ID: 1092296247

View in Genome Browser
Species Human (GRCh38)
Location 12:7201345-7201367
Sequence ACATATCAGCTATATTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092296247 Original CRISPR ACATATCAGCTATATTTGGG AGG Intronic
900981928 1:6050716-6050738 TCATTTCAGCTATATTTCAGTGG + Intronic
902871635 1:19317231-19317253 ACACAACAGCTGTATGTGGGAGG + Intronic
906317674 1:44798785-44798807 AGATATCAGAGCTATTTGGGAGG + Intergenic
908130556 1:61071034-61071056 ACATGTATGGTATATTTGGGAGG + Intronic
909047723 1:70730148-70730170 ACTTATCAGCTATTCATGGGGGG - Intergenic
909127682 1:71695196-71695218 AGATATCAGTTATATATGTGTGG + Intronic
911283295 1:95958293-95958315 ACAGATCAGCTAGTTTTGGAGGG + Intergenic
916035605 1:160919921-160919943 ACATATCAGCTAAATTTAAAGGG - Intergenic
916622514 1:166515836-166515858 ACATCTGAGCTATATTTGGAAGG + Intergenic
917378115 1:174373077-174373099 ACATATGAGGTACATTTAGGTGG - Intronic
923814729 1:237364499-237364521 ATATATCAGCTATATATATGTGG + Intronic
923878573 1:238077164-238077186 ACATACAAGCTTTATTTAGGTGG - Intergenic
1063912334 10:10844138-10844160 ACAGATAAGCTCTATTTGTGAGG - Intergenic
1068267940 10:54678775-54678797 ACATAACATCTATATATGGCAGG + Intronic
1070093615 10:73313924-73313946 ACCTATCAGTTATAATTGGAAGG + Intronic
1074616210 10:115070885-115070907 AAATATATGCTGTATTTGGGGGG + Intergenic
1075207426 10:120459060-120459082 ACATCTCATAAATATTTGGGGGG - Intronic
1075445466 10:122509804-122509826 ACATTCCAGATATATATGGGGGG + Intronic
1075641679 10:124069372-124069394 CCATATCACCAATAGTTGGGGGG - Intronic
1081253218 11:40861166-40861188 TCATCTCAGCTATATTTTGAGGG - Intronic
1081653003 11:44838006-44838028 AAATCTCATCAATATTTGGGTGG - Intronic
1089474363 11:118746456-118746478 AAAAATCAACTATATTTGTGTGG + Intergenic
1092296247 12:7201345-7201367 ACATATCAGCTATATTTGGGAGG + Intronic
1093259757 12:16920967-16920989 AAATATCAGAAATATTTGTGTGG + Intergenic
1094263874 12:28532275-28532297 ACATATTAGCAATATTTGATAGG - Intronic
1096359394 12:50970185-50970207 ACATTTCACCAATATTTTGGTGG + Intronic
1096820181 12:54227706-54227728 ACATTTCAGCTATTCTTGGTAGG - Intergenic
1097244976 12:57602815-57602837 ACACATCAACTATCTTTGGAGGG - Exonic
1097695825 12:62774019-62774041 ACATATCACTTAGGTTTGGGGGG - Intronic
1098727718 12:73989626-73989648 TAATCTCAGCTATACTTGGGAGG + Intergenic
1102073739 12:110043555-110043577 ACAAATCTGCTATGTTTGGCTGG + Intronic
1104331910 12:127854945-127854967 ACTTATCAGCTATACCTGTGCGG - Intergenic
1105320490 13:19315580-19315602 ACATATCAGCTATTTTATGAAGG + Intergenic
1106633932 13:31507097-31507119 ACATATGACCTTCATTTGGGTGG + Intergenic
1107467032 13:40660460-40660482 AGATAGCAGCTGTATTTGGCTGG - Intronic
1111364069 13:87218152-87218174 ACATTTCATCTATATTTGGAAGG - Intergenic
1113993347 14:16046093-16046115 ATATATCTGCTTTATTTGAGTGG + Intergenic
1114033211 14:18594467-18594489 AAATATCTGCAATATCTGGGGGG + Intergenic
1114078005 14:19173664-19173686 AAATATCTGCAATATCTGGGGGG + Intergenic
1114125730 14:19723298-19723320 AAATATCTGCAATATCTGGGGGG - Intronic
1117649686 14:57890285-57890307 ACACTTCAGCTAGATTTGGCAGG - Intronic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1121852957 14:97239390-97239412 GCATATCAGCTCTTTCTGGGAGG - Intergenic
1124867818 15:33510653-33510675 ACATATCATGTATATTTGACAGG + Intronic
1125770888 15:42165089-42165111 ACACATCATCCATGTTTGGGAGG - Exonic
1126992843 15:54402838-54402860 AAATATCAGAAATATTTGGAAGG - Intronic
1131726893 15:95235968-95235990 ACATATCATTTTTATTGGGGTGG + Intergenic
