ID: 1092292112

View in Genome Browser
Species Human (GRCh38)
Location 12:7166602-7166624
Sequence CAATTTTTCCAGAGACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092292112_1092292118 11 Left 1092292112 12:7166602-7166624 CCCTCCAGTCTCTGGAAAAATTG No data
Right 1092292118 12:7166636-7166658 ACTGATCCCTGGTGCCAAAAAGG 0: 33
1: 477
2: 902
3: 1273
4: 1124
1092292112_1092292123 25 Left 1092292112 12:7166602-7166624 CCCTCCAGTCTCTGGAAAAATTG No data
Right 1092292123 12:7166650-7166672 CCAAAAAGGTTGGTGACCACTGG No data
1092292112_1092292119 15 Left 1092292112 12:7166602-7166624 CCCTCCAGTCTCTGGAAAAATTG No data
Right 1092292119 12:7166640-7166662 ATCCCTGGTGCCAAAAAGGTTGG 0: 72
1: 1049
2: 1760
3: 1411
4: 1000
1092292112_1092292115 0 Left 1092292112 12:7166602-7166624 CCCTCCAGTCTCTGGAAAAATTG No data
Right 1092292115 12:7166625-7166647 TCCTCCATGAAACTGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092292112 Original CRISPR CAATTTTTCCAGAGACTGGA GGG (reversed) Intergenic
No off target data available for this crispr