ID: 1092287101

View in Genome Browser
Species Human (GRCh38)
Location 12:7134934-7134956
Sequence CAGCTTGGTGCCCTGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 277}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092287092_1092287101 14 Left 1092287092 12:7134897-7134919 CCTCTGGTGTTGTCCTCTCCCTG 0: 1
1: 0
2: 2
3: 26
4: 311
Right 1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 34
4: 277
1092287094_1092287101 1 Left 1092287094 12:7134910-7134932 CCTCTCCCTGGCATGACTTTGAT 0: 1
1: 0
2: 4
3: 16
4: 198
Right 1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 34
4: 277
1092287096_1092287101 -5 Left 1092287096 12:7134916-7134938 CCTGGCATGACTTTGATGCAGCT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 34
4: 277
1092287091_1092287101 15 Left 1092287091 12:7134896-7134918 CCCTCTGGTGTTGTCCTCTCCCT 0: 1
1: 0
2: 0
3: 24
4: 302
Right 1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 34
4: 277
1092287095_1092287101 -4 Left 1092287095 12:7134915-7134937 CCCTGGCATGACTTTGATGCAGC 0: 1
1: 0
2: 2
3: 8
4: 98
Right 1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 34
4: 277
1092287089_1092287101 19 Left 1092287089 12:7134892-7134914 CCCTCCCTCTGGTGTTGTCCTCT 0: 1
1: 0
2: 4
3: 63
4: 591
Right 1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 34
4: 277
1092287090_1092287101 18 Left 1092287090 12:7134893-7134915 CCTCCCTCTGGTGTTGTCCTCTC 0: 1
1: 0
2: 2
3: 27
4: 226
Right 1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 34
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092287101 Original CRISPR CAGCTTGGTGCCCTGTGGGG TGG Intronic
900373042 1:2340725-2340747 CAGTCTGGTGTCCTGTGTGGTGG - Intronic
900373052 1:2340769-2340791 CTGCGTGGTGGCCTGTGTGGCGG - Intronic
900422271 1:2560737-2560759 CAGCTCTGTGCCCTGGGGAGGGG + Intronic
900538507 1:3190962-3190984 CAGCTTGGGGCCTGCTGGGGCGG + Intronic
900910369 1:5593225-5593247 CATCTTGGTGTCCTTTGGGGAGG - Intergenic
901168777 1:7238970-7238992 CAGCTTGCAGTCCAGTGGGGAGG + Intronic
901196738 1:7444497-7444519 CAGCCTGGTGCCCAGGGAGGAGG - Intronic
901236688 1:7671047-7671069 CACCTTGGGGGCCTGGGGGGCGG - Intronic
902607082 1:17574778-17574800 CATCTTGCTGCCCTGCGTGGGGG + Intronic
903650429 1:24918493-24918515 CAGCTTGGTGCACTGAAGGTTGG - Intronic
904367454 1:30023700-30023722 CAGCCTGGCACCCTGAGGGGTGG + Intergenic
904424718 1:30415925-30415947 CACCTTCCTGCCCTGTGGGGTGG + Intergenic
904756688 1:32771954-32771976 CAGCATGGAGCCCTGAGGAGGGG - Exonic
906033964 1:42739659-42739681 CAGCCTGCTGCCCTGTGGGAGGG - Intronic
906159854 1:43640036-43640058 CAGCCTGGTTCCCTGGGGAGGGG - Intergenic
906215074 1:44033891-44033913 CAGCCTGGGCCACTGTGGGGCGG + Intergenic
910666238 1:89728423-89728445 CTGCTTGGAGCCCTGTGGGCTGG + Intronic
910763831 1:90761266-90761288 CAGCTTGGTGCGCTGTGTCCTGG + Intergenic
913688755 1:121258318-121258340 CAGCTTGCTTCCCTGTGGGAAGG - Intronic
