ID: 1092295488

View in Genome Browser
Species Human (GRCh38)
Location 12:7194589-7194611
Sequence GGGGATTCCATTACAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092295488_1092295491 -4 Left 1092295488 12:7194589-7194611 CCTTATTTTGTAATGGAATCCCC 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1092295491 12:7194608-7194630 CCCCCCGTCTTAAATCTTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1092295488_1092295489 -5 Left 1092295488 12:7194589-7194611 CCTTATTTTGTAATGGAATCCCC 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1092295489 12:7194607-7194629 TCCCCCCGTCTTAAATCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092295488 Original CRISPR GGGGATTCCATTACAAAATA AGG (reversed) Intronic
905242647 1:36590805-36590827 TAGGTTTCAATTACAAAATAAGG + Intergenic
910777047 1:90887371-90887393 GGGGATTACATTTCAACATGAGG - Intergenic
912677710 1:111700548-111700570 GGGGATTACATTTCAGCATAAGG + Intronic
912748901 1:112269141-112269163 GGGTATTAGATTCCAAAATATGG - Intergenic
912888708 1:113504075-113504097 GGAGATTTCTTAACAAAATACGG + Intronic
917002215 1:170372797-170372819 GGGCATTCAATTACAAAAAGAGG - Intergenic
919096661 1:193045314-193045336 GGGGATTACATTTCAACATGAGG - Intronic
923287115 1:232507076-232507098 GGACATTCCATTAAAAACTAAGG - Intronic
1063460609 10:6212938-6212960 GTGGATTCCAATACAACATGGGG - Intronic
1063835708 10:10009388-10009410 GGGCATTCCATGAGAAAAAAGGG - Intergenic
1064586979 10:16849198-16849220 GGGGATTCTTTTACAAAGCATGG - Intronic
1067236803 10:44458040-44458062 TGGGATTCCAGTACAGAAAAAGG + Intergenic
1072616626 10:97053888-97053910 GGGGATTACATTTCAACATGAGG - Intronic
1076526584 10:131116077-131116099 TTGGATTTCCTTACAAAATAAGG - Intronic
1077784080 11:5363764-5363786 GAGGATTCTATTAAAAACTAGGG + Intronic
1078733691 11:14000317-14000339 GGGTATTGCTTTATAAAATATGG - Intronic
1081479288 11:43470020-43470042 GAGGATGGCTTTACAAAATATGG + Intronic
1081950003 11:47037144-47037166 AGGGCTTCCATGGCAAAATATGG + Intronic
1082711853 11:56561978-56562000 GGGGATTACAATTCAATATAAGG - Intergenic
1084498251 11:69518312-69518334 GGGGATTGCATTTCAACATGAGG - Intergenic
1086044655 11:82518733-82518755 GGGTATTCAATTAGAAAACAGGG - Intergenic
1086601914 11:88643403-88643425 GGGGATTCCAATTCAACATGAGG + Intronic
1086927987 11:92661406-92661428 GGAGATTCCATTACCATATGTGG + Intronic
1087169112 11:95032345-95032367 GGGGACACAATTACAAAATGGGG + Intergenic
1087610211 11:100425105-100425127 GGGCATTCCATTAGGAAATGAGG + Intergenic
1090533229 11:127612877-127612899 GGGGATTGCATTTCAACATGAGG + Intergenic
1091495823 12:972058-972080 GGGGAATTAATCACAAAATATGG + Intronic
1091889172 12:4039400-4039422 GGGCATTCCATTAGTTAATACGG + Intergenic
1092295488 12:7194589-7194611 GGGGATTCCATTACAAAATAAGG - Intronic
1093011713 12:14113912-14113934 GGGTATTCAATTACGAAATGAGG + Intergenic
1095677419 12:44935870-44935892 GGGTATTCCATTAGGAAATGAGG + Intergenic
