ID: 1092289433

View in Genome Browser
Species Human (GRCh38)
Location 12:7150444-7150466
Sequence ACAGCTTGTGTGGCGTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092289424_1092289433 26 Left 1092289424 12:7150395-7150417 CCCTTCGACCTCAGGTCGCACTT 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1092289433 12:7150444-7150466 ACAGCTTGTGTGGCGTCAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1092289427_1092289433 18 Left 1092289427 12:7150403-7150425 CCTCAGGTCGCACTTCTGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1092289433 12:7150444-7150466 ACAGCTTGTGTGGCGTCAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1092289425_1092289433 25 Left 1092289425 12:7150396-7150418 CCTTCGACCTCAGGTCGCACTTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1092289433 12:7150444-7150466 ACAGCTTGTGTGGCGTCAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1092289422_1092289433 30 Left 1092289422 12:7150391-7150413 CCCTCCCTTCGACCTCAGGTCGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1092289433 12:7150444-7150466 ACAGCTTGTGTGGCGTCAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 104
1092289423_1092289433 29 Left 1092289423 12:7150392-7150414 CCTCCCTTCGACCTCAGGTCGCA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1092289433 12:7150444-7150466 ACAGCTTGTGTGGCGTCAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092289433 Original CRISPR ACAGCTTGTGTGGCGTCAGC TGG Intronic
900351504 1:2237152-2237174 ACAGCTTGTGTGCCGTTATGGGG + Intronic
901722772 1:11213446-11213468 GCAGCATGTGTGGGATCAGCTGG + Exonic
912637555 1:111312172-111312194 AGAGCCTGTGTGTAGTCAGCAGG - Exonic
912681791 1:111733674-111733696 AGAGGTTGTGTGGGGTCAGCTGG + Intronic
916785368 1:168083317-168083339 CCAGCTAGTGTGGGGTCAGTGGG + Exonic
916858850 1:168780935-168780957 ACAGCTTCTGTGGTGGCAGAAGG + Intergenic
920176007 1:204102405-204102427 AGAGCTTTTGTGTCATCAGCCGG + Intronic
920514715 1:206576183-206576205 AGAGCCTGTGTGGCTACAGCTGG - Intronic
923160634 1:231311783-231311805 ACACCATGTGTGGCAACAGCTGG + Intergenic
923891151 1:238216184-238216206 ACAGCTAGTGTGGTGTAAACAGG + Intergenic
1064145636 10:12824083-12824105 AAAGCTTGTGTGGAGGCAGAGGG + Intronic
1065351541 10:24800007-24800029 ACAGCTTGTGAGGAGTAAGAGGG - Intergenic
1068920340 10:62476574-62476596 ACAGCTTCTTTGGCATCAGGTGG - Intronic
1069901469 10:71708919-71708941 GCAGCTTGGGTGGGCTCAGCGGG - Intronic
1072179669 10:92969382-92969404 ACAGCATCTGTGACCTCAGCTGG - Intronic
1076448963 10:130542924-130542946 TCAGCAGGTGTGGCGTCGGCAGG + Intergenic
1077538745 11:3136577-3136599 AGTGGTTGTGTGGCCTCAGCTGG + Intronic
1079309247 11:19349824-19349846 CGAGCTTCTGTGACGTCAGCCGG + Intergenic
1080395401 11:31885567-31885589 ACAGGCTGTGTGGGGGCAGCTGG - Intronic
1081551841 11:44120775-44120797 ACAGCTGTTTTGGCCTCAGCTGG + Intronic
1089060937 11:115625694-115625716 ACAGCCTCTGTGGGGTCAGAAGG - Intergenic
1092289433 12:7150444-7150466 ACAGCTTGTGTGGCGTCAGCTGG + Intronic
1096387446 12:51204220-51204242 GCAGCTTGACTGGCTTCAGCAGG + Exonic
