ID: 1092290769

View in Genome Browser
Species Human (GRCh38)
Location 12:7158380-7158402
Sequence CCTTAGCACTCACTGTGTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092290761_1092290769 -6 Left 1092290761 12:7158363-7158385 CCCAATGGCAGCTGCCCCCTTAG 0: 1
1: 0
2: 2
3: 8
4: 135
Right 1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1092290762_1092290769 -7 Left 1092290762 12:7158364-7158386 CCAATGGCAGCTGCCCCCTTAGC 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1092290760_1092290769 -5 Left 1092290760 12:7158362-7158384 CCCCAATGGCAGCTGCCCCCTTA 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1092290759_1092290769 -4 Left 1092290759 12:7158361-7158383 CCCCCAATGGCAGCTGCCCCCTT 0: 1
1: 0
2: 1
3: 30
4: 188
Right 1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 132
1092290758_1092290769 4 Left 1092290758 12:7158353-7158375 CCTTTCTACCCCCAATGGCAGCT 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092290769 Original CRISPR CCTTAGCACTCACTGTGTTG GGG Exonic
902570259 1:17342459-17342481 CCGCAGCACTCACTGTGTGATGG + Intronic
904589757 1:31605898-31605920 CCTTAGCTGTCACAGTATTGTGG + Intergenic
908386754 1:63650224-63650246 CCTTATCAATAACTGTTTTGAGG - Intronic
910230622 1:84983119-84983141 GCTTACCACTCACTGTGATGAGG - Intronic
911102097 1:94103309-94103331 CTTCAGCAGTCAATGTGTTGGGG - Intronic
914265062 1:146031498-146031520 CATTACCACTCACTGAGTTTGGG + Intergenic
914693967 1:150058694-150058716 CCTTAAAACTCAATGTGTTTGGG - Intergenic
915808833 1:158885079-158885101 ACTGAGCACTCACTATGTTTGGG + Intergenic
918063266 1:181080644-181080666 CAGTAGCACTCACTATCTTGTGG - Intergenic
922090795 1:222393358-222393380 CTTGAGAACTCACTGTGGTGAGG + Intergenic
924004311 1:239590998-239591020 CATTAACACTTACTGTGATGGGG - Intronic
1063988232 10:11530949-11530971 CGTTTGCAGTCACTGTTTTGGGG - Intronic
1064405111 10:15054728-15054750 ACTTTGCATCCACTGTGTTGTGG + Intronic
1068687397 10:59883082-59883104 CCCTGGGACTCACTGTGTTTCGG - Intronic
1071366416 10:84904951-84904973 GCTCAGCCCTCACTGTGTTCAGG + Intergenic
1071416298 10:85444921-85444943 CATTACCACTCACGCTGTTGGGG - Intergenic
1071817240 10:89245548-89245570 CGAAAGCACTAACTGTGTTGAGG - Intronic
1072577028 10:96709792-96709814 CCTCAGCACCCGCTGTGTCGTGG - Exonic
1072654612 10:97321077-97321099 CCTGGGCACGCACTGGGTTGCGG + Exonic
1073071888 10:100799472-100799494 ACTGAGCACTTACTGTGTTCTGG - Intronic
1077942131 11:6854529-6854551 CAGTAGCACTCTCTGTTTTGGGG - Intergenic
1079336071 11:19571973-19571995 TCTAAGCACTCACTGTGTTAGGG + Intronic
1079402210 11:20114830-20114852 CTTTAGCACTTACTGTGTGTTGG + Intronic
1081992805 11:47346758-47346780 CACTTGCACTCCCTGTGTTGTGG + Intronic
1084021808 11:66422262-66422284 CCTTAGCACTCACCATGGAGTGG - Exonic
1084054057 11:66620133-66620155 GCTTTGCACTTACTGTGATGGGG + Intronic
1086989792 11:93290367-93290389 CCATAGTACTCACTGTATTTTGG + Intergenic
1087160373 11:94942768-94942790 CCTAACCACTCACTGTCTTAGGG + Intergenic
1087842953 11:102938860-102938882 CCTGAGCACTCACTGAGCCGAGG + Intergenic
1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG + Exonic
1092995069 12:13941884-13941906 CCTTAGCAGACACTGCGCTGCGG - Intronic
1093565779 12:20601481-20601503 CCTTTGAACACACTGTTTTGTGG - Intronic
1095971718 12:47905921-47905943 TCTTAGAACTCACTGTGCAGTGG + Intronic
1101016469 12:100505966-100505988 ATTTAGCAGTCACTGTGTTAGGG - Intronic
1101409149 12:104455122-104455144 CCTTAATCCTCACTGTGTTTGGG + Intergenic
1101860091 12:108475645-108475667 CCTTAGAACTCTTTCTGTTGAGG - Intergenic
1105603023 13:21903766-21903788 CCTGAGCATTCACTATGTTCAGG + Intergenic
1106174957 13:27322303-27322325 CTTGAGCACTTACTGTGTGGAGG + Intergenic
1108130033 13:47288859-47288881 CTGTAGCACTCACTGCCTTGTGG - Intergenic
1115506874 14:34101387-34101409 CCTGAGCAGTCAGTCTGTTGGGG - Intronic
1115709801 14:36038668-36038690 CCTTAGCATTCCCTGTGAGGTGG + Intergenic
1119647905 14:76361748-76361770 CCTTAGCCCTGACATTGTTGGGG + Intronic
1127277905 15:57463552-57463574 CCTTAGTACCCACTGGGGTGTGG + Intronic
1128715383 15:69904074-69904096 CTCAAGCACTCACTGTATTGTGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142842022 17:2640041-2640063 CATTTGCACTCTGTGTGTTGGGG + Intronic
1144060528 17:11580121-11580143 CCTCAGCACTCCTTGTGTTCAGG - Intergenic
1144590247 17:16517628-16517650 CCCTCCCACTCACTGTGCTGGGG + Intergenic
1146979252 17:37144409-37144431 ACTTAGCTCTCACTGTGGGGCGG - Intronic
1148743246 17:49904695-49904717 TCCTAGCACTTACAGTGTTGTGG + Intergenic
1148791797 17:50177359-50177381 CCTGAGCACTCACTGTGTGCAGG - Intergenic
1149809232 17:59651538-59651560 TCTTATGACTCACTTTGTTGTGG - Intronic
1155169544 18:23257126-23257148 CCTGAGCACTCACTGGCTGGTGG + Intronic
1155858349 18:30864155-30864177 CCTGAGCACCCAGTGTGTAGTGG + Intergenic
1156264787 18:35477742-35477764 CTTGAGCAGTCACTGTGGTGGGG + Intronic
1157572591 18:48722962-48722984 CCAGAGCACTCACTGTATTCAGG + Intronic
1157719716 18:49914322-49914344 CCATAGCACACCCTGTGATGGGG + Intronic
1158302325 18:56065797-56065819 CCTTAGAAGTCACTGTTTTCAGG - Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1158830961 18:61278050-61278072 CCATAGCACTCTGTGTGTTGAGG + Intergenic
1161555431 19:4939508-4939530 CCTTAACACTTAATTTGTTGAGG + Intronic
1163294610 19:16404297-16404319 CCCTGGAACTCCCTGTGTTGTGG + Intronic
1164532144 19:29056857-29056879 CCTCAGAGCTCACAGTGTTGGGG - Intergenic
1165304529 19:34995378-34995400 ACTGAGCACTTACTGTGTTGGGG + Intronic