1097291274 12:57917604-57917626 GGAGATTCCAATACAGAATGGGG + Intergenic
1097431640 12:59515555-59515577 GGGAATACCTTTACACAATAAGG + Intergenic
1098198083 12:68023636-68023658 AGGGTTGCCATAACAAAATAAGG + Intergenic
1100119422 12:91351670-91351692 GGGGATTGCATTTCAACATGAGG - Intergenic
1100692606 12:97054394-97054416 GGGGATTACATTTCAACATGAGG + Intergenic
1101193434 12:102358428-102358450 GGGGATTACATTTGAATATAAGG + Intergenic
1101282456 12:103272573-103272595 AGGGAGTGCATTAGAAAATAAGG - Intronic
1102621540 12:114199697-114199719 TGGGATTCCATTCCTACATATGG + Intergenic
1102637087 12:114333983-114334005 GAGGAGTCCTTTATAAAATATGG + Intergenic
1108298087 13:49045163-49045185 TGAGATTCCATTAAAAAAGAAGG - Intronic
1109532178 13:63664414-63664436 GGGGATTCCATTGTAACAAATGG - Intergenic
1110309112 13:74026486-74026508 GGTTCTTCTATTACAAAATAAGG + Intronic
1111102356 13:83605067-83605089 AGGGATCCCATTTCAATATAAGG - Intergenic
1111715133 13:91869973-91869995 GGGGATTACAGTTCAACATAAGG + Intronic
1112368569 13:98775404-98775426 GGGGATTCCTTTGCACAGTAGGG - Intergenic
1112657489 13:101467179-101467201 GGGGATTAGGTTCCAAAATATGG + Intronic
1115774022 14:36695871-36695893 GGGTATTCAATTAGAAAATGAGG - Intronic
1115807477 14:37067921-37067943 AGTGATTCTATTACAAAATTAGG + Intronic
1116790159 14:49330902-49330924 GGGGATTCAATTTCAACATATGG + Intergenic
1118046382 14:61975745-61975767 GGGGATTACAATTCAAAATGAGG + Intergenic
1118226676 14:63907033-63907055 GGGGATTAGATTTCAACATATGG + Intronic
1128602437 15:69008965-69008987 GTGGAGTCCATTAAGAAATAGGG + Intronic
1130737125 15:86562118-86562140 GGGTATTCCATTAGGAAAAAAGG - Intronic
1130776771 15:86992316-86992338 GGGGATTACATTTCAACATGAGG + Intronic
1131457147 15:92590439-92590461 TGGGATTCTAGTACAAAATGTGG - Intergenic
1131771826 15:95746150-95746172 GGGAATTCCATTTCAACATGAGG + Intergenic
1131929560 15:97425503-97425525 GGGAAATCCATGAAAAAATATGG + Intergenic
1135587423 16:23681428-23681450 GGTGATTCCCTTGCACAATAAGG + Intronic
1137533733 16:49301164-49301186 GTGGGTTCCTTTACAGAATATGG + Intergenic
1138830738 16:60371773-60371795 GGGGATTCAATTACAAGCTGTGG + Intergenic
1139303584 16:65964781-65964803 GGGAAGTCCCTTACAAAATCTGG - Intergenic
1140178872 16:72693986-72694008 GGGTATTCAATTACAAAAAGAGG - Intergenic
1141375917 16:83530690-83530712 CAGTCTTCCATTACAAAATAAGG - Intronic
1146088858 17:29856009-29856031 TGGGCTTCCATTACAAGATGAGG + Intronic
1153254381 18:3156013-3156035 GGGGATCCCATTTCATAAAAAGG - Intronic
1156190591 18:34715614-34715636 GGCAATTCCAGTATAAAATATGG + Intronic
1156639326 18:39071187-39071209 ATGAATTCCATTACAACATAAGG - Intergenic
1156794488 18:41026724-41026746 GGGGATTAAATTACAATATGAGG - Intergenic
1158645863 18:59246454-59246476 GAGGATTACATTTCAATATATGG + Intergenic
1158753817 18:60298599-60298621 GGGGATTAAGTTTCAAAATATGG + Intergenic
1163169848 19:15523512-15523534 GGGGATTCCAGTTCAACATGAGG + Intronic
