ID: 1092297577

View in Genome Browser
Species Human (GRCh38)
Location 12:7212832-7212854
Sequence CTGGGGGATCACGAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092297567_1092297577 21 Left 1092297567 12:7212788-7212810 CCTGGGGGAGGAAAACAGGAAGC 0: 1
1: 0
2: 5
3: 44
4: 334
Right 1092297577 12:7212832-7212854 CTGGGGGATCACGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 26
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092297577 Original CRISPR CTGGGGGATCACGAGGCAGC TGG Intronic
900155990 1:1203462-1203484 CTGGGGGAGGACGGGGCACCCGG - Intergenic
900597691 1:3489966-3489988 CTGCGGGCTCACCAGGCTGCTGG - Exonic
900870347 1:5297756-5297778 ATGGGGAATCCCCAGGCAGCAGG - Intergenic
902331301 1:15732339-15732361 CTGGGGGATGACCTGGCAGCGGG - Exonic
902403416 1:16170542-16170564 TTGGGAGATCATGAGGCAGCGGG - Intergenic
903049222 1:20588669-20588691 CTGCGGCATCCCGAGGCAGGAGG - Intergenic
903329352 1:22589226-22589248 CTGGGGGACCAGGACGCTGCGGG - Intronic
907856064 1:58304787-58304809 CTGGGGGATTCTGACGCAGCAGG + Intronic
912513026 1:110201315-110201337 CTGGAGGAGCAGGAGGTAGCAGG + Exonic
914989324 1:152484948-152484970 CAGGGAGATCAGGAGGCAACAGG - Intergenic
915048850 1:153046043-153046065 CTTTAGGATCAGGAGGCAGCAGG + Intergenic
915050241 1:153062558-153062580 CTTGGAGATCAGGAGGCAGTAGG - Intergenic
915054867 1:153118534-153118556 CTTGGAGATCAGGAGGCAGTGGG + Intergenic
916849703 1:168690971-168690993 CTGGGGGACCAAGAGGCAAAGGG - Intergenic
919079097 1:192848449-192848471 CTGGGGGAGCAAGAGGAAGCTGG + Intergenic
920370905 1:205478785-205478807 GTGAGGGATCACCGGGCAGCTGG + Intergenic
920877886 1:209854504-209854526 CTGGGGTATGAGGAGTCAGCAGG - Exonic
921067183 1:211631354-211631376 CTGGCGGATCCAGAGGCAGGGGG + Intergenic
1062909993 10:1206004-1206026 CAGGTGGTTCACGGGGCAGCTGG + Intronic
1063612826 10:7577162-7577184 CCAGGAGATCACTAGGCAGCAGG + Intronic
1067084663 10:43231436-43231458 CTCTGGGGTCAGGAGGCAGCAGG - Intronic
1069456030 10:68554657-68554679 CTGGGGGATAGCGGGGAAGCTGG - Intergenic
1070813825 10:79311378-79311400 CTGGGGGGACAGGAGCCAGCAGG - Intronic
1072618033 10:97062702-97062724 CTGGGGGAGCTGCAGGCAGCAGG + Intronic
1072815660 10:98506553-98506575 CTGGGGGAACCTGAGGCAGGAGG - Intronic
1073262817 10:102203463-102203485 CAGGGAGATCAAGGGGCAGCAGG - Intergenic
1074034363 10:109723479-109723501 CTGAGTGCTCACCAGGCAGCAGG + Intergenic
1075602606 10:123781421-123781443 CTGGGGGACCTCGAGGCAGATGG - Intronic
1075745932 10:124727512-124727534 CAGGTGGAACACGAGGTAGCAGG + Intronic
1076783412 10:132736917-132736939 CTGAGGGATCAGGGGGCAGAGGG - Intronic
1077143507 11:1035038-1035060 CTGGACGAGCACGAGGCGGCAGG + Intronic
1078594556 11:12674867-12674889 CGGGGGGCGCACGGGGCAGCGGG + Intronic
1078914028 11:15760918-15760940 CTCGGGGATCACTAGGAATCAGG + Intergenic
1079837248 11:25350345-25350367 CTGGGGGCTCACAAGGAAGGAGG + Intergenic
1081623983 11:44635690-44635712 CAGGGAGATCAGAAGGCAGCAGG + Intergenic
