ID: 1092297909

View in Genome Browser
Species Human (GRCh38)
Location 12:7216267-7216289
Sequence GTGTGAGTGTTTAAGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092297909_1092297914 15 Left 1092297909 12:7216267-7216289 CCAAATTCCTTAAACACTCACAC 0: 1
1: 1
2: 1
3: 34
4: 320
Right 1092297914 12:7216305-7216327 CTACTCTTAAATAATGACAAAGG 0: 1
1: 0
2: 0
3: 22
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092297909 Original CRISPR GTGTGAGTGTTTAAGGAATT TGG (reversed) Intronic
900832908 1:4977841-4977863 GTTTGAGGGTTTAGGGAACTTGG + Intergenic
900931807 1:5742580-5742602 CTGAGAGTTTTTAAGGATTTAGG - Intergenic
902302363 1:15511172-15511194 ATATGAGGGTTTAAGGAATTTGG + Intronic
902798057 1:18812250-18812272 GTCTCAGTGTTTCAGGGATTAGG + Intergenic
903992961 1:27287194-27287216 CTTTGAGTGTTTAAGGGAATGGG - Intronic
904061398 1:27713767-27713789 CTGTGAGTTTTTAAGGATTCGGG - Intergenic
905041335 1:34961542-34961564 ATATGAGGGTTTAAGGAATTTGG + Intergenic
905603199 1:39271733-39271755 GTGTGAGATTTTCAGAAATTTGG + Intronic
909971988 1:82001993-82002015 GTGAGATTGTTAAAAGAATTGGG - Intergenic
915392960 1:155561455-155561477 GTGTGTGTATTTTAGGGATTGGG - Intronic
915409116 1:155687373-155687395 GTGTGTGTATTTTAGGGATTGGG - Intronic
916212732 1:162371926-162371948 GAGGGAGTGTTTGAGGAATGAGG + Intronic
917369746 1:174279379-174279401 GTGTGAGTTTTTAAAAAATCAGG + Intronic
918258735 1:182774661-182774683 ATATGAAGGTTTAAGGAATTTGG - Intergenic
918394019 1:184095487-184095509 GTGTGATTGTTTTTGGAGTTAGG + Intergenic
919208267 1:194446408-194446430 GTGTGAGTGATTAGGTGATTGGG + Intergenic
920792433 1:209106055-209106077 GAGTTAGTGTTTCAGGAATGAGG + Intergenic
921919972 1:220656900-220656922 GTGGGTGTGTTTTATGAATTTGG + Intronic
922091877 1:222403406-222403428 ACATGAGTGTTTAAGGAATGTGG + Intergenic
923216932 1:231857010-231857032 ACATGAGGGTTTAAGGAATTTGG + Intronic
924029764 1:239874500-239874522 GAGTGAGTATTTGAGGATTTTGG + Intronic
924687637 1:246311599-246311621 GTGTGAGTGTTCAAGGAGGGTGG - Intronic
1063395103 10:5679093-5679115 GTGTGTGTGGTTAAAGAACTTGG + Intergenic
1063720746 10:8579096-8579118 GGGTGAATGTATAAGTAATTAGG - Intergenic
1064668677 10:17685553-17685575 ATAGGAGGGTTTAAGGAATTTGG + Intronic
1065797293 10:29319200-29319222 ATGAGAGTCTTTGAGGAATTGGG + Intergenic
1065945868 10:30605162-30605184 ATGAGAGTCTTTGAGGAATTGGG - Intergenic
1065962043 10:30741773-30741795 ACGTGAGCATTTAAGGAATTTGG + Intergenic
1066043697 10:31578534-31578556 GTGAGAGTGATTGAGGAATAAGG - Intergenic
1066272733 10:33839305-33839327 GTGTGTGTGTTTAAGTATTCTGG + Intergenic
1066472004 10:35708298-35708320 GTGTGTGTGTTTAGGTATTTAGG + Intergenic
1066547051 10:36511024-36511046 GTGTGACTGTTTATGGAGATTGG + Intergenic
1069083593 10:64114489-64114511 GTGTGTGTGTATAAGTAAGTGGG + Intergenic
1069932553 10:71892427-71892449 TTCTGAGGCTTTAAGGAATTGGG - Intergenic
1070354501 10:75626552-75626574 TGGAGAGTGTTTAAGGAATAGGG + Intronic