914148845 1:145021958-145021980 CAGCTTGCTTCCCTGTGGGAAGG + Intronic
914319830 1:146548481-146548503 CAGCGTGGTGCGCTGTGAGAGGG + Intergenic
915278126 1:154803746-154803768 CAGCTTGCTGGCCGGTGTGGCGG - Intronic
915507764 1:156368285-156368307 CAGCCTGCTTCCCTGTGGTGTGG + Intergenic
917038497 1:170776179-170776201 CAGCGTGGTGCCCTGTGCATAGG - Intergenic
918058041 1:181039412-181039434 CTGCTTGTTGCCGTGTGTGGTGG + Intronic
918148966 1:181781837-181781859 CAGAGTGGTGGCCTGTGGGATGG + Intronic
919925386 1:202189316-202189338 GAGGTTTGTGCCCTGTGGGATGG + Intergenic
920476079 1:206276818-206276840 CAGCTTGCTTCCCTGTGGGAAGG - Intronic
922567140 1:226608149-226608171 CAGCTTGGCCTCCTGTGGGAAGG + Exonic
922912820 1:229231944-229231966 AAGCTTGGCCCTCTGTGGGGCGG + Intergenic
923331839 1:232932564-232932586 CAGCTTGTTGTCCTGTGGAATGG - Intergenic
924878946 1:248136991-248137013 CACCTTGGTGCCGTGCTGGGTGG - Intergenic
1064839665 10:19576820-19576842 GAGCGTGGTTTCCTGTGGGGAGG - Intronic
1065190463 10:23203660-23203682 CGGCTAGGTGCCCTGTGCCGGGG + Intergenic
1067030331 10:42875368-42875390 GATCTGGGTACCCTGTGGGGTGG - Intergenic
1069638139 10:69937946-69937968 CAGCTCAGTGCCCCTTGGGGTGG - Intronic
1069724159 10:70566754-70566776 CTGCGTGGGGCCCTGTGGGTGGG - Exonic
1069827073 10:71260882-71260904 CAGCTGGGAGCCCTGCGGAGAGG + Intronic
1070961915 10:80505370-80505392 CTGCTTGTTGCCCTGTGGCAGGG + Intronic
1072538625 10:96381670-96381692 CAGCCTGGAGCACTGTGGGGTGG - Intronic
1075008192 10:118845523-118845545 CTGCTTGGTCCCCTGTGCAGTGG - Intergenic
1076065598 10:127445287-127445309 GAGCTCTGTGCCCTGTGGCGAGG + Intronic
1077010764 11:378311-378333 CAGCCTGGAGCCCTGGGCGGTGG + Intronic
1077409979 11:2399418-2399440 CCGCTGTGTTCCCTGTGGGGAGG + Intergenic
1077436288 11:2540733-2540755 CAGCTTTGTGCCCTCTAGGGTGG + Intronic
1077446034 11:2591332-2591354 GAGCCTGGTGCCCAGTGGAGCGG - Intronic
1083748910 11:64750572-64750594 CAGCTGGGATCACTGTGGGGTGG + Exonic
1083827238 11:65210696-65210718 CAGCTTGCGGTACTGTGGGGAGG + Intronic
1083868423 11:65471518-65471540 CAAGCTGGGGCCCTGTGGGGAGG - Intergenic
1083899234 11:65635730-65635752 CAGCTACGGGCACTGTGGGGTGG + Exonic
1083952770 11:65965994-65966016 GAGCTGGGTGCCCTGGGTGGGGG + Intronic
1084328628 11:68416525-68416547 CAGGCAGGTGCCCTGTGGGAAGG + Exonic
1085460263 11:76689234-76689256 GAGCCTGGTGCCCAGTGGGGTGG + Intergenic
1090230100 11:125096255-125096277 GAGCTTAGTTGCCTGTGGGGTGG + Intergenic
1090419904 11:126567574-126567596 CAGCTTTGTGCTCTGGGGGCTGG - Intronic
1092257328 12:6934487-6934509 CTGCTTGTTGACCTTTGGGGTGG - Exonic
1092260709 12:6951965-6951987 CCGCCTGGTGCCCTGCAGGGTGG + Exonic
1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG + Intronic
1093118719 12:15242578-15242600 GGGATTGGTGCCCTGTGGGTAGG - Intronic
1093339109 12:17949734-17949756 CAGCTTGGTCCCATGGGGTGGGG - Intergenic
1096080136 12:48827638-48827660 CAGCTTGATGCCCTCTGATGAGG + Exonic
1096084821 12:48858321-48858343 CAGCTGGGTCCCCTCTGGAGTGG - Intronic
1096189822 12:49609193-49609215 CAGCTTGGTGACCTGTGGACTGG + Intronic
1096312492 12:50533728-50533750 CAGCATGGTGCCCACTTGGGAGG - Intronic
1096487648 12:51994506-51994528 CACCTTGGTGTGCTGTGGGCTGG - Intronic
1097250681 12:57630971-57630993 CATCTTGGTGCCAGGTAGGGAGG - Exonic
1099913264 12:88859827-88859849 CAGCTTGGGGCCAGGTGCGGTGG - Intergenic
1102259603 12:111436180-111436202 CAGAATGGTGCCCTGTGCGGAGG + Intronic
1102992381 12:117324377-117324399 CAGCTTGCTGCCCTGAAGGAGGG - Intronic
1103016183 12:117496237-117496259 CAACTTGGCTGCCTGTGGGGTGG - Intronic
1103046343 12:117738024-117738046 GTGCTTGGAGCCCTGTGGAGGGG - Intronic
1103213934 12:119187303-119187325 CTGCTCGGTGCCCTGTGAGGTGG + Intronic
1104642962 12:130479134-130479156 GAGGTGGGTGCCCTGTGGGGCGG - Intronic
1104912249 12:132244925-132244947 CACCTTGGTGTCCTGTCTGGCGG - Intronic
1104968994 12:132522745-132522767 CAGCAGGGTGCCCTGTGAGGAGG + Intronic
1107243522 13:38265407-38265429 CAGGTTGGTGCCCTTCTGGGAGG + Intergenic
1110627597 13:77668736-77668758 CTGGTTGGTCTCCTGTGGGGAGG - Intergenic
1112658138 13:101474491-101474513 TAGCTTGCTGCCCTGAAGGGAGG + Intronic
1113594450 13:111521240-111521262 CCCCTGCGTGCCCTGTGGGGTGG + Intergenic
1113661246 13:112107701-112107723 CAGCTTGGAGTCCTGTGAGGAGG - Intergenic
1115694421 14:35881311-35881333 CAGCTTGGAGGCCTGGGTGGTGG - Intronic
1117441389 14:55762750-55762772 CAGCCTGGGGCCCCATGGGGAGG - Intergenic
1118810977 14:69273400-69273422 CAGCCTGGAGCACTGTGGTGAGG + Intronic
1119679775 14:76583945-76583967 GAGCTAGGTGTCCTGTTGGGAGG + Intergenic
1121595062 14:95156690-95156712 CAGATTGGGGCCCTGGGGGGCGG - Intronic
1121815204 14:96923791-96923813 CAGCCTGAGGCCCTGGGGGGAGG - Intronic
1121965197 14:98297077-98297099 CAGCGTGGTGCCGTGGTGGGGGG + Intergenic
1122534384 14:102451981-102452003 CAACTCGGTGCCCTGGAGGGAGG - Intronic
1123035673 14:105470949-105470971 CCGCTTGCTGCCCCCTGGGGAGG - Intergenic
1123070668 14:105641108-105641130 CACCTGGGTGGCCTGAGGGGTGG - Intergenic
1126800791 15:52295335-52295357 CGCCTGGGTGCCCTGTGGGTGGG - Intronic
1128617032 15:69118240-69118262 CAGCTTGATGGACTGTGAGGAGG + Intergenic
1128850934 15:70955029-70955051 CAGCTTGGGGTGCTGTGGGTAGG + Intronic
1129231022 15:74197294-74197316 CAGCTGGGTCCCCTGAGTGGGGG + Intronic
1129856830 15:78830787-78830809 CAGCTCGGAGGCCTTTGGGGTGG + Intronic
1130541405 15:84822969-84822991 CAGGCTGGTGTGCTGTGGGGTGG + Intronic
1131529431 15:93179330-93179352 CAGGTTCGGGCACTGTGGGGTGG + Intergenic
1132629194 16:908662-908684 CAGCCTGGTGACCTCTGGGCTGG - Intronic
1132752625 16:1465809-1465831 CAGCTGGGCGTCCTGTGGGGAGG - Intronic
1132983085 16:2749250-2749272 CTGCTTGCAGCCCTGTGGGAGGG + Intergenic
1136460653 16:30408034-30408056 CATCTTGGTGTCCTGAGGCGGGG - Exonic
1137479632 16:48841251-48841273 CAGCTTGTTGGCCTGTTAGGCGG - Intergenic
