ID: 1092289915

View in Genome Browser
Species Human (GRCh38)
Location 12:7153863-7153885
Sequence TCCAGCTGCCCTGCATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 289}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092289908_1092289915 -1 Left 1092289908 12:7153841-7153863 CCAGCACCTTCTCCCCTGAGTGT 0: 1
1: 0
2: 3
3: 65
4: 1696
Right 1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG 0: 1
1: 0
2: 0
3: 39
4: 289
1092289903_1092289915 30 Left 1092289903 12:7153810-7153832 CCCCAGGTGAGAGACTTCTTGTT 0: 1
1: 0
2: 2
3: 16
4: 184
Right 1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG 0: 1
1: 0
2: 0
3: 39
4: 289
1092289905_1092289915 28 Left 1092289905 12:7153812-7153834 CCAGGTGAGAGACTTCTTGTTCT 0: 1
1: 0
2: 1
3: 19
4: 157
Right 1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG 0: 1
1: 0
2: 0
3: 39
4: 289
1092289909_1092289915 -7 Left 1092289909 12:7153847-7153869 CCTTCTCCCCTGAGTGTCCAGCT 0: 1
1: 0
2: 4
3: 29
4: 348
Right 1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG 0: 1
1: 0
2: 0
3: 39
4: 289
1092289904_1092289915 29 Left 1092289904 12:7153811-7153833 CCCAGGTGAGAGACTTCTTGTTC 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG 0: 1
1: 0
2: 0
3: 39
4: 289
1092289907_1092289915 0 Left 1092289907 12:7153840-7153862 CCCAGCACCTTCTCCCCTGAGTG 0: 1
1: 0
2: 2
3: 32
4: 462
Right 1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG 0: 1
1: 0
2: 0
3: 39
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092289915 Original CRISPR TCCAGCTGCCCTGCATGGGC TGG Intronic
900474171 1:2868593-2868615 CCCAGCGTCCCTCCATGGGCCGG + Intergenic
900750041 1:4389985-4390007 TCCATGTGGCCTGCAGGGGCTGG - Intergenic
900935523 1:5764099-5764121 TCCAGTTTCCCTCCTTGGGCTGG - Intergenic
900954480 1:5878062-5878084 CTCAGCTGCCCTGCCTGTGCCGG - Intronic
901026327 1:6280531-6280553 CCCACCTGCCCTGCATGAGGAGG + Intronic
902038641 1:13476055-13476077 TCCTCCTGCTCTCCATGGGCAGG + Exonic
902228443 1:15011946-15011968 TCCAGCAGCCCTGAAGGTGCTGG - Intronic
903564992 1:24258604-24258626 TCCAGCTGACCTGAATAGGATGG + Intergenic
903938690 1:26913896-26913918 TGCAGCTCCCTGGCATGGGCAGG + Exonic
904617173 1:31756148-31756170 TGCAGCTGCCCTGGAGAGGCGGG - Exonic
906211601 1:44015385-44015407 TGGAGCTGCCCTGGATGGGCGGG + Intronic
906322131 1:44823358-44823380 TCCGGCTGCCCTGGGTGGTCAGG + Exonic
907091892 1:51732817-51732839 TCCAGCTGCCCAGCATGTCCTGG + Intronic
907101086 1:51836149-51836171 TCCAGATGACCTGCCGGGGCTGG - Exonic
907444437 1:54498971-54498993 TCCAGCTGCCCTGCAGGACCTGG + Intergenic
911056441 1:93712355-93712377 TCCTGCTGCCACACATGGGCAGG + Intronic
911401437 1:97379708-97379730 AGCAGCTGCCCTGAAGGGGCAGG + Intronic
911725202 1:101235970-101235992 TGCAGCTGCCCAGCAGGAGCCGG - Intergenic
912435978 1:109661306-109661328 TCCAGCTGCGCTGCACAGCCTGG - Exonic
912437920 1:109674888-109674910 TCCAGCTGCGCTGCACAGCCTGG - Exonic
912440431 1:109693347-109693369 TCCAGCTGCGCTGCACAGCCTGG - Exonic
