ID: 1092293641

View in Genome Browser
Species Human (GRCh38)
Location 12:7181266-7181288
Sequence TGGTGATCAGCAATGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092293641_1092293650 24 Left 1092293641 12:7181266-7181288 CCGTCCACCATTGCTGATCACCA No data
Right 1092293650 12:7181313-7181335 CCACCCCTCCGGATCTGGCAGGG 0: 13
1: 54
2: 111
3: 168
4: 227
1092293641_1092293647 19 Left 1092293641 12:7181266-7181288 CCGTCCACCATTGCTGATCACCA No data
Right 1092293647 12:7181308-7181330 GACTTCCACCCCTCCGGATCTGG 0: 31
1: 87
2: 117
3: 65
4: 76
1092293641_1092293648 23 Left 1092293641 12:7181266-7181288 CCGTCCACCATTGCTGATCACCA No data
Right 1092293648 12:7181312-7181334 TCCACCCCTCCGGATCTGGCAGG 0: 15
1: 49
2: 110
3: 147
4: 224
1092293641_1092293646 13 Left 1092293641 12:7181266-7181288 CCGTCCACCATTGCTGATCACCA No data
Right 1092293646 12:7181302-7181324 GCTGCTGACTTCCACCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092293641 Original CRISPR TGGTGATCAGCAATGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr