ID: 1092291541

View in Genome Browser
Species Human (GRCh38)
Location 12:7162394-7162416
Sequence GCTGGACACAAATGCACTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092291533_1092291541 27 Left 1092291533 12:7162344-7162366 CCTGTTACCAAACCAGAGTCCTG 0: 1
1: 0
2: 0
3: 14
4: 111
Right 1092291541 12:7162394-7162416 GCTGGACACAAATGCACTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 106
1092291537_1092291541 8 Left 1092291537 12:7162363-7162385 CCTGGAAACTCGCTTTTGTGCCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1092291541 12:7162394-7162416 GCTGGACACAAATGCACTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 106
1092291535_1092291541 20 Left 1092291535 12:7162351-7162373 CCAAACCAGAGTCCTGGAAACTC 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1092291541 12:7162394-7162416 GCTGGACACAAATGCACTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 106
1092291536_1092291541 15 Left 1092291536 12:7162356-7162378 CCAGAGTCCTGGAAACTCGCTTT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1092291541 12:7162394-7162416 GCTGGACACAAATGCACTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092291541 Original CRISPR GCTGGACACAAATGCACTGG CGG Intergenic
900926557 1:5709781-5709803 GCTGGAAACCAAGGCACTTGGGG - Intergenic
903237039 1:21956845-21956867 GCTGGACACAGATGCCCTTCGGG - Intergenic
903603689 1:24559659-24559681 GCTGGACACATCTGAACTGTGGG + Intronic
906251196 1:44312217-44312239 GCAGGGCACATCTGCACTGGAGG - Intronic
908208322 1:61873805-61873827 GCTGGAGACCCATGCACTGGGGG + Intronic
910641035 1:89462321-89462343 GCTGGCCACAGAGTCACTGGGGG - Intergenic
913242262 1:116839341-116839363 GCTGGACACATATCCTCAGGGGG - Intergenic
916168435 1:161983168-161983190 GCTGAACAAAAGTGCACTGGGGG + Intergenic
916459850 1:165012166-165012188 TCTGGAAACAAATGCTCTGCTGG + Intergenic
919580923 1:199371851-199371873 GATGGACAAGAATGCACTGAGGG + Intergenic
920371908 1:205484474-205484496 GCTGTCCTCAAATGCCCTGGGGG + Intergenic
920374348 1:205499364-205499386 CCTGGAGACAAGTGCTCTGGAGG - Intergenic
921823030 1:219639497-219639519 GCTGCACTCGAATGCACTGGGGG - Intergenic
923047748 1:230367975-230367997 GCTGGACACCAAGGAGCTGGGGG + Intronic
1063475045 10:6320917-6320939 ACTGGGCAGAAATTCACTGGAGG - Intergenic
1063848907 10:10162326-10162348 TCTGGACACAACGGCACTGATGG + Intergenic
1064989247 10:21241725-21241747 GCTGAACTCAAATGCCCGGGTGG - Intergenic
1065502973 10:26399982-26400004 GCTGGAAGAAAATGCACTTGTGG - Intergenic
1069278415 10:66622340-66622362 GCTTGAATCAAATGCACTGCAGG - Intronic
1072452445 10:95549203-95549225 GCTAGCCACAAATGCTCTGTAGG - Intronic
1073248505 10:102107795-102107817 GATGGAGGCAAATGCCCTGGGGG + Exonic
1077872924 11:6278700-6278722 GCTGGAAAGAAATGAACTGGTGG + Intergenic
1079885675 11:25985901-25985923 GCTGCACCCAAATGAACTTGGGG - Intergenic
1080889170 11:36394276-36394298 GCTAGACACAGGTGCAGTGGAGG - Intronic
1087390916 11:97533137-97533159 GATGGACACATATACAATGGAGG - Intergenic
1088598802 11:111458005-111458027 GCTGGACACCAATGTGCTAGTGG + Intronic
1089077574 11:115750709-115750731 GCTGGAGACCAATGCGGTGGAGG - Intergenic
1091988359 12:4932850-4932872 TTTGGACACAAACGCACAGGGGG - Intergenic
1092291541 12:7162394-7162416 GCTGGACACAAATGCACTGGCGG + Intergenic