1100519278 12:95357788-95357810 ACAGCATGTGTGGTGTTAGGGGG + Intergenic
1103215757 12:119200124-119200146 ACCGTCTGGGTGGCGTCAGCTGG + Intronic
1105025916 12:132848868-132848890 ACAACCTGGGTGGCGTTAGCTGG - Intronic
1106178494 13:27351328-27351350 ACAGCTCCTGGGGGGTCAGCAGG + Intergenic
1108186846 13:47896326-47896348 ACAGTGTGCGTGGTGTCAGCAGG + Intergenic
1114215670 14:20656032-20656054 ACAGCTCTTGTGGCCACAGCAGG + Intergenic
1120222651 14:81751974-81751996 AGAGCTTTTGTGGAGTCTGCTGG + Intergenic
1123045755 14:105513116-105513138 ACAGCCTGAGCGGCGGCAGCCGG + Intergenic
1124990687 15:34670453-34670475 AAAGCATGTGTGGCATCAGGGGG - Intergenic
1128368290 15:67020389-67020411 ACCGCCTGAGTGGCCTCAGCTGG + Intergenic
1129746288 15:78023720-78023742 ACAGCTAGTATGGGGTTAGCTGG - Intronic
1130917593 15:88318127-88318149 ACAGCTTGTGTGTGGTCCCCGGG - Intergenic
1130925190 15:88380264-88380286 GCAGCTCATGTGGTGTCAGCAGG - Intergenic
1131991550 15:98097743-98097765 CCAGCCTGTGTGTCGTCAGAGGG + Intergenic
1132771242 16:1564680-1564702 AAACCTTGTGTGTCGTCTGCCGG - Intronic
1134258454 16:12630800-12630822 ACAGCTTGTCTGAGGTCTGCGGG + Intergenic
1134895474 16:17882615-17882637 TCACCTTGTGTGGCCTCACCAGG - Intergenic
1136365579 16:29807661-29807683 ACAGCTTGTGTCGGTTCAGGTGG - Exonic
1142511239 17:394814-394836 ACAGCTGGAGTGGAGACAGCAGG + Intergenic
1145891606 17:28420096-28420118 ACAGGTTATGTGGCGAGAGCGGG + Intergenic
1147512617 17:41084394-41084416 ACAGCAGGTGGGGCGACAGCAGG - Exonic
1147527326 17:41238287-41238309 ACAGCTGGTTTGGCCACAGCAGG - Exonic
1148776923 17:50101231-50101253 AGAGCTCGTGTGGCTTTAGCAGG - Intronic
1156369545 18:36460535-36460557 ACAGCTTGTGGGGCCTCTTCAGG - Intronic
1156871221 18:41947729-41947751 TCACCTTGTTTGGCCTCAGCTGG - Intergenic
1157104397 18:44759588-44759610 ACAGTGTGTGTGGGGTGAGCTGG + Intronic
1157755584 18:50214360-50214382 ACAGCTGGGGTGGCCACAGCTGG + Intergenic
1160299582 18:77668163-77668185 TCTGCTTGTGAGGAGTCAGCGGG + Intergenic
1161078575 19:2299128-2299150 ACAGCTTGAGTGGCCCCTGCTGG - Intronic
1166819988 19:45573103-45573125 AAAGCTTGTGTGCCTTCAGACGG + Intronic
926352579 2:12010174-12010196 ACAGCTTGTGTTCCCTCAGCTGG - Intergenic
926450172 2:12993939-12993961 TCAGTTTGTGTGGGGACAGCAGG - Intergenic
926840711 2:17077322-17077344 ACAGGTGGTGTGCGGTCAGCTGG - Intergenic
937370638 2:121295090-121295112 ACAGCCTGTGTGGCCCCAGGTGG - Intergenic
937404679 2:121616000-121616022 ACAGCATGTGGGGCGTAAGAAGG + Intronic
937913465 2:127087529-127087551 ACAGCGTGAGTGGAGGCAGCAGG + Intronic
947315316 2:228851351-228851373 ACAAATTGGGTGGCTTCAGCAGG - Intronic
1172481248 20:35273033-35273055 ACAGCTTGTGTGGTGGGAGCTGG + Intronic
1173365320 20:42379820-42379842 AAAGCTTGTGTGAGATCAGCAGG + Intronic
1175940784 20:62536657-62536679 GCACTTTGTGTGGCCTCAGCAGG + Intergenic
1176385570 21:6137319-6137341 GGAGCTTGTGTGGGTTCAGCAGG - Intergenic
1179737903 21:43400933-43400955 GGAGCTTGTGTGGGTTCAGCAGG + Intergenic
1183030750 22:35102705-35102727 ACAGCTTGTCTGGCATAAGAGGG + Intergenic