1137647491 16:50088683-50088705 CAGCAAGATGTCCTGTGGGGTGG + Intronic
1137702240 16:50505735-50505757 CAGCTGGCTGCCCTGTGGAAGGG + Intergenic
1138095545 16:54208494-54208516 CAGCTTCCTGCGGTGTGGGGAGG + Intergenic
1138134163 16:54507419-54507441 CAGCTTGGTAGCCTGGTGGGGGG + Intergenic
1138507331 16:57484956-57484978 CAGAATGGTGCCCGGTGGGAAGG + Intronic
1140038135 16:71386569-71386591 CAGTTTGGTGCACTGGGTGGAGG + Intronic
1140042083 16:71414775-71414797 GAGCTTGTTACACTGTGGGGTGG + Intergenic
1140760854 16:78107569-78107591 CAGCTAGATGCCCTATGGGAAGG + Intronic
1141434786 16:83993883-83993905 ATGTTTGGTGCCCTCTGGGGTGG - Intronic
1141436438 16:84002318-84002340 CTGCTTGGTGCACGGTGGGACGG + Exonic
1141510674 16:84509898-84509920 CAGCATGGTGTCCTCTGTGGAGG - Intronic
1141593304 16:85082714-85082736 CAGCCTGGTGGCCGGCGGGGAGG + Intronic
1141811231 16:86377800-86377822 CAGCTGGGGGCCCTCTGGGCGGG - Intergenic
1142892973 17:2957221-2957243 CAGAGTGGTGCCTTGTGGGCAGG + Intronic
1143290733 17:5825999-5826021 CTGCTTGGTGGCCTCTGGTGGGG + Intronic
1145956656 17:28859343-28859365 CAGCTTGGAGCCCTGAGAGCAGG + Intronic
1147318770 17:39633604-39633626 CAGCCTAGTGCCCTATGGTGTGG + Intronic
1148185123 17:45637444-45637466 CAGATGGGGACCCTGTGGGGAGG + Intergenic
1148332497 17:46820757-46820779 CACCTGGGAGCCCTGTGGGTGGG - Intronic
1149855405 17:60078638-60078660 CAGCTGGGTTCCCGGAGGGGTGG + Intronic
1151349810 17:73525109-73525131 CTCCTTGGTGCCCTGGGGAGGGG - Intronic
1151745156 17:76008002-76008024 CACCTCGGGGCCCTGTGGGGAGG - Exonic
1152037102 17:77880312-77880334 GAGCCTGGTGTCCTGTGTGGTGG + Intergenic
1152563786 17:81091204-81091226 CAGCTAGGAGGCCTGTGGGGTGG - Intronic
1153564975 18:6410174-6410196 AAGCTTGGTGCCCTGGAGGAAGG - Intronic
1154415787 18:14174568-14174590 CAGCTTGCTTCTCTGTGGGCTGG - Intergenic
1160969254 19:1760139-1760161 CAGCTTGCTGGTCTGTAGGGTGG - Intronic
1161043509 19:2122356-2122378 CAGCTGTGTGCCCTGTGGCTGGG - Intronic
1161326283 19:3665755-3665777 CAGCTTGTTGCCCTCGAGGGAGG + Intronic
1161473835 19:4473793-4473815 GGGATTGGTCCCCTGTGGGGAGG + Intronic
1161577972 19:5065217-5065239 CAGGCTGGGGCCCTGTGGGATGG + Intronic
1163011724 19:14430836-14430858 GAGCTTCGTGGGCTGTGGGGAGG + Intergenic
1164548790 19:29190676-29190698 CAGCGGGGTGCACTGTGTGGGGG + Intergenic
1164750927 19:30654198-30654220 CTGCGTGGGGCCCAGTGGGGAGG + Intronic
1165856251 19:38880725-38880747 GAGAGGGGTGCCCTGTGGGGAGG + Exonic
1166657645 19:44623836-44623858 CAGTGGGGTGCCCTGTGGGATGG + Exonic
1166955789 19:46464053-46464075 CAGCTGGGAGCCTAGTGGGGAGG - Intergenic
1167119144 19:47506473-47506495 GAGCTGGGGGACCTGTGGGGTGG - Intronic
926104808 2:10143437-10143459 CAGCTGAGTGCCCTGAGGGCAGG + Intronic
926600778 2:14843515-14843537 TAAATTGGTGCCTTGTGGGGAGG - Intergenic
928202948 2:29262734-29262756 CAGCTTGCTGCCCTGTTGATGGG - Intronic
928428833 2:31201385-31201407 CTGCTTGGGTCCCTGTGGGGCGG - Intronic