1070573361 10:77658472-77658494 GTGTGATAGTTTTAGGAAGTAGG + Intergenic
1071212166 10:83355881-83355903 GGGAGAGTCTTTGAGGAATTAGG + Intergenic
1072051875 10:91712848-91712870 GTGTGAGTTCTTAAGGATCTTGG + Intergenic
1072142613 10:92602795-92602817 GTGTGTGTGTTTAAGTAACCAGG - Intronic
1072880597 10:99223489-99223511 ATGTTTGTGTTGAAGGAATTAGG - Intronic
1073296511 10:102442759-102442781 ATGTGAGCCTTTAAGGCATTTGG + Intergenic
1074667136 10:115740809-115740831 GTGTGTGTGTTTAAAGAGATAGG - Intronic
1076032220 10:127169309-127169331 ATGTGAGAGTCAAAGGAATTCGG - Intronic
1076716175 10:132365026-132365048 GTTTGTCTGTTTAAGGATTTAGG + Intronic
1076828218 10:132981133-132981155 GTGTGAGTGTGTGAGGATCTGGG + Intergenic
1078313275 11:10267742-10267764 GATTGTGTGTTTGAGGAATTTGG - Intronic
1078734059 11:14003420-14003442 TTATGAGGGTTTAAGGAGTTTGG + Intronic
1079530924 11:21451951-21451973 GTATGTGTGTTTAAGAAATAAGG + Intronic
1079822861 11:25152966-25152988 GTTTGAGGGTTTAAAGGATTTGG - Intergenic
1080399535 11:31921255-31921277 GAGTCAGTATTTCAGGAATTTGG - Intronic
1080826420 11:35852708-35852730 GGGTGGGTGTTTTAGGCATTGGG + Intergenic
1081492033 11:43576768-43576790 GTGTATGTGTATAATGAATTTGG + Intronic
1083053948 11:59801772-59801794 GTGTGTGTGTCTCAGGAAGTAGG + Exonic
1084068228 11:66717814-66717836 GTGTGTGTGTGTAAGGATCTAGG - Intronic
1087022257 11:93615392-93615414 CTGTGAGTGTTTGAGGGAGTGGG - Intergenic
1087650252 11:100858115-100858137 GTGTGTGTGTTTATGTAATTAGG + Intronic
1088223779 11:107596487-107596509 ATGTCAGTGTTTATGGAATATGG - Intronic
1091971937 12:4794672-4794694 GTGTGTGTGTTTAAAGAAAAAGG + Intronic
1092297909 12:7216267-7216289 GTGTGAGTGTTTAAGGAATTTGG - Intronic
1092820735 12:12351033-12351055 GTGTGTGTGTTTATGGAGGTGGG - Intergenic
1096059728 12:48686538-48686560 GTGTGTGTGTTTAGGTAACTAGG - Intergenic
1100419329 12:94416541-94416563 GTGTGTGTGTGTATGGTATTTGG - Intronic
1100915696 12:99419085-99419107 GTGTGGGTGTATGTGGAATTGGG + Intronic
1100949484 12:99829956-99829978 GGATGGGTGTTTTAGGAATTTGG - Intronic
1101102170 12:101405193-101405215 GACTGAGTGTTGAAGTAATTTGG - Intronic
1101119182 12:101561638-101561660 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1101335325 12:103791535-103791557 TATTGAGGGTTTAAGGAATTTGG - Intronic
1101983600 12:109428494-109428516 GTGTTGGTGTATAAGCAATTTGG - Intronic
1102333467 12:112056588-112056610 GATTGAGTGTTTTAGGAAGTTGG - Intronic
1102699040 12:114823322-114823344 GAGTTACTGTTTAAGGAATATGG - Intergenic
1102722051 12:115024990-115025012 GTGTGTGTGTGTAGGGAATTTGG + Intergenic
1104302706 12:127579963-127579985 TTGTGAGTGTTTAGGGATTCAGG - Intergenic
1105427429 13:20306223-20306245 ATGTGAGGGTTTAGGGAATTTGG + Intergenic
1106069270 13:26391818-26391840 GTGTGAATCTTTAAGTAAATAGG + Intronic
1106900965 13:34354844-34354866 GTGTGAGTGTATTAGGGATGAGG - Intergenic
1107816950 13:44253017-44253039 GAGTGGGTGTTTAATAAATTAGG - Intergenic
1108804691 13:54140022-54140044 GTGAGAATGTTTGAGGAATCAGG - Intergenic
1108991538 13:56663967-56663989 GTGTGATTGTTTGAAGAATCTGG - Intergenic
1109163550 13:59005421-59005443 GTGTGTGTGTGTAAGGGAGTGGG - Intergenic
1109690444 13:65881360-65881382 ATATGAGAGTTTAAGGAATTTGG - Intergenic
1109708781 13:66136139-66136161 GTGTGAGTATTTCAGTATTTAGG - Intergenic
1110781936 13:79476585-79476607 ATGTGAGTGTTTGAATAATTAGG - Intergenic
1111498129 13:89080869-89080891 GTGTGTGTGTGTAGTGAATTTGG + Intergenic
1111514811 13:89315319-89315341 GTCTGACTTTTAAAGGAATTAGG + Intergenic
1114305786 14:21421772-21421794 ATGTGAGTGTATTAGGAAATTGG + Intronic
1115050233 14:29051288-29051310 GTGTGTGTGTTTTAGGACATTGG - Intergenic
1116928220 14:50663464-50663486 CTTTTAGTTTTTAAGGAATTAGG - Intronic
1118975815 14:70675775-70675797 GTGTGTGTTGTTAAGGAGTTTGG - Intergenic
1119279819 14:73396352-73396374 GTGTGTGTGTTTAAGCAACAAGG + Intronic
1121713562 14:96056794-96056816 GTGTGAGGCTATAAAGAATTTGG - Intronic
1122331619 14:100920601-100920623 GTGGGACTGTATAAGGATTTTGG + Intergenic
1123171171 14:106374027-106374049 ATGTGAGTGTCTCAGGAATGCGG - Intergenic
1123503606 15:20915358-20915380 GTGTGAGTGATGAAGAAATAGGG - Intergenic
1123560853 15:21489029-21489051 GTGTGAGTGATGAAGAAATAGGG - Intergenic
1123597092 15:21926320-21926342 GTGTGAGTGATGAAGAAATAGGG - Intergenic
1125000651 15:34766711-34766733 GTGTGATTTTTCAAGTAATTAGG - Intergenic
1125800741 15:42444506-42444528 ATATGAGGGTTTAAGGAATTTGG - Intronic
1126046099 15:44641576-44641598 GTGTGTGTGTGTAAGATATTTGG - Intronic
1126077249 15:44923332-44923354 ATATGAGGGTTTAAGGAATCTGG - Intergenic
1126081466 15:44967533-44967555 ATATGAGGGTTTAAGGAATCTGG + Intronic
1126175245 15:45729966-45729988 ACATGAGGGTTTAAGGAATTTGG + Intergenic
1128965421 15:72052803-72052825 GTGTGAGTGAGTGAGGAGTTTGG - Intronic
1131455756 15:92581135-92581157 GTGTGAGTTTGTCACGAATTTGG - Intergenic
1131694584 15:94862269-94862291 GTTTAAGTGTTTAAAGAATATGG - Intergenic
1202969198 15_KI270727v1_random:216193-216215 GTGTGAGTGATGAAGAAATAGGG - Intergenic
1133014782 16:2934341-2934363 GTCTGAGTGGTTAAGGATTGAGG + Intronic
1136169696 16:28481405-28481427 GTGTGTGTGTTTTAAGCATTGGG - Intronic
1136651495 16:31677113-31677135 GTATGAGGGCTTAAGAAATTTGG - Intergenic
1138193842 16:55037676-55037698 GTGTGAGTGTATATAGAATATGG - Intergenic
1138541896 16:57693181-57693203 ATATGAGTGTTTAAGGGATTCGG + Intergenic
1139801528 16:69526870-69526892 TTGGGAGTTTGTAAGGAATTAGG - Intergenic
1140019590 16:71225354-71225376 GTATGAGAGTTTAAGGAATTTGG - Intronic
1140629765 16:76837124-76837146 GTGAGAGTCTTAAATGAATTGGG - Intergenic
1142165956 16:88588127-88588149 GTGTCAGTATTTAAAGAAATTGG + Intronic
1142647585 17:1324643-1324665 GTGTGTGTGTTTTATGAACTGGG - Intergenic
1143720300 17:8804495-8804517 GTGTTAATGTATATGGAATTTGG + Intronic
1143818604 17:9541092-9541114 ATGGGAATGTTTAGGGAATTTGG - Intronic
1143958647 17:10696455-10696477 GTGTGTGTGTTTTTGGATTTTGG - Intronic
1146462459 17:33057021-33057043 GTGTGTGTGTTTAAGGAGGTGGG + Intronic