1167881790 19:52465278-52465300 CCCCACCACTCACTGGGTTGAGG + Intronic
1168292365 19:55362809-55362831 ATTTAGCAGTCACTGTGTGGGGG - Intronic
1168381785 19:55930152-55930174 CCTTAGAACTCACTCATTTGAGG + Intronic
928491990 2:31793856-31793878 GCTTACCCCTCACTGGGTTGTGG - Intergenic
929054640 2:37865501-37865523 CCTGAACATTCACTGTGTTCAGG - Intergenic
935384097 2:102483227-102483249 ACTTAATACTCACTGTGCTGTGG - Intronic
935849892 2:107207025-107207047 CCTTAGCCCTCAAAGTGCTGGGG - Intergenic
939839608 2:147171030-147171052 CCTTAGCACTTACTATGTTTTGG + Intergenic
941929289 2:170924504-170924526 CCCTAGCACCCACTCTGGTGTGG - Intergenic
942785432 2:179696091-179696113 CCTTAGCATTGAAGGTGTTGTGG + Intronic
944206302 2:197162119-197162141 CCTTAGCCCACAGTGTGTTCTGG + Intronic
947837328 2:233185028-233185050 CTTTAGCACAAACTGTGTTTAGG + Intronic
1172924547 20:38520501-38520523 ACTTTGCACTAACTGTGTTTTGG + Intronic
1175172692 20:57091382-57091404 CCTCAGCACTCACACTTTTGCGG - Intergenic
1175890992 20:62315847-62315869 GGTGAGCACTCACTGTGCTGTGG - Intronic
1177624187 21:23637793-23637815 ACTTAGCACTATTTGTGTTGGGG - Intergenic
1178815365 21:35924311-35924333 CCTTTGCAGTCACTGAGTTTTGG + Intronic
1180145426 21:45915999-45916021 CCAGAGCACTCACAGTGGTGGGG - Intronic
1181041775 22:20195666-20195688 CCTCAGCATTCACTGAGTTTTGG + Intergenic
1181688320 22:24544067-24544089 CCTTCACACTCACTGTGCTGTGG + Exonic
1182863545 22:33582224-33582246 CCTTAGCACTCATGATGTTCTGG - Intronic
1184110326 22:42390317-42390339 CCTGAGCACTTACTGTGTGCTGG + Intronic
1184721866 22:46319354-46319376 ACCTGGCCCTCACTGTGTTGGGG + Intronic
950106161 3:10390256-10390278 ACTTATCTCTCACTGTGTTTTGG + Intronic
955175189 3:56606546-56606568 CCTTTGCACTTTCTGGGTTGAGG + Intronic
957131732 3:76231340-76231362 CCTTAGCACCCACTGCTCTGCGG + Intronic
959012169 3:101090291-101090313 CCATAGCTGTCACTGAGTTGTGG + Intergenic
961989414 3:131171696-131171718 CTTTAGCACTTACTGTGTGCTGG - Intronic
962733041 3:138300312-138300334 CCTGAGCACAGAGTGTGTTGTGG + Intronic
964573869 3:158142686-158142708 CCGTAGAACTCACTATCTTGAGG + Intronic
964625817 3:158758611-158758633 CCTTGACACCCACGGTGTTGAGG + Intronic
964935066 3:162074144-162074166 CCTTAGCCTTCTCTGTTTTGTGG - Intergenic
966950862 3:184816340-184816362 ACTTAGCACTCACTGTATACAGG + Intronic
971284497 4:25274625-25274647 ACTGAGCACTCACGGTGTTGGGG - Intronic
978583457 4:110254749-110254771 AATCAGCACTCACTGTGTTTTGG - Intergenic
978903034 4:113975738-113975760 GCTGAGCAGTCACTGTGTTCTGG - Intronic
984884892 4:184441398-184441420 CCTGACCACTCACTGTGATTTGG - Intronic
986116083 5:4776150-4776172 CAATAACACTCACTGGGTTGCGG - Intergenic
986890825 5:12302997-12303019 CATGAGAACTCACTGTCTTGAGG + Intergenic