933901504 2:86853616-86853638 CAGCTTGGTGTCCTGGAGAGAGG + Intronic
933974849 2:87500976-87500998 CAGCAAGGAGCCCTGTGTGGGGG - Intergenic
934546836 2:95224746-95224768 CAGCTTGATCCCCAGTGAGGTGG + Intronic
934588608 2:95526988-95527010 CAGCTTGGGGCCCAGCGTGGTGG + Intergenic
934662489 2:96150495-96150517 GAGCTGGGTGCACTGTTGGGGGG + Intergenic
935305729 2:101734661-101734683 CCGCTTGGTGGCCAGTGGGCTGG + Intronic
935667642 2:105526168-105526190 CTGCTTCCTGCCATGTGGGGCGG - Intergenic
936318976 2:111449837-111449859 CAGCAAGGAGCCCTGTGTGGGGG + Intergenic
940615841 2:156047772-156047794 CAGCTGGGTGCCCCGGGGGAGGG + Intergenic
945694818 2:213089382-213089404 AAGCAAGGTGCCCTGTGAGGAGG - Intronic
946715273 2:222548041-222548063 CAGTTTGTTGCCCTGTAGGATGG - Intronic
948863875 2:240765764-240765786 GACCTTGGAGCCCTGTGAGGGGG - Exonic
1169340017 20:4789614-4789636 CAGCTTCAGGACCTGTGGGGTGG + Exonic
1169486926 20:6041799-6041821 GAGCTTGCTGGCCAGTGGGGTGG + Exonic
1169898981 20:10534124-10534146 CAACTTTGTGCCTTGTGGGTAGG + Intronic
1170893568 20:20395529-20395551 CAGCAAGGTGCCCTGCTGGGAGG + Intronic
1171276356 20:23859264-23859286 CAGCATGGCTCCCTGAGGGGAGG - Intergenic
1172661901 20:36573980-36574002 CCGCTTGGGGCCCTGGTGGGGGG + Intronic
1174452954 20:50630988-50631010 CAGCTTGCTGACCTGTGAGCTGG - Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1175981967 20:62743194-62743216 CAGCTGAGTGCCCCGTGGTGTGG + Intronic
1178738223 21:35171871-35171893 CAGCTTGGGCCCATGTGGGAGGG + Intronic
1178834846 21:36088104-36088126 ATGCCTGGTGCCCTGTGTGGGGG - Intergenic
1179469641 21:41602056-41602078 CAGTTTGGTGGCTTGTGGTGGGG + Intergenic
1179626446 21:42652282-42652304 CAGCCTGGAGGCCTTTGGGGTGG - Intergenic
1180972425 22:19822454-19822476 CAGCTGGCTGCTCTGTGGGGTGG + Intronic
1181310114 22:21939984-21940006 CAGCTGGGGACCCTGGGGGGTGG + Intronic
1181584414 22:23845216-23845238 GAGCTTGGGGTGCTGTGGGGTGG + Intergenic
1182129950 22:27843629-27843651 CAGCTTGGTGCCCAGGAGGGAGG + Intergenic
1182476101 22:30577118-30577140 CAGCTTGTTGGCCTGTGAGGGGG + Exonic
1184309327 22:43631095-43631117 CAGCCTGGGGGGCTGTGGGGAGG - Intronic
1185064356 22:48623332-48623354 CTGCGTGGTGACCTGTGGGACGG + Intronic
1185241544 22:49750029-49750051 CTGCCTGGAGCCCTGTGGGTGGG - Intergenic
1185272798 22:49936414-49936436 CAGCCAGGCGCCCTGTGGGCGGG - Intergenic
1185337657 22:50278002-50278024 CTGCAGTGTGCCCTGTGGGGGGG + Exonic
949127494 3:463958-463980 CAGCTTGGAGACCTGAGCGGGGG + Intergenic
949987513 3:9552674-9552696 CAGCATGGTGCCCGGAGGCGGGG + Exonic
951862724 3:27272133-27272155 CAGCTGGGTTCCCTGTGGATAGG - Intronic
952810998 3:37402651-37402673 CTGGGTGGTGGCCTGTGGGGTGG - Intronic
953525375 3:43686090-43686112 GAGCATGGTGCCCTGGGGGCTGG - Intronic
953922226 3:46960151-46960173 CAGGCTGGGGCCCTGTGGGAAGG - Intronic
953981089 3:47413316-47413338 CAGCCTGCACCCCTGTGGGGTGG + Exonic
954105878 3:48409720-48409742 CTGCAGGGTGCCCTGTGGGAAGG + Exonic