1098359581 12:69641687-69641709 GCTGCAGAGAACTGCACTGGTGG + Intergenic
1102257493 12:111424720-111424742 CCTGGACACAGATTCACTGAGGG - Intronic
1102260550 12:111440662-111440684 GGTGGAGAAAAAGGCACTGGAGG - Intronic
1102491597 12:113292797-113292819 GCAGGACACCAATGCAGTGTCGG + Intronic
1107621128 13:42231802-42231824 GCTAGCCAGAAATGCACTGTAGG - Intronic
1108346631 13:49552859-49552881 GCTGGACACAACTGCGGTAGTGG + Intronic
1112902480 13:104374853-104374875 ACTGTACACAAATACACTGAAGG + Intergenic
1114479750 14:23025364-23025386 CCTCCACACATATGCACTGGAGG + Intronic
1117667337 14:58070306-58070328 GGTGGGCCCAAATACACTGGGGG + Intronic
1117983792 14:61367630-61367652 GCAGGACACAAATCCACTCTGGG - Intronic
1125074640 15:35599321-35599343 GATGGGCACAAATTCACAGGGGG - Intergenic
1130900650 15:88204772-88204794 ACTGGACAAATATTCACTGGGGG + Intronic
1132392717 15:101450655-101450677 GCTGGACACAGATGGGATGGGGG - Intronic
1132750662 16:1455956-1455978 GCTGGACCCAAGTACACTGCCGG + Intronic
1137595256 16:49719325-49719347 GCTATACACTAATACACTGGGGG + Intronic
1138751834 16:59431611-59431633 GATGGACACAGAAGAACTGGAGG + Intergenic
1138810006 16:60139001-60139023 ACTGAAGGCAAATGCACTGGGGG - Intergenic
1144773993 17:17775115-17775137 GCTGCACACAAAGGCACTCCTGG - Intronic
1146184810 17:30717790-30717812 ACTGGTCACAAGTGCAATGGAGG - Intergenic
1151548943 17:74810238-74810260 GCTGGCCTCTAATGCACAGGGGG + Intronic
1161042715 19:2118538-2118560 ACTGGACAGAAAGGCACTGAGGG + Intronic
1162973972 19:14197905-14197927 ACTGGTCACAAGTGCAATGGAGG + Intronic
1165299151 19:34957211-34957233 GCTGTTCCCACATGCACTGGAGG + Exonic
1165550525 19:36580524-36580546 GATGGACACATATACAATGGTGG - Intronic
925034171 2:673350-673372 GCTGGAGGCAAAGGCACGGGAGG + Intronic
925409780 2:3633236-3633258 CCTGGGCACAGATGCACTTGGGG + Intronic
927113223 2:19878906-19878928 GCTGGGCGCAAATCCTCTGGAGG - Intergenic
927458170 2:23275369-23275391 GCAGGCCACAGATGCACTGGAGG - Intergenic
929449070 2:42024717-42024739 GCTGGCCACAAATGAACCTGGGG + Intergenic
933938100 2:87223331-87223353 GTTAGATAGAAATGCACTGGTGG - Intergenic
935939717 2:108225501-108225523 TTTGGACACAAATGCACAGAAGG - Intergenic
937061261 2:118982073-118982095 GCTGAAAACAGAAGCACTGGGGG + Intronic
937339460 2:121081868-121081890 GCTGGACACAAACAGCCTGGGGG - Intergenic
938313915 2:130313703-130313725 CCTGAACTCAAATGGACTGGAGG + Intergenic
947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG + Intronic
1168973841 20:1949476-1949498 GTTGGACACAAGTGGAATGGAGG - Intergenic
1173530684 20:43767045-43767067 GCTGGGCACACATGTCCTGGCGG + Intergenic
1174466838 20:50724436-50724458 GCTGGAGCCATATGGACTGGAGG + Intergenic
1178484073 21:33005980-33006002 ACTGGACCCAAATGCACAGAGGG - Intergenic
1183638367 22:39078435-39078457 GCTGGGGACAAATGGAGTGGGGG - Intronic
949483666 3:4517378-4517400 GCTGGACTCAAATAAATTGGGGG + Intronic
953032077 3:39185831-39185853 GCTGCACACAGATGGCCTGGGGG - Exonic
955080533 3:55654298-55654320 GCAGGACACAAATCCAGTGTTGG + Intronic
959829202 3:110840167-110840189 GCTGGACCTGAAAGCACTGGAGG + Intergenic
963729512 3:148957811-148957833 GCAGGACTCAAAGGAACTGGAGG + Intergenic
968762246 4:2448766-2448788 TCTGGTCACACATCCACTGGAGG + Intronic
969291431 4:6242529-6242551 GCTGGTCAGAAACGCACTAGTGG - Intergenic
969820889 4:9719513-9719535 GCTGGACTCCCATGCACTGCGGG + Intergenic