913324454 1:117614511-117614533 TCCAGCTCTCCTTCCTGGGCTGG + Intronic
914750894 1:150534240-150534262 TGCAGCTGCCCTGCAGGTGTGGG + Intergenic
915469909 1:156119688-156119710 CCCAGCTGCCTTGCCTGGGGTGG - Intronic
918053586 1:180998051-180998073 TACAACTGCCCTGCATTGGGAGG + Intronic
921174405 1:212581233-212581255 TCCAAGAGCCCTGCAGGGGCCGG - Intronic
922062630 1:222106701-222106723 CCCAGCTCCCCTGCATGAGCTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923790565 1:237107829-237107851 TCCACCTCCCCTGCACAGGCTGG + Intronic
924381557 1:243470214-243470236 TCCAGCTGCCCCGACGGGGCTGG + Intronic
924846277 1:247775587-247775609 TCTAGCGTCCCTGCATGGTCGGG - Intergenic
1062802714 10:392008-392030 GGGAGCTGCCCTGCATGTGCTGG - Intronic
1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG + Intergenic
1063238736 10:4146344-4146366 CCCAGGTGTCCTGCATGGTCTGG + Intergenic
1065207879 10:23374474-23374496 TCCAGTTCTCCTGCATGGGTTGG - Intergenic
1067575153 10:47404161-47404183 TCCAGCTCCCCAGCCTGGCCTGG - Intergenic
1067582154 10:47452654-47452676 TCCAGCTTCCCAGCCTGGCCTGG + Intergenic
1067652781 10:48168609-48168631 TCCAGGTGCGCTGCCTGAGCTGG - Exonic
1067690658 10:48499317-48499339 CCAAGCTGCCAGGCATGGGCAGG + Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069854155 10:71430230-71430252 TCCATGTGCCCAGCAGGGGCTGG + Intronic
1071095420 10:81968525-81968547 TCCAGCTGCCGTGTTTTGGCAGG + Intronic
1072588391 10:96803354-96803376 TCCAGTTGTCCTTCATGGGCTGG + Intergenic
1073069371 10:100783532-100783554 TAAAGCTGCCCTGCAGTGGCTGG - Intronic
1075032080 10:119030213-119030235 TCCAGCAGCCCGGCCTCGGCGGG - Exonic
1075405112 10:122189847-122189869 TCTAGCTGTCATGAATGGGCTGG + Intronic
1075726558 10:124613552-124613574 GCCCTCTGCCCTGCATGGGCAGG + Exonic
1076538505 10:131198598-131198620 TCCAGCACCGCTGCATGGGAGGG - Intronic
1077364970 11:2157993-2158015 GCCAGCTGCCCTGCAAGTCCTGG + Intronic
1078087409 11:8242557-8242579 TCCAGCAGCCCAGGATGGGATGG - Intronic
1083386027 11:62311024-62311046 TCCAGATGCGCTGCCTGGGCCGG + Intergenic
1083471261 11:62885587-62885609 TGCAGCTGCCCTTCCTGGACAGG + Exonic
1084214197 11:67638842-67638864 CCCGGCTGCCCTGCTGGGGCGGG + Intronic
1084268876 11:68018764-68018786 TCCAGCTGCGTGGCCTGGGCCGG - Exonic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1085590333 11:77754100-77754122 TTCAGCTGCTCTACATGGGCAGG + Intronic
1086189500 11:84061917-84061939 GCCAGCTGCCCTGCAGCAGCTGG + Intronic
1086431226 11:86738974-86738996 TCCAGTTCTCCTGTATGGGCTGG + Intergenic
1088814816 11:113413637-113413659 TTCACCTGCACTGCAAGGGCAGG - Intronic
1088976125 11:114817921-114817943 TCCTGCTGTCCTGCATGAACAGG + Intergenic
1089639790 11:119840045-119840067 TCATGCTGCCCAGCAAGGGCTGG + Intergenic
1089682326 11:120125610-120125632 TCCTGCTGCCTGACATGGGCTGG - Intronic
1091260787 11:134232556-134232578 TCCAGGTGCCCTGCTGGGGCAGG + Intronic
1091386001 12:94996-95018 TCCACCTACCCTGCATTGTCTGG + Intronic
1092182856 12:6457960-6457982 TCCTGCTGCCCTGCTGTGGCTGG + Intronic
