ID: 1092293234

View in Genome Browser
Species Human (GRCh38)
Location 12:7177820-7177842
Sequence TTCTTACAGCCTCATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092293229_1092293234 -1 Left 1092293229 12:7177798-7177820 CCCACCTCGGTATTGGGGTGTCT No data
Right 1092293234 12:7177820-7177842 TTCTTACAGCCTCATGAGGGAGG No data
1092293224_1092293234 16 Left 1092293224 12:7177781-7177803 CCTCGGTTTTAGGGGTACCCACC No data
Right 1092293234 12:7177820-7177842 TTCTTACAGCCTCATGAGGGAGG No data
1092293231_1092293234 -5 Left 1092293231 12:7177802-7177824 CCTCGGTATTGGGGTGTCTTCTT No data
Right 1092293234 12:7177820-7177842 TTCTTACAGCCTCATGAGGGAGG No data
1092293230_1092293234 -2 Left 1092293230 12:7177799-7177821 CCACCTCGGTATTGGGGTGTCTT No data
Right 1092293234 12:7177820-7177842 TTCTTACAGCCTCATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092293234 Original CRISPR TTCTTACAGCCTCATGAGGG AGG Intergenic
No off target data available for this crispr