1085781400 11:79412294-79412316 CTGGGCCATCATGAGGGAGCTGG - Intronic
1087105690 11:94404340-94404362 CGGGTGGATCACGAGGCGGGTGG - Intergenic
1089413456 11:118266641-118266663 CTGGGGGCTCAGGAGACAGAAGG + Intergenic
1089964392 11:122643853-122643875 CTTTGGGAGCCCGAGGCAGCAGG - Intergenic
1091251349 11:134146806-134146828 CTGGGGGAGGCCGAGGCAGGAGG - Intronic
1091292288 11:134447859-134447881 ATGGGGGAACCCGAGACAGCAGG - Intergenic
1091444530 12:535925-535947 CTGGGGGATAAGGAGGAAGAGGG + Intronic
1091673252 12:2467713-2467735 CTGGGAGATCAGGAGACACCGGG - Intronic
1091874249 12:3920467-3920489 AGAGGGGATCAGGAGGCAGCTGG - Intergenic
1092297577 12:7212832-7212854 CTGGGGGATCACGAGGCAGCTGG + Intronic
1098222332 12:68283329-68283351 CTGGGGCACCACCAGGCACCTGG - Intronic
1098892560 12:76024167-76024189 CTTTGGGATGCCGAGGCAGCTGG + Intergenic
1098989446 12:77048707-77048729 CTGGGTGATCAGGAGGCATTGGG + Intronic
1099642308 12:85306984-85307006 CTGCAGGATAAGGAGGCAGCAGG - Intergenic
1102511657 12:113420069-113420091 CTTTGGGATGCCGAGGCAGCTGG - Intronic
1102830835 12:115997663-115997685 CTTGGGGAGTACGAGGCAGGCGG - Intronic
1104860672 12:131921760-131921782 CTGGGGGACGCCGAGGCCGCAGG - Exonic
1105296443 13:19091032-19091054 CTGGGGTGTCACCAGGCAGATGG + Intergenic
1107085161 13:36419662-36419684 CTGTGGGAGGCCGAGGCAGCTGG - Intergenic
1112792235 13:103015701-103015723 CTAAGGGATGCCGAGGCAGCTGG - Intergenic
1113693306 13:112327159-112327181 CTGGGGGATCACACAGCAGTGGG - Intergenic
1114185048 14:20394719-20394741 CAGGTGGATCACGAGGCAGGTGG - Intronic
1117129575 14:52672059-52672081 CTGTGGGAGCCCGAGGCAGGTGG + Intronic
1120239989 14:81938913-81938935 CTCGGGGATAAGGAGGAAGCTGG - Intergenic
1122422696 14:101587448-101587470 CTGGAGGAGCTCGAGGCAGGGGG + Intergenic
1122627245 14:103090902-103090924 CTGGAGGCTGGCGAGGCAGCGGG - Intergenic
1122779077 14:104136111-104136133 CTGGGGGCTAGCGAGGCAGGTGG + Intergenic
1122783290 14:104152788-104152810 ATCGGGGCTCACGAGGCAGATGG + Intronic
1122956842 14:105075149-105075171 CTGGGGGAGCTCGGGGCAGCGGG - Intergenic
1124376952 15:29134469-29134491 CTGGGGGCTCACGGGCCAGCCGG + Intronic
1124393499 15:29280677-29280699 CTGAGACATCACCAGGCAGCAGG - Intronic
1124719147 15:32097164-32097186 CTGGGGGCTCCCGACTCAGCAGG - Intronic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1127833548 15:62771770-62771792 CTGGGGGACCACCAGGCAGGAGG + Intronic
1130186646 15:81689779-81689801 TTGGGGGATCAAGTGGCAGCAGG + Intergenic
1131390824 15:92046915-92046937 CTGGGGGATAATGATGCTGCTGG + Intronic
1131836298 15:96395058-96395080 CTGGACGAGCACGAAGCAGCAGG - Intergenic
1132065118 15:98724774-98724796 CTGAGGGATACCGAGGCATCCGG - Intronic
1132568435 16:633743-633765 CTGGAGGAGCCCGAGGCCGCCGG + Exonic
1132898376 16:2239484-2239506 CTGGGGGATCCTGAGCCAGCGGG - Exonic
1133321147 16:4914535-4914557 CTGGGGGATCTTGAGGGAACAGG + Intronic
1134017220 16:10897273-10897295 GTGGGGCATCACGAGGCAAGAGG + Intronic
1134369140 16:13607144-13607166 CGGGCGGATCACGAGGCAGGCGG + Intergenic
1134814931 16:17198129-17198151 CTGGGAACTCACGAGGCAGAAGG - Intronic
1135401428 16:22169028-22169050 CTGGGCCCTCACGAGGGAGCTGG - Intronic
1137971993 16:52994828-52994850 CTGTGGGAGCCCGAGGCAGGCGG + Intergenic
1138431598 16:56972532-56972554 CCGCGGGATCAGGAGGCTGCAGG + Intronic
1139228776 16:65260269-65260291 ATGGAGGAACAGGAGGCAGCAGG - Intergenic
1139760737 16:69182861-69182883 CTGGGGGCTCACGCCTCAGCTGG + Intronic
1140852540 16:78948568-78948590 CAGAGGGATGAGGAGGCAGCAGG - Intronic
1141453000 16:84117986-84118008 CTTGGGGAGGCCGAGGCAGCCGG + Intergenic
1141620544 16:85234849-85234871 CTGGGGGATTAGAAGGCATCTGG + Intergenic
1141745055 16:85920016-85920038 CTGGGGGATCAGGAGGCCCAGGG - Intronic
1141964962 16:87435647-87435669 GTCGTGGAGCACGAGGCAGCGGG + Intronic
1142501895 17:337707-337729 CTGGGTGCTGACGAGGCACCAGG + Intronic
1143564010 17:7710571-7710593 CTGGGGGATCAGGAGGTGGGAGG + Exonic
1143875100 17:9985456-9985478 ATGGGGGAGCAGGAGGCGGCAGG - Intronic
1143980109 17:10861582-10861604 CAAGGCGATCAGGAGGCAGCGGG - Intergenic
1144521355 17:15954397-15954419 CTGGGTGATCACGAGGATGTGGG - Intronic
1147648946 17:42050965-42050987 CTTTGGGATCACGAAGGAGCGGG + Intronic
1149602240 17:57900377-57900399 CTGGGGGACTAGGATGCAGCAGG - Intronic
1151451866 17:74203033-74203055 CTGGGGGAGGCCGAGGCAGGCGG - Intergenic
1151766535 17:76136052-76136074 CTGGGGGATCAGGAGACAAAGGG - Intergenic
1151879754 17:76887908-76887930 CTGGGGGGCCATGAGGGAGCGGG - Intronic
1153384832 18:4480326-4480348 CAGGAGGATCACGAGGCAGGGGG + Intergenic
1155438570 18:25837742-25837764 CAGGAGGATCACTAGGCACCAGG + Intergenic
1156522141 18:37730803-37730825 CGGGGGGAGCTCCAGGCAGCAGG + Intergenic
1160340713 18:78086732-78086754 CTGGGTGTTCACAAGGGAGCTGG + Intergenic
1160579390 18:79875032-79875054 CTGGGAGATCACAGGGCAGAAGG - Intronic
1160680566 19:410101-410123 CTGGCAGATCACGAAGCAGCTGG - Intergenic
1160904468 19:1445938-1445960 CTGGGGGGGCCCGAGGCGGCGGG - Intergenic
1161065043 19:2233351-2233373 CTGGGGGCTCACCAGGCCCCTGG + Exonic
1161102082 19:2426298-2426320 CTGGTGGAGCACCAGGCAGGTGG - Exonic
1161731537 19:5963977-5963999 CTGGGGTACCAGGGGGCAGCAGG - Intronic
1161854727 19:6757555-6757577 CTGGGGGATAAGCAGGCAGGAGG - Intronic
1161993218 19:7697149-7697171 CTGGGGAACCACGAGGCTGGGGG - Intronic
1162380638 19:10329676-10329698 CTGGGGCAGCACGTGGCAGCAGG - Intronic
1163718571 19:18886747-18886769 ATGGGGCATCTGGAGGCAGCTGG - Intronic
1164465155 19:28481639-28481661 CTGGGGGAACACACTGCAGCTGG - Intergenic
1164957184 19:32396538-32396560 CTGGGGGATGCCAAGGCAGGAGG + Intergenic
1165140556 19:33697473-33697495 CTTTGGGAGCACGAGGCAGGTGG - Intronic
1166997355 19:46726045-46726067 CTGAGGAAGCACGAGCCAGCAGG + Intronic
1167051108 19:47079270-47079292 CTGTGGGATGCCGAGGCAGACGG - Intronic
1168645422 19:58056257-58056279 CTGGGGGCTGTGGAGGCAGCAGG - Intergenic
928366885 2:30709660-30709682 CTGAGGGCTCGCGAGGCAACAGG + Intergenic
928459440 2:31456963-31456985 CTGAGGGATCCAGAGGCAGATGG - Intergenic
931291640 2:60879515-60879537 CTGGGGGAACAGCAGGCAGCAGG - Intergenic
934151758 2:89154115-89154137 CTGGGGAATCACAGAGCAGCAGG + Intergenic
934215502 2:90027791-90027813 CTGGGGAATCACAGAGCAGCAGG - Intergenic
934746232 2:96761316-96761338 CTTGGTGAGCTCGAGGCAGCTGG - Exonic
935320547 2:101884033-101884055 CAGGGGGAGCAAGAGGCAGACGG + Intronic
935743671 2:106172832-106172854 CTGAGGAATGACGAGGCAGATGG - Intronic
937202166 2:120210592-120210614 CTGGGGGATCCCCTGGAAGCTGG - Intergenic
939271073 2:139940415-139940437 CTGGGTGCTCACAAGGCAGATGG + Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
945974476 2:216259556-216259578 CTGGAGGATCAAAAGGCAGGAGG - Exonic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946241272 2:218357417-218357439 CTGTGGGATGAGGAGGCAGGTGG + Intronic
946339777 2:219059815-219059837 CTGGAGGCGCAGGAGGCAGCCGG + Intronic
946433041 2:219635650-219635672 CTGGGGGAACAAGGGGCTGCTGG - Intronic
947605503 2:231483201-231483223 TGGCGGGATCCCGAGGCAGCAGG - Intronic
948271532 2:236677580-236677602 ATGCGGGATCACGCTGCAGCTGG + Intergenic
948978523 2:241479754-241479776 CTGTGGGCTCACGGGGGAGCTGG + Intronic
1169080808 20:2796879-2796901 CTGAGACATCAGGAGGCAGCAGG + Intronic
1169917651 20:10699478-10699500 GTGGGGCATCACAAGGAAGCTGG - Intergenic
1172558972 20:35868845-35868867 CTTTGGGAGGACGAGGCAGCTGG + Intronic
1173422997 20:42919153-42919175 CTGGGGGATCCCCAGGCTGGAGG - Intronic
1174569690 20:51492686-51492708 CTTGGGGAGCAGGAGGCGGCCGG + Intronic
1175212118 20:57366399-57366421 CTGGGGAATCCCAAGGGAGCAGG + Intronic
1175715074 20:61249937-61249959 CTGGGGGATCTTGATGCTGCTGG + Intergenic
1175958315 20:62622566-62622588 CTGGGGCACCAGGAGCCAGCAGG - Intergenic
1176973329 21:15290339-15290361 CTGGGGGGGCCTGAGGCAGCAGG + Intergenic
1178450111 21:32690645-32690667 CTTGGGGAGGCCGAGGCAGCTGG + Intronic
1179668620 21:42929858-42929880 CTCTGGGAGCCCGAGGCAGCTGG - Intergenic
1180090343 21:45531005-45531027 CTGGGGGGCCACGGGGCAGGGGG + Intronic
1181028648 22:20139644-20139666 CTGGGGGAGCGCGGGGCAGCAGG - Intronic
1181951849 22:26559765-26559787 CTGGGAGAGCCCTAGGCAGCAGG - Intronic
1183726698 22:39593971-39593993 CTGGGGGATACCGAGGATGCTGG + Intronic
1185156780 22:49197814-49197836 CTGGGGAATCGCGAGGCAGGCGG - Intergenic
949483766 3:4518261-4518283 CCGGGGGCTCAGGAGGCACCTGG - Intronic
950122283 3:10489741-10489763 CTGGAGGCTCACGGTGCAGCTGG - Intronic
952128553 3:30332646-30332668 CTGTGGGATCACGGGGAGGCTGG - Intergenic
953123822 3:40071885-40071907 CTGCAGGGTCACGAGGGAGCTGG + Intronic
954805664 3:53218538-53218560 CAGGGAGATCAAGAGGCAACTGG + Intergenic
955353523 3:58211326-58211348 CTGGGGGACAATGAGGCAGGAGG + Intronic
957949024 3:87100210-87100232 CTGGTGGATCACGAGGTCTCAGG + Intergenic
959837870 3:110942268-110942290 CTGTGGGATGCCGAGGCAGGTGG + Intergenic
960993251 3:123325226-123325248 CTTGGGCAACACGAGGCATCTGG + Intronic