1164597332 19:29538904-29538926 GGGGATCACATTTCAACATAAGG + Intronic
1164660098 19:29956710-29956732 TGGGCTTCCATTACAAGATGAGG - Intronic
925793612 2:7519152-7519174 GGAGTTTACATTAGAAAATAAGG + Intergenic
926527577 2:14000711-14000733 TGTGATTGCATTACAAGATAAGG + Intergenic
926651867 2:15355543-15355565 GGGGATTACATTTCAACATGAGG - Intronic
928792432 2:34973753-34973775 TGGTGTTCCATTACACAATAGGG + Intergenic
929185712 2:39091743-39091765 GGGGATGCCATTCTATAATACGG + Intronic
929996459 2:46829150-46829172 TGGGCTGCCATAACAAAATATGG - Intronic
930109995 2:47670480-47670502 GGGAATTTCATCCCAAAATATGG - Intergenic
932200117 2:69819015-69819037 TGGTATTTCATTTCAAAATAAGG - Intronic
935403069 2:102680776-102680798 GGAGATTCCATTAGAATATCTGG + Intronic
935718108 2:105956303-105956325 AGAGATTTCATTACAAAAAAGGG + Intergenic
939040673 2:137185617-137185639 GTGGATTGCATTAAAAAATGCGG - Intronic
942534407 2:176948327-176948349 GGGGATGCTACCACAAAATATGG + Intergenic
943711173 2:191096797-191096819 GGGGATTCAATTAGGAAAAAAGG + Intronic
943933451 2:193885013-193885035 GGAGATTCCGATTCAAAATAGGG + Intergenic
944476268 2:200110099-200110121 GGGCATTCTGTTACAAAATGAGG - Intergenic
945283556 2:208060205-208060227 GGGGATTACATTTCAACATGAGG + Intergenic
945715737 2:213355828-213355850 GGGGATTCGATTAGAAAAAGAGG - Intronic
946812490 2:223540841-223540863 GGGGATTACATTTCAACATGAGG - Intergenic
1171146956 20:22793166-22793188 GGGGATTACAATTCAAAATAAGG - Intergenic
1171877748 20:30594161-30594183 GTGGATGCCATAACAATATATGG - Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1174903688 20:54527435-54527457 GTGGATGCCATAACAATATATGG - Intronic
1177145369 21:17401550-17401572 GGGGAATCAAATAGAAAATAAGG + Intergenic
1177179948 21:17734274-17734296 GGGGATTACATTTCAACATGAGG + Intergenic
1177524311 21:22272329-22272351 GGGTATTCAATTAGAAAATGAGG - Intergenic
1180579709 22:16820922-16820944 GGGTATTCTATCACAAAAGAGGG - Intronic
1181940651 22:26473317-26473339 CTGGATTCCATTACAAACAATGG + Intronic
1182953494 22:34399199-34399221 GGGGATTCCATTTCTACATGAGG - Intergenic
1185302752 22:50091010-50091032 GTGGATTCCATTCCCACATAAGG - Intronic
950270291 3:11609426-11609448 GGAGATTTCATTAAAAAACAAGG + Intronic
950751498 3:15132422-15132444 GGTGAATCCATTTAAAAATAGGG - Intergenic
953691185 3:45120987-45121009 GGGGCTACCACTAAAAAATACGG - Intronic
955455900 3:59121584-59121606 GGGGATTGCAATTCTAAATAGGG + Intergenic
956139777 3:66134248-66134270 AGGGCTAACATTACAAAATAAGG - Intronic
956224441 3:66940449-66940471 GGACATGCCATTCCAAAATATGG + Intergenic
956895697 3:73657747-73657769 GGAGATTTCATTACATTATATGG - Intergenic
957624192 3:82637875-82637897 GAGGATTAAATTACATAATAAGG + Intergenic
958674103 3:97244001-97244023 GTGGGCTCCATTCCAAAATAAGG - Exonic
959827500 3:110816021-110816043 GGGGAATCCAGTAGAAAAGAGGG + Intergenic
961095682 3:124154288-124154310 GGGTATTCAATTACAAAAACAGG + Intronic