1092289915 12:7153863-7153885 TCCAGCTGCCCTGCATGGGCTGG + Intronic
1094024733 12:25950734-25950756 TCCAGTTCTCCTGTATGGGCTGG - Intergenic
1094489728 12:30952187-30952209 TCCAGTGGCCCTGCCTGGGAGGG + Intronic
1094840945 12:34342511-34342533 CCCCGCTGCCATGCATGTGCGGG + Intergenic
1096178106 12:49536408-49536430 TCCAGCTCACCTGCTGGGGCTGG - Intergenic
1096521390 12:52186681-52186703 CCCAGCTACCCTTCATGGGCTGG + Intronic
1097289089 12:57898835-57898857 TCCAGCAGCCCTGCAGGGTTTGG + Intergenic
1097882150 12:64695820-64695842 TGTAGCTGCTCTGCATAGGCAGG + Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1101787126 12:107893790-107893812 TCAAGAAGCCATGCATGGGCCGG - Intergenic
1102615087 12:114146630-114146652 GCTAGCAGCCCTTCATGGGCAGG + Intergenic
1113795641 13:113056137-113056159 TCCACCTGCCCTGGACGGGGAGG + Intronic
1114036738 14:18636453-18636475 TCCTGCTTCCCTGCAGGGGCTGG - Intergenic
1114121898 14:19678584-19678606 TCCTGCTTCCCTGCAGGGGCTGG + Intergenic
1115333782 14:32225209-32225231 TGCCTCTGCCCTGCATAGGCTGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG + Intergenic
1119382332 14:74237227-74237249 CCCAGCTGCCCAGCTTGGGCTGG - Intergenic
1119405455 14:74395994-74396016 CACAGTTCCCCTGCATGGGCAGG + Intergenic
1119868205 14:77991638-77991660 TTCAGCTGCCCTACAAAGGCAGG - Intergenic
1120746048 14:88152972-88152994 TCCAGGTGCCCTGCCTGAGAAGG + Intergenic
1121245646 14:92459354-92459376 TGCAGCTGTCTTGCAAGGGCTGG + Intronic
1122352350 14:101103465-101103487 TCCAGCCTCTCTGCCTGGGCCGG + Intergenic
1122543387 14:102509764-102509786 TCCCGCTGTCCTGCCTGGCCGGG - Exonic
1122881056 14:104690572-104690594 TCCTGGTTCCCTGCCTGGGCAGG - Intronic
1122888082 14:104719417-104719439 GCCAGCTGCCCAGCGTGGGCAGG + Exonic
1123025861 14:105423617-105423639 GCCCGCGGCCCTGCAGGGGCAGG - Intronic
1123687595 15:22810169-22810191 TCCGCCTGCCCTGCGTGGGATGG + Intronic
1124005522 15:25792761-25792783 TCCATCTCCCCTGCCAGGGCAGG + Intronic
1126323065 15:47446120-47446142 CCCATCTGCCCTGGAAGGGCAGG + Intronic
1129744379 15:78007926-78007948 TCCCGCTGGCCTGCAGGGCCAGG + Intronic
1130152951 15:81324944-81324966 TCCAGCTGCCCTGGAGCTGCGGG + Intergenic
1132106746 15:99068336-99068358 TCCAGCGGCCCTGCCAGGGGTGG - Intergenic
1132426822 15:101724589-101724611 GCCAGATACCCTGCAGGGGCGGG + Exonic
1132426842 15:101724634-101724656 GCCAGATACCCTGCAGGGGCGGG + Intergenic
1132467625 16:84754-84776 TCCTCCTGCCCTGCCTGTGCAGG + Intronic
1132715817 16:1289357-1289379 GCCACCTGACCTGCAGGGGCGGG + Intergenic
1133000706 16:2850107-2850129 TCCTGTTGCCCTGCAGAGGCAGG + Intergenic
1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG + Intronic
1134018336 16:10904759-10904781 TCCAGCTGCCGGGCATTGGGTGG - Exonic
1134079517 16:11315494-11315516 TCCTGCGGCCCTTCTTGGGCTGG - Intronic
1137572877 16:49578264-49578286 TCCAGCTGCTATGGATAGGCTGG - Intronic
1139233372 16:65308700-65308722 TACATCTGCCCTGCTTGGTCAGG - Intergenic
1139379882 16:66523902-66523924 TCCAGCTGCCCTCGATGGAGCGG - Intronic