954293344 3:49661181-49661203 CTGCATAGTGGCCTGTGGGGCGG - Exonic
954301315 3:49702165-49702187 CTGGGTGGGGCCCTGTGGGGAGG + Intronic
954622972 3:52006152-52006174 CATTCTGGTGCCCTGTGGGAGGG - Intergenic
954842377 3:53523242-53523264 CTGCTGGGTGCCCTGTGTAGAGG + Intronic
956459100 3:69453963-69453985 CAGCTTGGGTCCCAGTGCGGGGG - Intronic
957339751 3:78880458-78880480 TAACTTTGTGCCTTGTGGGGAGG - Intronic
959512143 3:107225717-107225739 CAGCTTGGTGCTCTCAGGGTAGG + Intergenic
961012217 3:123443956-123443978 TATCGTTGTGCCCTGTGGGGTGG - Intronic
961578528 3:127858531-127858553 CAGCTTTCTGACCTGTAGGGTGG - Intergenic
961661083 3:128469161-128469183 CAGATTGGTGGCCCATGGGGTGG + Intergenic
962677302 3:137766466-137766488 CAGCTTGGTGGTCTGCGGGTTGG + Intergenic
965317211 3:167207790-167207812 CAACTTGCTGTTCTGTGGGGAGG - Intergenic
965537706 3:169841192-169841214 TAGATTGGGGCCCTGTGGGAGGG - Intronic
967118857 3:186364919-186364941 CAGAATGGAGCACTGTGGGGAGG + Intergenic
968466011 4:751699-751721 CAGCTTCATGCCCTTTGGAGGGG - Intronic
969091550 4:4697580-4697602 CAGATTGGTGCCCTCTGGGTTGG - Intergenic
969525491 4:7701985-7702007 CAACTTCGTGCCATGTGGGGCGG - Intronic
969532415 4:7737241-7737263 CAGCGGGGTGGCCTGTGGGAGGG - Intronic
969824652 4:9747822-9747844 CGGCTTGGTGCCCTGGGGATGGG - Intergenic
970482875 4:16495537-16495559 CACATTGGTGCTATGTGGGGTGG - Intergenic
972148905 4:36064639-36064661 CAACCTGGTTCCCTGTGGGGAGG + Intronic
972762693 4:42122306-42122328 CAGCTTGGTGGTTTGTGGTGAGG + Intronic
973117027 4:46474433-46474455 CAGTTTGGAGCCCTGGGTGGAGG + Intronic
975461243 4:74655872-74655894 CATCTTGGTGTCCTGAAGGGAGG - Intergenic
975584152 4:75933745-75933767 CAGCCTGGTGCCTGGTGCGGTGG + Intronic
981549493 4:145928948-145928970 CAGATTGCTGCCATGTGGGGAGG + Intronic
983726490 4:170934840-170934862 CAGCTTGGTCCTCTGTCTGGAGG + Intergenic
984714111 4:182910904-182910926 CTGATTGATGCCTTGTGGGGAGG - Intronic
985610226 5:883803-883825 CAGCGTGGGGCCCTGACGGGAGG - Intronic
985635529 5:1034006-1034028 CAGCTTTGTGCCCTGTGATTCGG - Intronic
985665702 5:1180664-1180686 CCTCTGGGTCCCCTGTGGGGTGG + Intergenic
985721157 5:1489935-1489957 CTGCATGGCGCCCAGTGGGGCGG + Intronic
985987333 5:3527145-3527167 CAGCCTGGGTCCCTGTGTGGAGG - Intergenic
986276668 5:6281261-6281283 GGACTTGGTGACCTGTGGGGTGG - Intergenic
987906377 5:24082920-24082942 CAGCATGATGCCCTGTGGAAAGG - Intronic
991406906 5:66308884-66308906 CAGCTTGGTGTCATGGCGGGAGG - Intergenic
993929616 5:93922379-93922401 CAACTTGGTGCCAGGTGTGGTGG + Intronic
994085139 5:95750306-95750328 CTGACTTGTGCCCTGTGGGGAGG - Intronic
996579755 5:125018219-125018241 CTGCTTGGAGTCCAGTGGGGGGG + Intergenic
999201132 5:149817031-149817053 CAGCTTGGTGACCAGGGGTGGGG - Intronic
999343284 5:150792284-150792306 CAGCCTTGTGCCCTCTGGGCAGG + Intronic
999800286 5:155027126-155027148 CAGCTTGGTGCACAGTGAGCAGG + Intergenic