970359317 4:15292509-15292531 TCTGGAAACAAATGCACAGGGGG - Intergenic
973189700 4:47372967-47372989 GCTGGACCCACATGCCCTGCAGG + Intronic
975096255 4:70460706-70460728 GCTGGACCAAAAGGCACTGCAGG - Intronic
977427538 4:96887360-96887382 TCTTAACACAATTGCACTGGGGG + Intergenic
979643627 4:123040386-123040408 GCTGGACCAAAATACACTGCAGG - Intronic
982426646 4:155270622-155270644 GCTGAAAACAAATTTACTGGAGG - Intergenic
982661791 4:158216204-158216226 GGTGAACAGAAATGCTCTGGTGG - Intronic
986270715 5:6228382-6228404 GCTGGACACACGTTCACTGGTGG - Intergenic
995105333 5:108371012-108371034 CCTGTACAGAAATGCACAGGAGG + Intronic
998174114 5:139890869-139890891 ACTGAACACATATGCACAGGTGG + Intronic
1001274579 5:170341072-170341094 ACTGGACACAAGTGGACTTGAGG - Intergenic
1001981983 5:176044162-176044184 GCTGGACACAAAGTCACAGGTGG - Intergenic
1002235481 5:177799895-177799917 GCTGGACACAAAGTCACAGGTGG + Intergenic
1010154995 6:72782167-72782189 GCTGGACATAAATGCATTTGAGG + Intronic
1012565351 6:100642201-100642223 GCAGGACACAAACTCACTTGAGG + Intronic
1014644852 6:123960298-123960320 ACTGGGCACAAATGCAATGGTGG - Intronic
1018231649 6:161681682-161681704 GCTGGCCACACACTCACTGGAGG + Intronic
1021146381 7:17094228-17094250 ACTGGACACAAATGCATGTGAGG + Intergenic
1022952745 7:35354083-35354105 GCTGGAGAGAAGTGCACTCGAGG + Intergenic
1023819201 7:43970959-43970981 GCGGGACACAAAGGCTCTGATGG + Intergenic
1024557682 7:50617489-50617511 GCTGGGCACAGAGGCCCTGGTGG + Intronic
1029744252 7:102507922-102507944 GCGGGACACAAAGGCTCTGATGG + Intronic
1029762243 7:102607084-102607106 GCGGGACACAAAGGCTCTGATGG + Intronic
1033472383 7:141661709-141661731 TCTGGACACGAATTCTCTGGAGG - Exonic
1033560743 7:142528114-142528136 GCTGGACACACATCCCCTAGTGG + Intergenic
1036642264 8:10591907-10591929 GCTGGACACAGATGCACTCACGG - Intergenic
1038698401 8:29826856-29826878 GCTGAGCAGAAATGCAGTGGTGG + Intergenic
1040516581 8:48140469-48140491 GCTGCACTCGAATGCACTGGGGG - Intergenic
1040877995 8:52173413-52173435 CCTGGACAGACAGGCACTGGGGG - Intronic
1049309532 8:141926050-141926072 TTTTGATACAAATGCACTGGAGG - Intergenic
1051131190 9:13862774-13862796 GCTGCACACAAAATCACTGTGGG - Intergenic
1052867484 9:33473460-33473482 ACTGGACACAAATTCTGTGGAGG + Intronic
1053446976 9:38159998-38160020 TCTGCCCACAAATGTACTGGTGG - Intergenic
1057720416 9:97527748-97527770 GCTGGGGACACATGGACTGGAGG + Intronic
1057830615 9:98403375-98403397 GCTGGACACAAATGCAGAGAGGG + Intronic
1059292313 9:113237258-113237280 GCAGGACACAACTGCTCTGGAGG + Intronic
1060739485 9:126088897-126088919 GCTGGACACATATGCATTGGAGG - Intergenic
1060786350 9:126454364-126454386 GCTGAACACAAATGAATTAGGGG - Intronic
1062052690 9:134455773-134455795 GCTGGGCACAAACGCCGTGGGGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1187356512 X:18577844-18577866 GATGGTCCCAAATGCACAGGTGG - Intronic
1190968802 X:55329196-55329218 GTTGGATACAAATGAACTGGAGG - Intergenic
1194329252 X:92560646-92560668 GCTGAACACCCATGAACTGGCGG + Intronic
1199875434 X:151924282-151924304 CCTGGGCACAATTGCAATGGAGG + Exonic
1200138239 X:153885285-153885307 GATGGACACCCATGCACGGGAGG + Intronic
1200352683 X:155515595-155515617 GATGGACACATATGTACTGTTGG - Intronic
1200761356 Y:7042171-7042193 ACTGAACCCAAGTGCACTGGGGG - Intronic