1141543439 16:84745238-84745260 TCCTGCTTCCCTGCAGAGGCTGG + Exonic
1142276809 16:89123139-89123161 TACAGCTGCCCTGCGGGGCCTGG + Intronic
1142287853 16:89178738-89178760 TCCAGCTGCTCTTGATGGACTGG + Intronic
1142307133 16:89292069-89292091 TCCAGCTGCCCTGCGGGTTCTGG + Intronic
1142356989 16:89605951-89605973 AGCAGCTGCCCGGCCTGGGCTGG + Intergenic
1142362563 16:89634437-89634459 TCCAGCTGCCCAACAGGGCCTGG - Intronic
1143108188 17:4539772-4539794 GCCAGCCCCCCAGCATGGGCAGG - Exonic
1143198627 17:5097025-5097047 TCCAGCTGACCTCCATTTGCAGG - Intergenic
1144734084 17:17545220-17545242 TACAGGTGACCTGCATGGGCGGG - Intronic
1144838465 17:18171044-18171066 TCCAGCTGGTCAGGATGGGCTGG + Intronic
1145901030 17:28490648-28490670 TCCAGCTTCCCTTCAGGGACTGG - Intronic
1147403438 17:40194442-40194464 TCGTGCTGCCCTGCATGCCCAGG + Exonic
1147903913 17:43810410-43810432 TCCACCTGCCCTGGTTGGGGAGG + Intronic
1149987007 17:61354903-61354925 TCCACCTGCCCTGAAGGGGAGGG - Intronic
1150445245 17:65223515-65223537 TTCAGATCACCTGCATGGGCAGG - Intronic
1150521163 17:65867237-65867259 TCCAGCTGCTGTGCACAGGCCGG - Intronic
1151081504 17:71334564-71334586 TCCAGCTGCCCTTTCTAGGCAGG + Intergenic
1151365078 17:73611819-73611841 TCCAGCTTGGCTGCAGGGGCAGG - Intronic
1151758908 17:76089778-76089800 TCCAGAAGCCCTGACTGGGCTGG - Intronic
1151974269 17:77475603-77475625 TCCAGCTGCCCTCCCTCTGCAGG - Intronic
1152500891 17:80708408-80708430 CCAAGCTGCCCTGCAGGTGCAGG + Intronic
1152729201 17:81961479-81961501 TCCAGCTGCCCCGCGGGGGGGGG - Intronic
1152795470 17:82304198-82304220 TCAAGCTGCCCTGCATCCGGTGG - Intergenic
1152924076 17:83079652-83079674 TCCAGCGGGCCGGGATGGGCGGG + Intergenic
1153837846 18:8980368-8980390 TCCACCTGCTCTACAGGGGCAGG - Intergenic
1154074155 18:11182775-11182797 TCCACCTGCCCTCCCTTGGCTGG - Intergenic
1154162802 18:11992406-11992428 GCCAGCTGCCCTGCAGTGACTGG + Intronic
1154381042 18:13850078-13850100 TCCTGCTCCCATGCCTGGGCTGG + Intergenic
1155602784 18:27568831-27568853 TCCAGCTTCACTGCAGGGGGTGG + Intergenic
1156455363 18:37290198-37290220 TCCAGCTGCTGTGCATGGACAGG - Intronic
1157697872 18:49738058-49738080 TCCAGCTGACCTGCATTCTCTGG + Intergenic
1158565279 18:58549815-58549837 CTGAGCTGCCCTGCATGGGTAGG + Intronic
1159066997 18:63581174-63581196 TCCAGATGTTGTGCATGGGCCGG + Intergenic
1160998755 19:1897959-1897981 TCTTGCTGCCCTGCTAGGGCTGG - Intergenic
1162479727 19:10921295-10921317 GCCTGCTGCTGTGCATGGGCTGG + Intronic
1163665966 19:18604239-18604261 TGCAGCTGCCCTCCCGGGGCTGG + Intronic
1163675908 19:18655176-18655198 TCCAGCCGCCCTGCAAGAGAGGG - Intronic
1163860619 19:19740902-19740924 TACAGCTGCCCTGCCCGCGCAGG + Intergenic
1167646803 19:50710434-50710456 ACCAGCTGCCCTTCAAGGGCAGG + Intronic
1167744049 19:51340641-51340663 TCCGGCTGCGCTGCCTGGGGTGG - Exonic
1168337812 19:55606081-55606103 AGCAGCTGCCCTACATGGGGAGG - Intronic
1168356883 19:55706093-55706115 TCCAGATTCTCTGCATGTGCAGG + Intronic
925129466 2:1484288-1484310 TCTAGCTGCCCAGCCTGGCCCGG + Intronic