1000040876 5:157484434-157484456 CAGCTTGGGGGCCTGCGGGTGGG - Intronic
1001932812 5:175685148-175685170 CCGCCTGGTGCCCTCTGGGAGGG - Intronic
1002451394 5:179320847-179320869 CGGGTTGTTGCCCTGTGAGGAGG + Intronic
1005313552 6:24582290-24582312 CACCTTGGTAGTCTGTGGGGTGG + Exonic
1005320277 6:24646356-24646378 TTGCTTGGTCCCCTGCGGGGTGG - Intergenic
1005376165 6:25185060-25185082 CAGCTTTGTGCCCTTTCTGGAGG + Intergenic
1005650289 6:27879366-27879388 CAGCTTGGTGCTCTCAGCGGTGG - Intergenic
1005940312 6:30555709-30555731 CATCTTGAAGCCCTGCGGGGAGG + Exonic
1006461841 6:34163861-34163883 CAGCTTCTGTCCCTGTGGGGAGG - Intergenic
1006931897 6:37693751-37693773 CAGTTTGTTGTCCTCTGGGGTGG - Intronic
1007487689 6:42193599-42193621 TGGCTCTGTGCCCTGTGGGGTGG + Intronic
1009884952 6:69614926-69614948 CATCTTGGTATCCTGGGGGGAGG + Intergenic
1010062098 6:71635239-71635261 GAGCTTGCTGCCCTGAAGGGAGG - Intergenic
1010926640 6:81752799-81752821 CAGCTGCGTGCCCTGCGGGCGGG - Intergenic
1015212158 6:130710584-130710606 CAGCCTGGTGCCCTTTGTGTTGG - Intergenic
1017960496 6:159216994-159217016 CAGCTTCCTGCCCCGTGGTGTGG + Intronic
1018625272 6:165771827-165771849 ATGCTAGGTGGCCTGTGGGGCGG + Intronic
1019467893 7:1200378-1200400 CAGCCTGGAGCCCTGGGGGACGG - Intergenic
1019660475 7:2221153-2221175 CAGGGCGGTGCCCGGTGGGGTGG - Intronic
1019940574 7:4286084-4286106 CAGCTTGGTGACCTTTCTGGGGG - Intergenic
1021121506 7:16800804-16800826 AAGCTTGGGGCCCTGTGAGATGG + Intronic
1022031063 7:26492323-26492345 CAGCTTGGATCCTGGTGGGGTGG + Intergenic
1023045827 7:36209396-36209418 CCACCTGGTGCCCTGTGAGGAGG + Intronic
1023700522 7:42888209-42888231 CTGCTTGGGGCCCTTTGGGGCGG - Intergenic
1024959195 7:54957244-54957266 CAACTTGGGGCCCGCTGGGGAGG - Intergenic
1026594675 7:71724470-71724492 AAGCATGGTGCCCAGTGAGGAGG + Intergenic
1028223208 7:88220110-88220132 CCGCGTGGTGCGCTCTGGGGCGG - Intronic
1028417426 7:90595851-90595873 CAGCGTGTTGGGCTGTGGGGAGG - Intronic
1031732732 7:125318462-125318484 CTGCTTGGTGTCCTATAGGGAGG - Intergenic
1033453473 7:141481947-141481969 CAGCATCGTGACCTGAGGGGTGG + Intergenic
1034436693 7:151065983-151066005 CAGCTTCCTGCCCTGGGAGGAGG - Intronic
1034536421 7:151728497-151728519 CAGCTTGGTGACCTGGGGTTGGG - Intronic
1035015556 7:155762766-155762788 CAGCTAAGCACCCTGTGGGGAGG + Intronic
1035407161 7:158606709-158606731 CAGCCAGGTGGCCTGTGGGCCGG + Intergenic
1035438808 7:158878917-158878939 GTGCTGGGTGCCATGTGGGGAGG + Intronic
1035962971 8:4157876-4157898 CATCCTGTTGTCCTGTGGGGAGG - Intronic
1036690397 8:10941262-10941284 CAGGTTGGTTCCCTGGGGGCAGG + Intronic
1036694993 8:10968431-10968453 CAGCTTTGTGCCCTCAGGGCTGG + Intronic
1037986707 8:23294814-23294836 CTGCTTGGTTCCCTGTGTGAGGG - Exonic
1039208497 8:35184311-35184333 AAACTTGGTGCCATATGGGGTGG - Intergenic
1039566590 8:38556304-38556326 CACCTCCTTGCCCTGTGGGGAGG - Intergenic
1045345195 8:101287700-101287722 CTACTTGCTGCACTGTGGGGAGG + Intergenic