1135754753 16:25087653-25087675 ACATATTTGCTATCCTTGGGTGG - Intergenic
1136912709 16:34157807-34157829 ATATATCTGCTTTATTTGAGTGG + Intergenic
1138519199 16:57561272-57561294 AGATGTCAGCTAAATTTTGGAGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142627253 17:1200117-1200139 ACAGATCAAAAATATTTGGGAGG + Intronic
1143230576 17:5350766-5350788 ACATAACAGCTACATTTGAGGGG + Intronic
1144539016 17:16120849-16120871 AAAAAACAGCTATATTGGGGTGG + Intronic
1148375029 17:47135486-47135508 ACATATCTGCTTTATTTGAGTGG + Intronic
1153034796 18:750767-750789 ACATATTAACTATATTTTGAAGG + Intronic
1155905919 18:31451020-31451042 AAATAAAAGCTATATTTGGGAGG + Intronic
1156005330 18:32434113-32434135 ACTGATTGGCTATATTTGGGTGG - Intronic
1157297692 18:46457909-46457931 TCACATCAGCTAGGTTTGGGAGG + Exonic
1168202577 19:54827110-54827132 GGATATAAGCTATGTTTGGGAGG + Intronic
925885626 2:8391854-8391876 ACACATTAGCTCTTTTTGGGAGG - Intergenic
926389314 2:12371317-12371339 CCATATTAGCTGTATCTGGGTGG + Intergenic
926777630 2:16438218-16438240 AAATATCTGCTATATATGGTAGG + Intergenic
927058548 2:19390941-19390963 GAATATCAGTTATATTTGTGAGG - Intergenic
927819415 2:26249930-26249952 ATACAGCAGCTACATTTGGGTGG + Intronic
928346338 2:30500598-30500620 ACATAGCAGATAGATTTAGGGGG + Intronic
930178720 2:48328536-48328558 GCACATCAGAAATATTTGGGGGG - Intronic
930927684 2:56839200-56839222 ACATATCTACAAAATTTGGGGGG + Intergenic
933219720 2:79674725-79674747 ACATAACAGGTATTTTTTGGTGG - Intronic
938538333 2:132264755-132264777 ATATATCTGCTTTATTTGAGTGG - Intergenic
939408750 2:141796796-141796818 ACATAACAACCATCTTTGGGAGG + Intronic
939560630 2:143727384-143727406 ATATATCACCTATATTTCAGTGG + Intronic
942139471 2:172963589-172963611 ACATAACACCTATATTTCAGGGG - Intronic
1171351362 20:24505469-24505491 ACCTAGCAGCTAAATTGGGGTGG + Intronic
1171811675 20:29749766-29749788 ATATATCTGCTTTATTTGAGTGG - Intergenic
1171867233 20:30496560-30496582 ATATATCTGCTTTATTTGAGTGG - Intergenic
1171907996 20:30915954-30915976 ATATATCTGCTTTATTTGAGTGG + Intergenic
1172935934 20:38620235-38620257 AAACATCAGCTATATTTGTGAGG + Intronic
1173337929 20:42128082-42128104 ACATAGCAGCTCCATTTGAGGGG - Intronic
1175601976 20:60281628-60281650 ACATTTCACCTTTAGTTGGGAGG + Intergenic
1178464236 21:32832199-32832221 AAAAATCAGTTATATTTGGCTGG - Intergenic
1179128579 21:38614170-38614192 ACATATAAGTTATATGTAGGAGG - Intronic
1180313921 22:11261420-11261442 ATATATCTGCTTTATTTGAGTGG - Intergenic
1180341429 22:11622106-11622128 ATATATCTGCTTTATTTGAGTGG + Intergenic
1180457325 22:15521522-15521544 AAATATCTGCAATATCTGGGGGG + Intergenic
1180914725 22:19478225-19478247 ACATATCAGGTATTCTTGAGTGG + Intronic
1184055910 22:42049195-42049217 ACATGTTGGCTATATTTGTGCGG - Intronic
949386952 3:3513550-3513572 ACATTTCAGCTGAATTTGGAAGG + Intergenic
949398872 3:3644892-3644914 ATAAATCAGCTCAATTTGGGAGG - Intergenic
949791224 3:7794094-7794116 ACATAGCAGGAATATTTGAGAGG + Intergenic
953064752 3:39458744-39458766 ACCTATCAGCAACATGTGGGTGG - Intergenic
954961753 3:54571691-54571713 ACACATCACATCTATTTGGGAGG + Intronic
955762560 3:62303436-62303458 ACATATTGGCTTTTTTTGGGAGG - Intergenic
957156698 3:76552696-76552718 ATATATAATCTATATTTGAGTGG + Intronic
957286832 3:78227530-78227552 ACATTTCAGCCATCTTTTGGGGG + Intergenic
958031203 3:88113254-88113276 ACCAATAAGCTATATTTAGGGGG - Intronic
964585089 3:158288844-158288866 ACAGATCAAAAATATTTGGGGGG - Intronic
965907361 3:173725518-173725540 ACAAATCAGTAATATTTTGGGGG - Intronic