925205181 2:2000127-2000149 TACAGCTCCCCTCCCTGGGCAGG + Intronic
926381629 2:12296327-12296349 TTCAGCTGCCCTGCAGGGTGTGG + Intergenic
926690742 2:15731537-15731559 TCCAACTGCTTTGCAGGGGCTGG - Intronic
928324887 2:30311419-30311441 GCAAGCAGGCCTGCATGGGCTGG - Intronic
928395533 2:30940805-30940827 TCCAGAAGGCCTTCATGGGCTGG + Intronic
928945730 2:36770424-36770446 ATCAGCTCCTCTGCATGGGCTGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929927876 2:46230409-46230431 TCCTGCTGCCCTGCTGGGGAAGG - Intergenic
930104919 2:47632134-47632156 TCAAGCAGGCCTGCAAGGGCGGG + Intergenic
932585225 2:73023348-73023370 GACAGCTGCCCAGCCTGGGCTGG - Intronic
932766631 2:74474688-74474710 TGCAGCTGACCTGTCTGGGCTGG + Exonic
933961865 2:87411887-87411909 TCCAGCTGCGCTGGCTTGGCTGG - Intergenic
934040500 2:88124237-88124259 TCCACCTGCCCTGCATGCCCAGG - Intronic
934716838 2:96549505-96549527 GCCCGATGCCCTGCCTGGGCGGG - Intronic
935953479 2:108352055-108352077 CCCAGCTGCCCTGCTTAGACAGG + Intergenic
936078880 2:109418846-109418868 CAGTGCTGCCCTGCATGGGCTGG + Intronic
937111207 2:119368009-119368031 TCTAGCTGCCCTGTTGGGGCAGG + Intronic
938041880 2:128082856-128082878 TCCAGTTTCCCTGTGTGGGCTGG + Intergenic
938109729 2:128555737-128555759 AGCAGCTGCCCTCCTTGGGCTGG - Intergenic
938257167 2:129868418-129868440 TCCAACTCCCATGCTTGGGCAGG - Intergenic
938305970 2:130254121-130254143 TCCTGGTGCACTGCCTGGGCCGG - Intergenic
938539648 2:132275585-132275607 ACCAGATGCCCCGCGTGGGCCGG - Intergenic
941415535 2:165216279-165216301 GGCAGGTGCTCTGCATGGGCTGG + Intergenic
941986412 2:171515807-171515829 TCCACCTGCCCCACGTGGGCAGG - Intergenic
942059504 2:172215286-172215308 TCCTGCTGCCCTGCTCGTGCTGG + Intergenic
942139851 2:172967100-172967122 TCCAGCTGCACAGTCTGGGCAGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
946223572 2:218249683-218249705 TCCTGCTTCCCTGCAGGGCCTGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948055870 2:235008947-235008969 TCCAGCTGGCTTACAGGGGCTGG + Intronic
948150418 2:235740145-235740167 TCCCGCTGCCCAGCAGGAGCAGG + Intronic
948284024 2:236770071-236770093 TGCAGATGCCCTGCCTGGGTCGG + Intergenic
948461144 2:238130580-238130602 TGCAGGTGTCCTGCAGGGGCCGG - Exonic
948901755 2:240959877-240959899 TCCTGCTGCCCTGCTTGTCCTGG + Intronic
1168821425 20:775970-775992 CCCAGCCGCTCTGCATGGGAGGG + Intergenic
1168957051 20:1841622-1841644 TCCAGCTGCCCAGCCTTGCCTGG + Intergenic
1171861557 20:30405806-30405828 GCCAGCCGCCCTGCCTGGGAGGG + Intergenic
1174404618 20:50295233-50295255 TCCATCAGCCCTACAAGGGCAGG - Intergenic
1174518085 20:51108766-51108788 TCCTGCTGCTCTGCCTGTGCTGG + Intergenic
1175215028 20:57387699-57387721 TCCAGCTGCCCTGCAGAGGAGGG - Intergenic
1175340394 20:58225702-58225724 TGCAGCTGTACTGCAGGGGCTGG - Intronic
1175552645 20:59827213-59827235 ACCAGCTGGCCTTCATGGGCGGG + Intronic
1175801521 20:61803638-61803660 TCCAGTTACTCTGCATGGCCAGG + Intronic
1175828665 20:61950679-61950701 TGCTGCTGCCCAGCAGGGGCCGG - Intergenic