1183302874 22:37066864-37066886 ACAGCATGCGTGGCGTCACCTGG + Exonic
950688119 3:14633583-14633605 ACTGCTTGTGTGGCGGAACCTGG + Intergenic
952256669 3:31701626-31701648 AAAGCTTGTGTGGTGTCACTGGG - Intronic
953350408 3:42211030-42211052 AAAGCTTTTGTGGAGTCAGGGGG + Intronic
956737318 3:72247723-72247745 ACAGCTGGTGGGGAGACAGCAGG - Intergenic
958795218 3:98700061-98700083 CCAGCTTGTGTTGCGACAGAGGG - Intergenic
963780517 3:149481660-149481682 ACACCATGTGTGGAGACAGCTGG + Intronic
968490326 4:886705-886727 ACTGCGTGTGGAGCGTCAGCAGG - Intronic
974685879 4:65228395-65228417 ACAGGTTGTGTGACCTCAGTAGG + Intergenic
979969482 4:127116125-127116147 ACAGTGTTTGTGGCCTCAGCTGG - Intergenic
981797104 4:148608023-148608045 ATAGCTTGTTTGACCTCAGCTGG + Intergenic
984684396 4:182649842-182649864 ACAGCTTGTGTGGGGGCCACAGG - Intronic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
986287709 5:6372284-6372306 GCAGCTTGTCTGGCGTCAACTGG - Exonic
986482843 5:8205928-8205950 ACAACTTGTGTGGTGTCTTCAGG - Intergenic
991291483 5:65037234-65037256 GCAGCTTGCCTGGGGTCAGCAGG - Intergenic
999058212 5:148605097-148605119 ACAGCTCGTGTTGGCTCAGCTGG + Intronic
1002537149 5:179882434-179882456 TCAGCTTCTGTGGAGTCTGCTGG - Intronic
1006313717 6:33278400-33278422 CCAGCCTGTGGGACGTCAGCAGG - Exonic
1009468021 6:63997506-63997528 ACAGCTCCTGTAGCGGCAGCAGG + Intronic
1010150610 6:72727731-72727753 TCAGTTTGGGTGGGGTCAGCTGG + Intronic
1019085277 6:169469542-169469564 ACAGCTTGTCTGGCTTTAGTGGG - Intronic
1019370038 7:657756-657778 ACGTCTTGTGTGGTGACAGCTGG - Intronic
1019661232 7:2225126-2225148 ACAGCATGAGTGGCCTCAGAAGG + Intronic
1030754696 7:113273220-113273242 ACAGCCTCTGTGGCTCCAGCCGG - Intergenic
1033481912 7:141751074-141751096 ACAGCTCCTGTGGCATCACCTGG - Intronic
1033482551 7:141756358-141756380 ACAGCTCCTGTGGCATCACCTGG - Intronic
1035226048 7:157432739-157432761 GCAGCTTGTGTGCCGGAAGCTGG + Intergenic
1040840569 8:51780250-51780272 ACAGCCTGTTTGGAATCAGCAGG - Intronic
1045038446 8:98196425-98196447 ACAGCATGGGTGGCAGCAGCTGG - Intronic
1046714188 8:117549259-117549281 GCAGCTGGTTTGGCATCAGCTGG - Intergenic
1047585090 8:126262864-126262886 ACAGCTTTTGTGGTCTCAACTGG - Intergenic
1056815730 9:89799476-89799498 AATGCTGGGGTGGCGTCAGCAGG + Intergenic
1056929658 9:90863355-90863377 ACTGCATGTGTGGCCCCAGCTGG - Intronic
1059665591 9:116443478-116443500 ACAGCCTGTGTGGCCTTAGAAGG + Intronic
1059729359 9:117041620-117041642 ACAGCTTGAGAGGTTTCAGCAGG - Intronic
1061942066 9:133889179-133889201 TCAGCTTGTCTGGGGTCATCTGG - Intronic
1062418968 9:136469907-136469929 ACAGCCTGAGTGGCCACAGCAGG + Intronic
1185737092 X:2502271-2502293 GCAGGTTCTGTGGTGTCAGCAGG - Intronic
1188709606 X:33379170-33379192 GCAGCATCTGTGGCGTCAACTGG - Intergenic
1189269090 X:39737871-39737893 ACTGGTTGTGTGACCTCAGCAGG - Intergenic
1189480895 X:41391542-41391564 ACAGCAGGTGTGGCTTTAGCAGG - Intergenic
1196729681 X:118928269-118928291 ACATCCTGTGTGGCTTCAGATGG - Intergenic
1200806716 Y:7441325-7441347 ACAGATTGTCTGAAGTCAGCGGG + Intergenic