961575231 3:127830592-127830614 GGGGATTACAGTTCAAAATGAGG - Intergenic
973112061 4:46408827-46408849 GGGTATTCAATTAGAAAAAAAGG + Intronic
973131425 4:46653258-46653280 GGGAATTACAATTCAAAATAAGG + Intergenic
974540433 4:63226312-63226334 GGAGATCACATTTCAAAATACGG - Intergenic
975179281 4:71325232-71325254 TTGGATTCCATTAAAAAAAAAGG + Intronic
977457734 4:97282769-97282791 GGGTATTCAATTACAAAAAGAGG + Intronic
977723110 4:100263766-100263788 GGGAATCCCATTATTAAATAGGG + Intergenic
979887813 4:126052466-126052488 AGGAATTCCAATAGAAAATAGGG + Intergenic
980882316 4:138724417-138724439 GAGGATTCTATTTCAAAACACGG + Intergenic
981119213 4:141029666-141029688 GGGAATTCCTTTACAAATTATGG + Intronic
981135108 4:141201855-141201877 GGGGATTCTGTTCCAACATATGG - Intronic
982434026 4:155361068-155361090 GGTGATCCCATTCCAAAATGTGG - Intronic
984277783 4:177630982-177631004 GTGTATTCCAATACTAAATAGGG - Intergenic
984420348 4:179513377-179513399 AGGGCTTCTATTACACAATAAGG + Intergenic
985195935 4:187429239-187429261 GGGGATCCCATTTCAATATTTGG + Intergenic
985222533 4:187723204-187723226 CTGGATTCCAGTACAAAGTATGG + Intergenic
987308210 5:16658204-16658226 GGGGATTACATTTCAACATGGGG + Intergenic
987314455 5:16711269-16711291 TGGGATACCATTAGAAAAAATGG + Intronic
987939171 5:24510094-24510116 GGTGGTACCATTACAAAAAATGG + Intronic
988659023 5:33244170-33244192 ATGGATTCCATTACATAATTGGG - Intergenic
989645942 5:43632718-43632740 GGGGCTACCATTAAAAAGTAAGG + Intronic
989785012 5:45316591-45316613 GGGTATTCAATTACAAAAAGAGG + Intronic
990015350 5:51054786-51054808 GGTGATTTCATTACAAGATTGGG - Intergenic
990679001 5:58220067-58220089 GGGCATTCAATTACAAAAACAGG + Intergenic
992822394 5:80510598-80510620 GGGGATTCAATTAGATATTAAGG - Intronic
993059430 5:83021224-83021246 TGGGATTCAATTTCAAAATGAGG + Intergenic
995182567 5:109242307-109242329 GGGAATTCTATTATAGAATAAGG + Intergenic
995750599 5:115449834-115449856 GGGGCTTCCAAGACAAACTAAGG - Intergenic
998873945 5:146580503-146580525 GGGGATCCATTTACAAATTAAGG - Intergenic
1000882474 5:166714071-166714093 GGGGATTAAATTTCAAAATAAGG + Intergenic
1002008597 5:176257644-176257666 GGGGATTACAATTCAACATATGG + Intronic
1002218126 5:177654607-177654629 GGGGATTACAATTCAACATATGG - Intergenic
1005135093 6:22559237-22559259 GGGGATTAGATTTCAACATATGG - Intergenic
1005919105 6:30382768-30382790 GGGGATTACATTTCAACATGAGG + Intergenic
1007200724 6:40106349-40106371 GCGGCTACCTTTACAAAATAAGG - Intergenic
1008088930 6:47273689-47273711 GGGTATTCAATTACGAAATGAGG + Intronic
1008193910 6:48494738-48494760 GGGTATTCAATTACGAAAAAAGG + Intergenic
1010503049 6:76624801-76624823 GGGTATTCAATTACAAAAAGAGG - Intergenic
1011593971 6:88998104-88998126 GTGGACCCCATTAAAAAATAAGG - Intergenic
1012016415 6:93857725-93857747 GTGCATTCCATGACAAATTAAGG + Intergenic
1012617159 6:101291409-101291431 GGGGCTGCCATAACAACATATGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1015520808 6:134129739-134129761 GGGGATCACATTTCAAAATGAGG - Intergenic