1176031869 20:63016783-63016805 TCCAGGTGCCCTGAGTGGACTGG + Intergenic
1178695334 21:34787921-34787943 TCCAGCTGCCCTGCTCAGGCTGG + Exonic
1179332821 21:40421846-40421868 CCCAGGTGCCCTGCAGGGGAGGG + Intronic
1179785211 21:43725968-43725990 GCCAGCTGCCCAGCATGGCCTGG - Intronic
1179955653 21:44736860-44736882 CGCAGCTGCCCTGACTGGGCTGG + Intergenic
1180086377 21:45509668-45509690 CCCAGCAGCTCTGCAGGGGCTGG - Intronic
1180460862 22:15563501-15563523 TCCTGCTTCCCTGCAGGGGCTGG - Intergenic
1180865316 22:19115311-19115333 ACCAGCTGCCCAGCCTGGGGTGG - Intronic
1181314413 22:21962309-21962331 CCCAGCACCCCTCCATGGGCTGG - Intronic
1181527016 22:23495884-23495906 TCCAAGTGCCCTCCAGGGGCCGG + Intergenic
1181856558 22:25785362-25785384 ACCACCTGCCCTGCCAGGGCTGG + Intronic
1183293182 22:37015217-37015239 TACAGCAGCCCTGCAAGGGGAGG - Intronic
1183703476 22:39462969-39462991 TCCGGCTGCCCTCTCTGGGCAGG + Intronic
1183797159 22:40128986-40129008 CCCAGCTGCCCTGCATGACATGG - Intronic
1183966749 22:41446873-41446895 TCCCTCCGCCCTGCAGGGGCGGG + Exonic
1184854086 22:47136957-47136979 GCCACCTGCACAGCATGGGCTGG - Intronic
1185344641 22:50305954-50305976 TGCAGCTGCCCAGACTGGGCGGG - Intronic
1185377227 22:50488149-50488171 TCCAGCAGCCCTGCCTGGGTTGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950282837 3:11721419-11721441 TCCAGAGGCCCTGTATGGACTGG - Intergenic
950443539 3:13023334-13023356 CCCAGCTGCCTGGCCTGGGCTGG - Intronic
950682069 3:14592373-14592395 GCCAGCAGACCTGCATGGACAGG + Intergenic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953992811 3:47497218-47497240 TCCAGCTTCCCTCCCAGGGCAGG + Intronic
954138311 3:48592450-48592472 CCCAGCTGCCCTAGAAGGGCCGG - Exonic
954748565 3:52800862-52800884 TCCAGCAACTCTGCATGTGCAGG + Intronic
954882119 3:53843582-53843604 ACCAGCTCCCCTGGGTGGGCAGG + Intronic
954948427 3:54447164-54447186 TGCAGCTGCCATGCATGTGGTGG - Intronic
955356363 3:58236356-58236378 TCCAGCTGCCCTGCAGAGCAGGG + Intergenic
956386514 3:68725265-68725287 TCCAGCTGGCCAGCAGTGGCAGG - Intergenic
957705116 3:83770409-83770431 TCCTGCTGCCATTCATGGCCTGG - Intergenic
959521618 3:107328318-107328340 TGCAGCAGCCATGAATGGGCTGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961554328 3:127687963-127687985 TTCACCTGCCCTGCATGGGATGG + Intergenic
963644815 3:147900843-147900865 TCCAGTTTTCTTGCATGGGCTGG - Intergenic
964037510 3:152217334-152217356 TCCAGTTGGCCTGCAAGTGCAGG - Intergenic
966011739 3:175087257-175087279 GCCAGCTGCCCTGCCCGGGAGGG + Intronic
966889292 3:184395129-184395151 TCCACCTGCCTTGGCTGGGCTGG + Intronic
966924231 3:184634167-184634189 TCCAGCTGCCCTGAGTGGAAAGG + Intronic
967389240 3:188939147-188939169 TCCAGCTGCCCACTCTGGGCAGG + Intergenic
967794966 3:193590144-193590166 TCCAGTTCTCCTGCATAGGCTGG - Intronic
967973054 3:195013211-195013233 TCCTGAGGCACTGCATGGGCTGG - Intergenic
968457442 4:706563-706585 TCCCGCGGTCCTGCCTGGGCTGG - Intronic
968457482 4:706665-706687 TCCCGCGGTCCTGCCTGGGCTGG - Intronic