1147549856 17:41432992-41433014 GAGTGAATGATTTAGGAATTAGG + Intergenic
1148094812 17:45044978-45045000 ATATGAAGGTTTAAGGAATTTGG + Intronic
1150653752 17:67026187-67026209 GTGTGTGTGTTTGAGGACTGTGG + Intronic
1150653767 17:67026356-67026378 GTGTGTGTATTTGAGGAATGTGG + Intronic
1150653774 17:67026427-67026449 GTGTGTGTATTTGAGGAATGTGG + Intronic
1150867594 17:68870149-68870171 TTATGAAGGTTTAAGGAATTTGG - Intronic
1152884925 17:82844227-82844249 GTGTGTGTGTTTAAAGACCTGGG + Intronic
1152994970 18:397996-398018 GTGTAAGTATTTAAGACATTTGG - Intronic
1154508195 18:15063401-15063423 GAGAGAGATTTTAAGGAATTAGG - Intergenic
1155736978 18:29236083-29236105 GTGTGATTTTTTAAAGTATTGGG - Intergenic
1156018030 18:32568178-32568200 GTGTGAGAGTTTAAGGAATTTGG + Intergenic
1158000371 18:52611376-52611398 GTGAGAGTGTATAAAAAATTAGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158512893 18:58107209-58107231 GTGTGACTGTATAAGGAGTCAGG - Intronic
1158517849 18:58145608-58145630 CTATGGATGTTTAAGGAATTGGG + Intronic
1159217484 18:65413723-65413745 GTGTGAGTATTTAAACTATTCGG - Intergenic
1159556705 18:69953585-69953607 GAGTGACTGTTTAAGGTATGGGG + Intronic
1159726310 18:71964428-71964450 GTGTGTGTGTTTAAGAAATATGG + Intergenic
1159750204 18:72291637-72291659 GTGTGTGTGTTTAAGGAAAATGG - Intergenic
1159968877 18:74624492-74624514 GTGTAAGAGTTTAAGTAATACGG - Intronic
1161518121 19:4708203-4708225 ATGTGAGGGTTTAAGGATTTTGG - Intronic
1161602353 19:5192126-5192148 GTGGGAGTGTTTCAGGAATGGGG + Intronic
1163057705 19:14733636-14733658 CTAAGAGTGTTTAAGGATTTAGG - Exonic
1165231840 19:34392278-34392300 GTGTCAGTGTCTGAGGAATTAGG + Intronic
1165356777 19:35309381-35309403 ACATGAGGGTTTAAGGAATTTGG + Intronic
1165375459 19:35438746-35438768 GCATGAGGGTTTAAGGAATTTGG - Intergenic
1167840221 19:52110771-52110793 GCGTGGGTGTTTGAGGAAGTGGG - Intergenic
1168399408 19:56076108-56076130 GTGTGTGTGTTTAGGTTATTTGG - Intergenic
1168555366 19:57334317-57334339 ATATGAGGGCTTAAGGAATTTGG + Intergenic
925302166 2:2825230-2825252 GTGTGTGTGTTTTATGAATAGGG + Intergenic
927444909 2:23150890-23150912 GTGTGTGTGTTTTAGCCATTTGG - Intergenic
929886837 2:45886266-45886288 GTGGGAGTGGGTTAGGAATTGGG - Intronic
934578445 2:95418260-95418282 GTGTGTGTGTGTAAGGAAAGAGG + Intergenic
934739719 2:96711485-96711507 GCGTGGGTTTTTAAGGAATGTGG + Intronic
934903448 2:98179073-98179095 GTGGGAGTATTTATGGAATCTGG - Intronic
935931882 2:108135457-108135479 GGGGGAGTGTGTAAGGAATCTGG - Intergenic
938225939 2:129616369-129616391 CTATGGGTGTTTAAGGATTTAGG - Intergenic
938716945 2:134029624-134029646 GTGTGCATGTGTGAGGAATTGGG - Intergenic
938721472 2:134070943-134070965 GTGTGTGTGTGTACAGAATTGGG + Intergenic
938730758 2:134145236-134145258 GTGTGTGTGTTTAAAGAACCTGG + Intronic
939589236 2:144043245-144043267 GTGTGTGTGTTTAACCAAGTAGG + Intronic
940780798 2:157931750-157931772 GTGTGTGTGTGTACTGAATTAGG - Intronic
941355970 2:164491636-164491658 GTTTCAGTGTTTTAGCAATTAGG + Intergenic
