTTGGCTGGAGGTGGAAGG + Intergenic
964386163 3:156150171-156150193 CTGAATAGGCTGCTGGTGAAGGG + Intronic
967142879 3:186576892-186576914 CTGAGTTGGTTGGTGGGAGAGGG + Intronic
967812895 3:193775380-193775402 CAGAACTGGGTGGTGGCTGAAGG + Intergenic
969502717 4:7563128-7563150 CTGCATTGGCTGGGGGTGAAGGG + Intronic
972006295 4:34111868-34111890 CTGATGTGGCTAGTGTTTGAAGG - Intergenic
972430552 4:38977310-38977332 CTGGTTTGGCTGGTGTTTGCTGG + Intronic
975082298 4:70295941-70295963 CTGAAATGCATGGAGGTTGATGG + Intergenic
980070684 4:128240550-128240572 CTGACTTGGCTGGAGGATGAAGG - Intergenic
980961887 4:139483613-139483635 CTGAATTGGCTGCTGCATGTGGG + Intergenic
981422329 4:144565468-144565490 CTGAACAGGCTAGTGGCTGAAGG - Intergenic
983859356 4:172686179-172686201 CTGCAGAGGCTGGTGGTTGGTGG - Intronic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
987998203 5:25313206-25313228 CTTCATTGGCTGTTGATTGAAGG - Intergenic
988800445 5:34691599-34691621 GTGAAATGGGTGGAGGTTGAGGG + Intronic
990794825 5:59528001-59528023 TTTAACTGGATGGTGGTTGATGG - Intronic
991228752 5:64304921-64304943 CTGATTAGGGTGGTGGTTGCTGG - Intronic
995570814 5:113479375-113479397 CTGATTTTGGTGGTGGTTAAAGG + Intronic
996748904 5:126869483-126869505 CAGAATTGGCTCATGGTTGGGGG + Exonic
997382383 5:133446886-133446908 ATGACTGGGCTGGTGGCTGAGGG + Intronic
998395222 5:141813996-141814018 TTGAATTGGCTGGTGGTCTCTGG + Intergenic
1000980696 5:167813630-167813652 CTGACTGGGCCAGTGGTTGAAGG - Intronic
1002329678 5:178432910-178432932 CAGAATTGGTTGGTGGGTGAAGG - Intronic
1003651424 6:7964200-7964222 CTGAATTGCCTGGTGGTAGATGG - Intronic
1004020480 6:11771658-11771680 ATGAATTTGGTGGTGGTTGGTGG - Intronic
1004199778 6:13536859-13536881 CTGAATTGACAGGAGGCTGATGG - Intergenic
1004989440 6:21120321-21120343 CTGAATTTGCTGTGGGATGATGG - Intronic
1006085284 6:31590667-31590689 CTGAACTGGCTGGAGAATGATGG - Intronic
1007946214 6:45829441-45829463 CTCACATGGCTGGTGGTTGATGG + Intergenic
1008460293 6:51761422-51761444 CTGGTTTGGCTGGTGGTGGGGGG + Intronic
1011508004 6:88068592-88068614 CTGAATTGACCCGTGGTGGAAGG - Intergenic
1014072315 6:117197029-117197051 CTAAATTGGCTGGAAGCTGATGG + Intergenic
1016605245 6:145914157-145914179 CTGAGTTGGCTGGGGTTGGATGG + Intronic
1017437397 6:154429311-154429333 CTGAAGGCGCTGGTGTTTGATGG - Intronic
1020205201 7:6109163-6109185 GTGAACTGGCTGGAGGTGGAAGG + Intronic
1022199969 7:28107157-28107179 GTGGATTGGTTGGTGTTTGAGGG - Intronic
1022212496 7:28225250-28225272 CTGAATTGGAGGAAGGTTGAGGG + Intergenic
1025058564 7:55784966-55784988 CTGAACAGGGAGGTGGTTGAGGG - Intergenic
1025827813 7:65024835-65024857 CTGAACAGGGAGGTGGTTGAGGG + Intergenic
1028315101 7:89391813-89391835 CTGAATTAGTTGGTGTTAGATGG - Intergenic
1028903556 7:96127946-96127968 CTGAATGGGCTGTTGGGTGGAGG - Intronic
1029263558 7:99321028-99321050 ATGAAATGACTGGTGGATGAGGG + Intergenic
1030583854 7:111392560-111392582 CAGAATTGGTTGGTGTTAGAAGG - Intronic
1030955368 7:115845230-115845252 CTGTCTTGGCTGGTTGTTCAGGG - Intergenic
1031990647 7:128196740-128196762 CTGAAATGGCTGGAATTTGAGGG - Intergenic
1032691326 7:134290190-134290212 CTGGATTGCCTGGTGGTAGAAGG - Exonic
1035109202 7:156466376-156466398 TTTAAGTGGCTGGTGGGTGAGGG - Intergenic
1036777449 8:11623405-11623427 ATTACTTGGCTGGTGGTTTAGGG + Intergenic
1037724025 8:21468281-21468303 AAGATTTGGCTGGTGGTAGAGGG - Intergenic
1039588206 8:38724846-38724868 CTGGATTGGTTTGTGGATGAGGG - Intergenic
1039670478 8:39591192-39591214 CTGATCAGGGTGGTGGTTGAAGG + Intronic
1040985856 8:53293868-53293890 GTGAATTGGCTAGAGGTTGGTGG + Intergenic
1044752082 8:95426100-95426122 CTGAATTGGCTGGAGGAAGCAGG + Intergenic
1044886571 8:96784730-96784752 CTGAATTTGATGGTGGATGTTGG + Intronic
1047370243 8:124250217-124250239 ATGAATTAGATGGTGGATGAAGG - Intergenic
1047995413 8:130330458-130330480 GTGAATGGGGTGGTGGTTGTGGG - Intronic
1051336944 9:16074216-16074238 CTTAATTGGATGGTAGTAGATGG - Intergenic
1051853268 9:21533731-21533753 GTGAATTGGCAGGGTGTTGACGG + Intergenic
1056578768 9:87875066-87875088 ATGAGTTGACTGGTGGCTGAAGG - Intergenic
1058638673 9:107061550-107061572 CTGATTAGGGTGCTGGTTGATGG + Intergenic
1061244723 9:129395578-129395600 ATGAATGGGAGGGTGGTTGAAGG + Intergenic
1191935730 X:66425340-66425362 CTGAATTTGCTGATTTTTGAAGG - Intergenic
1193529986 X:82644404-82644426 CTGAATTGACATGTGTTTGAAGG - Intergenic
1197570608 X:128146698-128146720 CTCAAGTGTCTGGTGATTGAGGG - Intergenic
1198690250 X:139275036-139275058 CTGAGTTGGGTGGTTGCTGAAGG + Intergenic