968457531 4:706802-706824 TCCCGCGGTCCTGCCTGGGCTGG - Intronic
968457580 4:706939-706961 TCCCGCGGTCCTGCCTGGGCTGG - Intronic
970449627 4:16154163-16154185 TCCAGATGCAGTGCCTGGGCTGG - Intergenic
972342081 4:38160865-38160887 TCCAGCTGACCTGATTAGGCAGG + Intergenic
977440921 4:97066472-97066494 TTCACCTGACCTGAATGGGCAGG + Intergenic
978013835 4:103719957-103719979 GCCAGCTGCCCGGCACAGGCTGG + Intergenic
979482375 4:121234810-121234832 TCCAGTGGCCCTTCAAGGGCAGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981629809 4:146805119-146805141 TCCAGCAGCCCTGCAGGAGAGGG + Intronic
985888630 5:2699359-2699381 TCCAGCTGCCCTGACGGTGCCGG + Intergenic
986423415 5:7606982-7607004 TCCACCTGCCCTGCACATGCAGG + Intronic
986423420 5:7606991-7607013 CTCAGGTGCCCTGCATGTGCAGG - Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987309975 5:16672780-16672802 TCCTGCTGTCCTCCATGGCCAGG + Exonic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
998253352 5:140567205-140567227 TCCAGCGGGCCTGCCTGGGACGG - Exonic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
998599067 5:143566326-143566348 TCCAGCGGGCCTGCTTGGGTAGG + Intergenic
998945093 5:147330448-147330470 TCCAGCCCCTCAGCATGGGCTGG - Intronic
1000592988 5:163181304-163181326 TCCATCTTCTCTGCATTGGCAGG + Intergenic
1001570229 5:172725929-172725951 TCCAGCAGCCCTGCCTGGCCTGG + Intergenic
1001656705 5:173356265-173356287 TGCTGCTGCCCTGCCTGGGCCGG + Intergenic
1001806287 5:174589553-174589575 GCCATCTGCTCTGCCTGGGCTGG + Intergenic
1002066389 5:176654152-176654174 GCCACATGCCCTGCATGTGCTGG - Intronic
1003125455 6:3352060-3352082 TCCAGCAGCCCTGCCTGGGGAGG - Intronic
1004442677 6:15669134-15669156 TTAAGCTGCCCTGCAGGGGAAGG + Intergenic
1006422687 6:33945183-33945205 CCCCACTGCCCTGCACGGGCGGG - Intergenic
1006480058 6:34285132-34285154 TCCATCTGCCCTGCATGGAGAGG - Exonic
1007166162 6:39830546-39830568 CCCAGCTGCACTGCCTGAGCCGG - Intronic
1007422940 6:41730434-41730456 ACCAGGTGGCCTGCATGGCCTGG + Intronic
1007594144 6:43041024-43041046 TCCGGCTGCCCTGGATCTGCTGG + Exonic
1012759237 6:103277166-103277188 TCCAGCTGCCTTGCATGCTCTGG + Intergenic
1017632078 6:156406233-156406255 TCCTGCAGCCCTACTTGGGCAGG + Intergenic
1017788607 6:157776105-157776127 TCCAGCTACATTCCATGGGCTGG - Intronic
1018174462 6:161166912-161166934 TCCCGCTGCCCTGCAGGTGCTGG - Intronic
1018206718 6:161443383-161443405 ACCACATGCCCTGCATGGGGCGG + Intronic
1018356270 6:163021023-163021045 TCCACCTGCCCAGGACGGGCAGG - Intronic
1018751232 6:166808047-166808069 TCGTGCTGCCCTGCAGGGGTGGG - Intronic
1019174445 6:170153059-170153081 TGCGGCTGCCCTGCAGGAGCTGG + Intergenic
1019656701 7:2199866-2199888 TCCAGCTGACCTGGATGGTGCGG - Intronic
1019656945 7:2200969-2200991 TCCACCTACCCTGCGTGGCCTGG - Intronic
1019775356 7:2909349-2909371 TCCCGTGGCCCTGCATGGCCTGG + Intronic
1020617647 7:10479263-10479285 TACAGCTGCCCTGCATGCTTTGG - Intergenic
1022985503 7:35650266-35650288 GCCTGCTGCACTGGATGGGCTGG + Intronic
1023844174 7:44111841-44111863 TCGGGCTCCCCTGCAAGGGCGGG - Exonic