997519274 5:134512260-134512282 CATGAGAACTCACTGAGTTGGGG - Intergenic
997714443 5:136031469-136031491 CAGTAGATCTCACTGTGTTGTGG - Intronic
1003140040 6:3463765-3463787 CCAGAGAACTCACTGTCTTGAGG - Intergenic
1004560289 6:16743344-16743366 CCTTTTCACTCACTGTGTGATGG + Intronic
1005929115 6:30467744-30467766 CATTAGAACTCACTGAGTTCAGG + Intergenic
1006364350 6:33606579-33606601 CCTAAGCACTGACTGCATTGTGG + Intergenic
1006606103 6:35259150-35259172 GCTCAGCACTCACTGTCTTACGG - Intronic
1007281750 6:40717899-40717921 CCTGATCACTCACTCTGTTTTGG - Intergenic
1008579380 6:52892102-52892124 CCTTAGCACCCCTTGGGTTGGGG - Intronic
1010716552 6:79236631-79236653 CCTTAGCACTACCTTTGTTGTGG - Intergenic
1011034802 6:82961564-82961586 CCTCAGCAGTCAGTGTGGTGTGG - Intronic
1012597239 6:101054642-101054664 CATGAGAACTCACTGTGGTGAGG + Intergenic
1013187369 6:107771669-107771691 CATTATGACTCTCTGTGTTGAGG + Intronic
1017697219 6:157028857-157028879 TCTTACCATCCACTGTGTTGTGG + Intronic
1018286402 6:162243739-162243761 CCTAAGAACTCACTGAGATGTGG - Intronic
1023727578 7:43160123-43160145 CCTTTGCACTTACTGATTTGTGG + Intronic
1024555261 7:50598285-50598307 CCTTAGAAATCACTGGATTGTGG - Intronic
1024906513 7:54388226-54388248 CAGTAGCACTCTCTGTTTTGGGG + Intergenic
1025796956 7:64746750-64746772 CTATAGCACTCTCTGTTTTGGGG + Intergenic
1030323431 7:108194059-108194081 CCTTATCCCTCACTGTCCTGTGG - Exonic
1032505509 7:132431495-132431517 CCTTCCCTCTCACAGTGTTGGGG - Intronic
1033325414 7:140373826-140373848 CCTTTGAATTCAGTGTGTTGCGG - Intronic
1043060491 8:75495406-75495428 CCTCAGAATTCACTGTGCTGAGG + Intronic
1045260009 8:100564242-100564264 CCTGAGAACCCACAGTGTTGTGG - Intergenic
1052512901 9:29444488-29444510 CATGAGCACTCACTATCTTGAGG - Intergenic
1055093366 9:72385475-72385497 ACTTAGCACTTAGTATGTTGAGG - Intergenic
1055818648 9:80236806-80236828 CCTTCTCACTCACTAAGTTGTGG - Intergenic
1056550374 9:87648581-87648603 GCTTAATACTCACTGTGTGGTGG + Intronic
1056751948 9:89358182-89358204 CTTAAGCACTCACTGTAGTGTGG - Exonic
1057172875 9:92974470-92974492 CCTGAGTGCTCACTGTCTTGGGG - Intronic
1060024403 9:120158782-120158804 CCTGAGGACTCACTGTGTGCAGG + Intergenic
1186804035 X:13121753-13121775 CCTTTGTCCTCACTGTGTAGTGG + Intergenic
1187709509 X:22039583-22039605 CCTTTTCTCTCACTGTCTTGAGG - Intronic
1192811433 X:74550501-74550523 TCTCAGCGCTCACTGTGTAGCGG + Intergenic
1197127405 X:122963652-122963674 ATTGAGCACTCACTGTGTTCAGG + Intergenic
1199812560 X:151365229-151365251 CCTTAGCCCTGCCTGTCTTGGGG - Intergenic
1199863356 X:151821634-151821656 CCTTAGCACTGGCTGTCTTCTGG + Intergenic
1199972648 X:152872303-152872325 CCTGAGCACCCACTATGCTGTGG - Intergenic
1199985892 X:152949922-152949944 CCTTAGCACTGACTGTCCTCTGG - Intronic