969064376 4:4466755-4466777 ATAAATCAGCTCTATCTGGGCGG - Intronic
971312621 4:25538550-25538572 GCATCTGAGCAATATTTGGGTGG - Intergenic
972685228 4:41346048-41346070 ACAAAGAAGCTTTATTTGGGAGG + Intergenic
976682849 4:87776427-87776449 ATATATCATCTATTTTTAGGTGG - Intergenic
979801530 4:124915156-124915178 AGATTTCAGGTATATTTGGTGGG + Intergenic
980243646 4:130208373-130208395 AAATATCAGATCTATTTTGGTGG - Intergenic
980861856 4:138508695-138508717 AAATATCATCTATTTTTTGGTGG - Intergenic
981007649 4:139892393-139892415 GCATATTAGTTATATTTTGGAGG - Intronic
981046871 4:140272789-140272811 AAAGGTCTGCTATATTTGGGTGG + Intronic
984916280 4:184727743-184727765 ATTTATCAGTTACATTTGGGTGG - Intronic
985886721 5:2685941-2685963 ACATTTCAGGTCTGTTTGGGAGG + Intergenic
986045056 5:4028617-4028639 ACATATCAGCTTTCATTGGTTGG + Intergenic
986347893 5:6851369-6851391 ACATGTCAGCTGTATTTCTGCGG + Intergenic
987793895 5:22604221-22604243 AAATATCAGCTATTTCTGGGGGG + Intronic
993464398 5:88227215-88227237 ACATAGTAGCTATAAATGGGTGG + Intronic
993583955 5:89699925-89699947 AAATTTCAGCCATATTTGGTAGG - Intergenic
997558604 5:134823432-134823454 ACATAACAGCTGTATTTGCCGGG - Intronic
998245734 5:140502687-140502709 ACATATCAGCTATTTTGAGGAGG + Intronic
998885105 5:146685895-146685917 ACATACAAGCTAGATTTTGGTGG - Intronic
999897878 5:156054083-156054105 GCAAATCATATATATTTGGGTGG + Intronic
999978208 5:156933461-156933483 ACTTTTCAGCTTTTTTTGGGGGG - Intronic
1001986238 5:176076100-176076122 ACATTTCAGCGATATGTGGGTGG - Intronic
1002230629 5:177762024-177762046 ACATTTCAGCGATATGTGGGTGG + Intronic
1002264705 5:178021724-178021746 ACATTTCAGCGATATGTGGGTGG - Intronic
1007882554 6:45183671-45183693 ACATTTCAGCGAGATTTGGAGGG + Intronic
1008015278 6:46511596-46511618 GAACATCAGCTATATTTGTGTGG + Intergenic
1008162772 6:48099031-48099053 ACATTTCAGCTATTTTTGTCTGG + Intergenic
1010617540 6:78030808-78030830 ACCAATCAGCAAGATTTGGGTGG + Intergenic
1012557229 6:100528913-100528935 AGATATCTGCTATCTTTTGGGGG + Intronic
1013759721 6:113503159-113503181 ACATATCAGCAATATTTGAAAGG - Intergenic
1018268151 6:162048176-162048198 ATATATCATCTATTTTTGAGAGG - Intronic
1022611285 7:31876258-31876280 ACATATCAACAATATATGTGAGG + Intronic
1022814092 7:33897368-33897390 CCATATCACCTAGATTTTGGGGG + Intergenic
1032833124 7:135649333-135649355 ACAGATCACAAATATTTGGGGGG - Intergenic
1033926084 7:146462105-146462127 TCATATCACCTATTTTTCGGAGG - Intronic
1035230214 7:157460877-157460899 AGATATCTGCTATTTTTGGCCGG - Intergenic
1039014833 8:33135205-33135227 ACATATCAATTATATTTGAAGGG - Intergenic
1041023616 8:53661490-53661512 ACATCTCAGATATATTTTGCAGG + Intergenic
1041480172 8:58311365-58311387 ACATTCCAGGTATTTTTGGGAGG - Intergenic
1041756801 8:61322922-61322944 ACATAGCAGTAAAATTTGGGAGG - Intronic
1047076944 8:121414598-121414620 ACATATGAAATATATTTGGCCGG - Intergenic
1055871703 9:80888327-80888349 ACATACAAGCTATATTTAGAAGG + Intergenic
1058512537 9:105735987-105736009 AAATACCAGCTATTTTTGAGAGG - Intronic
1203362302 Un_KI270442v1:227633-227655 ATATATCTGCTTTATTTGAGTGG - Intergenic
1186038581 X:5451004-5451026 ACATATCATATATATTTTTGAGG + Intergenic
1186200553 X:7151631-7151653 ACATATCTGGTATTTTTGTGTGG + Intergenic
1186672784 X:11783660-11783682 AGATATGAGCTTTTTTTGGGGGG + Intergenic
1188139513 X:26531660-26531682 ACATATCATCTATATGTTGGAGG + Intergenic
1193145771 X:78074150-78074172 ACATATCACATATATTATGGTGG - Intronic
1201076019 Y:10188706-10188728 ATATATCTGCTTTATTTGAGTGG + Intergenic