1026660157 7:72293573-72293595 TCCTGCTACCCTGCATGGTAGGG - Intronic
1026925618 7:74190786-74190808 ACCAGCTGCTCTGCCTGGGTTGG - Intronic
1030711712 7:112757627-112757649 TCCAGGTGGCCCTCATGGGCAGG - Intergenic
1033588361 7:142790926-142790948 TCCAGCAACCCTGCCTGGCCAGG - Intergenic
1034276435 7:149825904-149825926 TCCAGCTGCACCGCCTGGGCCGG - Intergenic
1034541903 7:151763772-151763794 TCCAGATGCCGTGCCTGGTCTGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034803586 7:154068514-154068536 ACCAGCTGCCCTCCAAGGCCGGG - Intronic
1035048769 7:155986162-155986184 TCCAGCTGCCCAGCCAGGCCAGG + Intergenic
1036577859 8:10045200-10045222 TCAAGGTGCCATGCATGGGGAGG + Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1041394680 8:57378464-57378486 TTCTGCTGCCCTGCATGTGCAGG - Intergenic
1042080067 8:65041871-65041893 TCCTGCTGCCCTGCCAGGGAAGG + Intergenic
1043195829 8:77290208-77290230 TCCTGGTACCCTGCAAGGGCAGG - Intergenic
1044395084 8:91702213-91702235 TGCAGCTGCCCTTCTTGGGAAGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1048866333 8:138764373-138764395 TCCTACTGCCCAGGATGGGCAGG + Intronic
1049600663 8:143505921-143505943 GCCAGCTGCCCTGCAGGGAGCGG - Intronic
1049607715 8:143537413-143537435 TCCAGCTGGTCTGAGTGGGCAGG - Intronic
1049675374 8:143886703-143886725 CCCACATGCCCTGCCTGGGCGGG - Intergenic
1050569192 9:6920069-6920091 TCCAGTTCTTCTGCATGGGCTGG - Intronic
1052993915 9:34539450-34539472 CCGCTCTGCCCTGCATGGGCAGG + Intergenic
1053072106 9:35107724-35107746 TGCAGCTGGCCTGGAGGGGCTGG + Exonic
1054831224 9:69627396-69627418 CCCAGCTGGCTTGCATGGGAAGG + Intronic
1056650850 9:88460667-88460689 TCCTGCTGGCCTGCCTGAGCTGG - Intronic
1057772635 9:97982681-97982703 CCCAGCTGCCCTGCCAGGGCCGG + Intergenic
1060234677 9:121853866-121853888 GCCAGCTGCTCTGCAGGTGCTGG - Intronic
1060913103 9:127366463-127366485 TCCTGCTGCCCTGCATCCCCAGG + Intronic
1061406138 9:130393991-130394013 TCCAGCTGACCGTCATGGGTGGG + Intronic
1061926107 9:133806803-133806825 TCCGGCAGCCGTGCATGGGTGGG - Intronic
1062077610 9:134600333-134600355 CCCAGCTGCCCTGGACGGGGTGG + Intergenic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062350463 9:136136208-136136230 TCCAGATGCCCGGGATGCGCCGG + Intergenic
1186448251 X:9650516-9650538 TCCAGCTGCCCTCACTGGGAGGG + Intronic
1187710176 X:22045446-22045468 TCCAGCTGCCATGCAATTGCTGG - Intronic
1188482895 X:30653113-30653135 TCCAGCTGCATGGCATGGGGCGG - Intergenic
1188841364 X:35022185-35022207 CACAGCTGCCCTGTGTGGGCAGG + Intergenic
1188988779 X:36791791-36791813 CACAGCTGGCCTGCATAGGCAGG - Intergenic
1190728047 X:53204471-53204493 TCTAGCTGCCCAGCATGGGAGGG + Intronic
1190745297 X:53318940-53318962 CGCAGCAGCCCTGCCTGGGCAGG + Intronic
1193068123 X:77279602-77279624 GCCAGCTGCCCTGTCTGGGAGGG + Intergenic
1194118042 X:89926788-89926810 TCCTGCTGCCCGGGGTGGGCAGG + Intergenic
1198707593 X:139465514-139465536 TTCAGCTGCTTTGCATGGACAGG - Intergenic
1200051486 X:153434112-153434134 TCCAGCTACCCGGAATGCGCTGG + Intergenic