963818410 3:149860021-149860043 CTTGGGGAGCCCGAGGCAGGTGG + Intronic
963903754 3:150756990-150757012 ATGGGGGATCACCTGGAAGCAGG - Intronic
966504128 3:180679746-180679768 CTGGAGGACCACGGGGCAGCTGG + Intronic
967845737 3:194041204-194041226 CTTTGGGAGAACGAGGCAGCTGG + Intergenic
967949624 3:194830714-194830736 GTGAGGGAGCAAGAGGCAGCAGG + Intergenic
968728445 4:2258950-2258972 CTGGAGGATAACGAGGCAGGGGG + Intronic
968872592 4:3249308-3249330 CTGGGGAGACACGAGGTAGCCGG - Exonic
969713079 4:8855539-8855561 CTGGTGGGTCACCCGGCAGCTGG - Intronic
970587138 4:17525390-17525412 CTTGGGGATGCTGAGGCAGCAGG + Intronic
970831581 4:20346237-20346259 CTTTGGGAGCACGAGGCAGGCGG - Intronic
970919789 4:21380419-21380441 CTGGGGGATGATGAGGGAGAGGG + Intronic
972420351 4:38880939-38880961 CTTGGGGAGGACGAGGCAGGTGG + Intronic
972680885 4:41305838-41305860 CTGGGGGATCAGGCTGAAGCTGG + Intergenic
974204972 4:58690067-58690089 CTTGGGGAGGACGAGGCAGCTGG - Intergenic
984961103 4:185099549-185099571 ATGGTGGAGCACGGGGCAGCTGG + Intergenic
985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG + Intergenic
985860372 5:2466013-2466035 CTGGGAGGTCTCCAGGCAGCAGG - Intergenic
987095116 5:14542672-14542694 GTGTGGGATCACCAGGAAGCTGG + Intergenic
988030388 5:25756329-25756351 CTGGGGGATCAAGAAGCAGTAGG + Intergenic
989133066 5:38126449-38126471 CTGGGAGACCCCCAGGCAGCCGG + Intergenic
996553592 5:124755053-124755075 CAGGAAGATCAAGAGGCAGCAGG + Intergenic
997210507 5:132074260-132074282 CTGGGTGCTCAAGAGGCTGCTGG + Intronic
997990760 5:138543006-138543028 CTGGGGGATGGCGAGGAAGGGGG - Intronic
999975145 5:156904842-156904864 CTGTGGGATGCCGAGGTAGCGGG + Intergenic
1000082254 5:157859070-157859092 CTGGGGGAGTTCGAGGCGGCGGG - Exonic
1001774297 5:174317042-174317064 CTGGGGGATCACCAGGTGCCAGG + Intergenic
1002965444 6:1961764-1961786 TTGAGGATTCACGAGGCAGCAGG - Intronic
1004598723 6:17126992-17127014 CGGGGGGATCATCAGGCAGCAGG - Intronic
1006635693 6:35459787-35459809 CTGGGGGAACAGGTGGCAGTGGG - Intronic
1007193824 6:40041982-40042004 CTGTGGGATCAGGCTGCAGCTGG - Intergenic
1007649895 6:43412865-43412887 CTGGAGGGGGACGAGGCAGCAGG - Intergenic
1008705234 6:54150254-54150276 CTGGAGGTTCACTAGGCTGCAGG + Intronic
1011795768 6:90949414-90949436 CGGGTGGATCACGAGGCGGGTGG + Intergenic
1013148313 6:107417513-107417535 CTTGGGGAGGCCGAGGCAGCTGG + Intronic
1016414811 6:143821067-143821089 CTGAGGCTGCACGAGGCAGCAGG + Intronic
1018030450 6:159837183-159837205 CTGGGGGACCAAGATGCAGCAGG + Intergenic
1018611777 6:165654309-165654331 CTGGGCCATCACCTGGCAGCCGG + Intronic
1019006265 6:168799230-168799252 CTGGGGGATTGACAGGCAGCTGG - Intergenic
1019744667 7:2692900-2692922 CTGGGGGCTCAGGGGACAGCCGG - Intronic
1023516726 7:41008851-41008873 TCGGGTGACCACGAGGCAGCAGG - Intergenic
1024237253 7:47408009-47408031 CTGGGGCAGCAAGAGGCGGCTGG + Intronic
1024576267 7:50767270-50767292 CTGGAGGATCAGGAGCCAGAGGG - Intronic
1026929071 7:74213067-74213089 CAGGGGGATCCCAAGGCAGGAGG + Intronic