1047088894 8:121551656-121551678 AAGCTTGCAGCCTTGTGGGGAGG + Intergenic
1048011810 8:130463508-130463530 CAGCTTGGTCCCCGGTGCTGTGG + Intergenic
1048201032 8:132374016-132374038 CCTCTGGCTGCCCTGTGGGGTGG - Intronic
1048297494 8:133225248-133225270 CAACTTGCTGTCCTGTGGGGAGG + Intronic
1048355360 8:133649351-133649373 CATCTTGGTTCCTTGTGGGTGGG - Intergenic
1048690616 8:136958708-136958730 GAGCTTGCTGCTCTGTTGGGTGG + Intergenic
1048874695 8:138827715-138827737 CATCTTGGTTCTCGGTGGGGGGG - Intronic
1048979911 8:139697714-139697736 CAGCATGGTGCTCTGAGGAGGGG - Intronic
1049237531 8:141519521-141519543 CTGCTTGGTGTTCTGTGGGGAGG - Intergenic
1049597453 8:143491330-143491352 CAGCGTGGTTCCGTGTGGGCCGG - Intronic
1049604068 8:143521020-143521042 CAGCTGAGAGCCCTGTGGGCCGG - Intronic
1049854142 8:144851076-144851098 CAGCTGGGTGCCCTGCTGGCAGG - Exonic
1051195867 9:14562275-14562297 GGGCCCGGTGCCCTGTGGGGAGG + Intergenic
1055509727 9:76984433-76984455 CAGGTTGGTGCCCCCTGGGATGG - Intergenic
1055681908 9:78724378-78724400 CAGCTTGGATCCCAGTGGTGGGG - Intergenic
1056697047 9:88867617-88867639 CAGCTTTGTGCTCTGGGGAGAGG + Intergenic
1057076010 9:92138496-92138518 GAGGTTTGTGCCCTGTGGGATGG + Intergenic
1057076686 9:92141731-92141753 TTGCTTGGTGCCCTGGGGCGTGG + Intergenic
1057211649 9:93203911-93203933 CAGCCAGGAGCCCTGTGGGAGGG + Intronic
1059324485 9:113495962-113495984 GAGACAGGTGCCCTGTGGGGTGG + Intronic
1059505998 9:114800357-114800379 CAGATAGGTGCCCTCAGGGGAGG + Intronic
1060025669 9:120168950-120168972 CAGCTGGGTGGCCTGAGGGATGG - Intergenic
1060819606 9:126653817-126653839 CAGCTTGGGGGCCTGGGAGGTGG - Intronic
1061091286 9:128428014-128428036 CACCTTGATGCCCTGAGGGCAGG + Intronic
1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG + Intergenic
1062265441 9:135684720-135684742 CAGCCTGGTCCCCTCTGGGGAGG + Intergenic
1062418709 9:136467947-136467969 CAGGTCGCTGCCCGGTGGGGTGG + Intronic
1062464317 9:136674444-136674466 CAGCTTGGGGGCCTGGAGGGCGG - Intronic
1062465222 9:136677869-136677891 CGGCTGGGTCCCCTGTGGGGTGG - Intronic
1062592925 9:137282058-137282080 CAGGTGGGTGCTCTGTGGGAAGG - Exonic
1185565194 X:1089691-1089713 CTCGTTGGTGCCCTGTTGGGTGG + Intergenic
1186385128 X:9103238-9103260 CAGCTTTGTGGGCTGTGGGGAGG + Intronic
1186473220 X:9837215-9837237 CAGCTTTGTGGTTTGTGGGGAGG + Intronic
1192089035 X:68133044-68133066 CCGCTTGCTGCCGAGTGGGGCGG - Intronic
1192931815 X:75814500-75814522 CAGCTTGGTGGGGGGTGGGGGGG + Intergenic
1194981040 X:100440715-100440737 CAGCTTGGTGCCCTAGGTGTAGG - Intergenic
1196147385 X:112332906-112332928 CAGCTTGGTGCTCTGTTGTTAGG + Intergenic
1199979333 X:152912297-152912319 CAGCATGGTGCCCTCTGCAGGGG + Intergenic
1200074923 X:153546158-153546180 AAGCTTGGAGCCCTGGGGGTGGG + Intronic
1200217972 X:154376928-154376950 CAGCTTGGATCCGTATGGGGAGG + Intergenic
1201420065 Y:13788468-13788490 CAGCTTGCTGCCCAGTGTGTAGG - Intergenic