1016530697 6:145055480-145055502 GGAGATTCCATTACAGATTTGGG + Intergenic
1016930624 6:149403922-149403944 GGGGATTACATTTCAATATAAGG + Intronic
1017523285 6:155220680-155220702 GGGATTTGCATTACAAACTAGGG + Intronic
1024403219 7:48948661-48948683 GGGGATTACATTTCAACATGAGG + Intergenic
1026334679 7:69383535-69383557 GGGGATTACATTTCAATATGAGG - Intergenic
1028423372 7:90658492-90658514 GGGGATTAGATTACAACATACGG + Intronic
1028860589 7:95645994-95646016 GGGGAGTGCAATATAAAATAAGG - Intergenic
1030353649 7:108519662-108519684 GGGAATTCTACCACAAAATATGG + Intronic
1031284262 7:119843964-119843986 GGAAATTGCATTTCAAAATAAGG - Intergenic
1032839835 7:135704977-135704999 GGAGATTCTATTTCAAAATGTGG - Intronic
1038219530 8:25594225-25594247 TGGTATTCTATTAGAAAATAAGG - Intergenic
1041335466 8:56777296-56777318 CGGGATTCCCTTCCAGAATAAGG + Intergenic
1042627862 8:70778912-70778934 GGGTATTCCATTAGGAAAAAAGG - Intronic
1043244055 8:77975703-77975725 GGGTATTCAATTAGGAAATAAGG - Intergenic
1044105759 8:88204295-88204317 AGGGATAGCATTACAAAATAAGG + Intronic
1046241948 8:111507922-111507944 TGGTATTCTATTACAAAGTAGGG + Intergenic
1048637360 8:136311730-136311752 GGGGATTACATTTCAACATAAGG + Intergenic
1048771288 8:137898199-137898221 TGGGTTTCCAATACAAAATGTGG + Intergenic
1050670304 9:7989246-7989268 GGGGATTACATTTCAACATGAGG + Intergenic
1052217688 9:25986750-25986772 GGGTATTCAATTAGAAAATGAGG + Intergenic
1052610742 9:30770246-30770268 AGGGATTCCATTAAAATATATGG - Intergenic
1053026529 9:34733961-34733983 AGAGATTCAACTACAAAATAGGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1054890359 9:70244473-70244495 GGGTATTCAATTAGGAAATAAGG + Intergenic
1055332334 9:75197270-75197292 GGGGATTAAATTTCAACATAAGG + Intergenic
1056543439 9:87593836-87593858 GGGGATTACATGACAAAGTCAGG + Intronic
1056753450 9:89367955-89367977 GTGGATGTGATTACAAAATATGG + Intronic
1058728232 9:107824047-107824069 GGAAGTTCCATTGCAAAATAAGG - Intergenic
1185957374 X:4506147-4506169 GGGGATTCAATTTCAACATGAGG + Intergenic
1188396580 X:29691956-29691978 GGACATTCCATTCCCAAATATGG - Intronic
1188402099 X:29758297-29758319 GAGAATTACATTACAAAATATGG + Intronic
1188871316 X:35376662-35376684 GTGGTTTCCAGTGCAAAATAAGG + Intergenic
1190479835 X:50865176-50865198 AGGCATTCCTTTCCAAAATATGG - Intergenic
1193271373 X:79533486-79533508 GGGAAGTCCATCACAAAAAAAGG - Intergenic
1195042143 X:101024357-101024379 AGGGCTGCCATTACAAAATACGG - Intronic
1196015372 X:110934271-110934293 GGGGCTTACATTTCAACATAAGG - Intergenic
1196288008 X:113905241-113905263 GGGGATCCAATTTCAACATAAGG - Intergenic
1196817293 X:119675513-119675535 GGAAATTCTATTACAGAATATGG - Intronic
1197032185 X:121829957-121829979 GGGGATGCCATTACTGAATAGGG + Intergenic
1197966907 X:132073902-132073924 GGGGTTTTCATTAAAATATAAGG - Intergenic
1199329087 X:146537521-146537543 GGGAATTCCACTTCAGAATATGG + Intergenic