1032756935 7:134899888-134899910 CTTTGGGATCCCGAGGCAGGAGG - Intronic
1034276333 7:149825447-149825469 CTCTGGGAGCAGGAGGCAGCTGG - Intergenic
1034337802 7:150334619-150334641 CGTGGGGCTCAGGAGGCAGCTGG - Intronic
1034670180 7:152851854-152851876 CAGGGGGAGCATGAGGGAGCAGG + Intronic
1036002859 8:4627663-4627685 CTGGGGCATCCCGGAGCAGCTGG - Intronic
1037731621 8:21529863-21529885 CTGGGGGATATCAAGGAAGCTGG - Intergenic
1037860572 8:22402524-22402546 CTTGGGGAGCCCGAGGCAGGAGG + Intronic
1038466848 8:27772370-27772392 CTGGGGGACCGAGAGGCCGCGGG + Intronic
1039886952 8:41660272-41660294 TTGGTGGCTCAGGAGGCAGCGGG + Intronic
1045504918 8:102771541-102771563 CTGGGGGCTCACCAGGCAGCAGG + Intergenic
1048299220 8:133239120-133239142 CTAGGGGAACAAGAGACAGCCGG + Intronic
1049231717 8:141488247-141488269 ATGGGGGAACAAGAGGGAGCAGG - Intergenic
1049257090 8:141619924-141619946 CTGGGGGGCCAGGAGGCATCTGG + Intergenic
1049332107 8:142060082-142060104 CTGGGAGGTCAGGAGGCCGCGGG - Intergenic
1049437993 8:142596432-142596454 CTAGGGGAGCCCGAGGCAGCAGG + Intergenic
1049775524 8:144402130-144402152 CTGGGGGAGCCCGAGGCGTCAGG - Intronic
1050412959 9:5385437-5385459 CAGGAGGATCACGAGGCAGGAGG - Intronic
1051482897 9:17578905-17578927 CTGGCGGATCCCTAGTCAGCGGG - Intergenic
1053667279 9:40325108-40325130 CTGGAGGATCACAGGGCAGGTGG + Intronic
1054378424 9:64465136-64465158 CTGGAGGATCACAGGGCAGGTGG + Intergenic
1054517331 9:66051175-66051197 CTGGAGGATCACAGGGCAGGTGG - Intergenic
1056099658 9:83288882-83288904 TTGGGGGATCATAAGGCAGCAGG + Intronic
1057263292 9:93598144-93598166 CTGGGGTGTCACCAGGCAGATGG - Intronic
1057295028 9:93829836-93829858 CTGTGGGATCACCAGGCCTCAGG + Intergenic
1057414287 9:94847395-94847417 CTGTGGGATGTGGAGGCAGCAGG + Intronic
1057481741 9:95449941-95449963 CTGGGAGATCAAGAGGAAACGGG + Intronic
1058705081 9:107631235-107631257 CTTTGGGAGGACGAGGCAGCTGG - Intergenic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060185981 9:121564531-121564553 CTGGGGGTTGAGGAGGCAGAAGG - Intergenic
1060401928 9:123354422-123354444 CTGGGGGATCACTGAGAAGCTGG + Intergenic
1060521186 9:124294988-124295010 CTGGGGGAGGGCGAGGCATCCGG + Intronic
1060583500 9:124771617-124771639 GAGGTGGATCGCGAGGCAGCCGG + Intergenic
1061009255 9:127945593-127945615 ATGGGGGATCCCGAGGAAGGAGG + Intronic
1061851771 9:133420280-133420302 CAGGTGGATCACGAGGCACGCGG - Intronic
1062165347 9:135104808-135104830 CTGGAGGAGCAGGAGGCAGGAGG - Intronic
1062722572 9:138052020-138052042 CTGGGGGGCCACGTGGGAGCTGG + Intronic
1188686299 X:33074683-33074705 CTGGGGCATCACATGGCAGGAGG - Intronic
1195463839 X:105158112-105158134 CGGGCGGATCACGAGGCGGGCGG + Intronic
1195616273 X:106914548-106914570 CTGGCTGAGCACAAGGCAGCTGG - Intronic
1197714907 X:129699621-129699643 CTGGGGGATCGCCATGCATCTGG - Intergenic
1200952309 Y:8910828-8910850 CTTGGGGAGTACGGGGCAGCTGG + Intergenic
1201683906 Y:16680477-16680499 GTGGGGGATCCCAAGGCAGAAGG + Intergenic