941646626 2:168047890-168047912 GGTTGAGTTTTTAATGAATTTGG - Intronic
941857740 2:170247824-170247846 GTGTGATTGTTGTAGGAAATGGG - Intronic
942117035 2:172738129-172738151 TTGAGAGTGTTTATGGAAGTTGG + Intronic
942206212 2:173622092-173622114 GTGTCAGTGTTGCAGGAATGAGG - Intergenic
942370967 2:175284194-175284216 GTGCATGTTTTTAAGGAATTTGG + Intergenic
943129829 2:183841161-183841183 GTGTGTGTGTTTCAAGTATTTGG - Intergenic
943207154 2:184914929-184914951 TTGTGAATGTTCAATGAATTGGG + Intronic
944998535 2:205322465-205322487 GCGTGAATGTTCAGGGAATTGGG - Intronic
945473473 2:210254148-210254170 GTTTAAGATTTTAAGGAATTTGG + Intergenic
945485535 2:210391077-210391099 GTGTTAGTGTTTATGGAAGATGG + Intergenic
945549349 2:211200248-211200270 GTGTGTGTGTTAAGGGAATAGGG - Intergenic
945877358 2:215292450-215292472 GTGTGTGTGTTGGGGGAATTTGG - Intergenic
945888904 2:215407879-215407901 GTGTGTGTGTATAAGGGAGTTGG + Intronic
947226687 2:227847437-227847459 GTGTGAGGGTTTAAGAAATGGGG + Intergenic
947234272 2:227923406-227923428 GTGTGAGTGCCTTAGGAATTAGG - Intronic
947329120 2:229009714-229009736 GTGTGAGTATATGAGGAACTAGG + Intronic
948354399 2:237366432-237366454 GTTTGAGGGATTAAGGAATAGGG + Intronic
1170428597 20:16258543-16258565 GGGTGTGTGTTTTTGGAATTGGG - Intergenic
1171510581 20:25680865-25680887 GTGTGAATGTTTAATGTAATGGG - Intronic
1173539270 20:43838966-43838988 GTGTGGGTGTTTTAGGATTAGGG + Intergenic
1174837569 20:53872780-53872802 GTGTGTGTGTTTAAAAAATGTGG + Intergenic
1175875898 20:62229370-62229392 GTGTGAGTGTGTGGGGAATGGGG - Intergenic
1176094970 20:63336691-63336713 GTGTGTGTGTGTACGGATTTGGG - Intergenic
1176789887 21:13308386-13308408 GAGAGAGATTTTAAGGAATTAGG + Intergenic
1177932398 21:27300911-27300933 GTGTGTGTGTTTATTGGATTGGG + Intergenic
1179609423 21:42540259-42540281 ATTTGAGGGTTTAAGGAATTTGG + Intronic
1179720284 21:43312742-43312764 GTGTGTGTGTTTATGGAGTGGGG - Intergenic
1180043237 21:45291299-45291321 ATATGAGAGTTTAAGGAATTTGG + Intergenic
1181518303 22:23430552-23430574 GAGTGAGTGTTGAATGAGTTAGG + Intergenic
1181929384 22:26387758-26387780 GAGAGAGAGTATAAGGAATTGGG + Intergenic
1183350092 22:37330140-37330162 GGGTGAATGTTGGAGGAATTAGG - Intergenic
949125051 3:437151-437173 GGGTGTGTGTTTAAGGGATGAGG - Intergenic
949307447 3:2658603-2658625 GTTTGGGTATTTAAGGAAATGGG - Intronic
949623894 3:5847019-5847041 ATATGAGGGTTTAAAGAATTTGG + Intergenic
949624884 3:5854073-5854095 ATGTGAAAGTTTAAGGAATTTGG + Intergenic
949933276 3:9097417-9097439 CTGAGAGAGTTTAAGGGATTAGG + Intronic
950399409 3:12759131-12759153 GTGTCAGCTTTTAAGGAAATCGG - Intronic
951036918 3:17942739-17942761 GGGTGAGTGCTAAAGGCATTGGG + Intronic
951717522 3:25664807-25664829 GTGTGTGTGTGTGAGGAAATCGG - Intronic
952698026 3:36293203-36293225 GTGTGTGTGTTTCATTAATTTGG + Intergenic
954283327 3:49600269-49600291 GGGGGAGTGTTTAGGGAATGGGG + Intronic
954910819 3:54106027-54106049 ATATGAGCGTTTAAGGAATTTGG + Intergenic
955196137 3:56806382-56806404 GTGTGTGTGTTTACGGGCTTAGG + Intronic
955443723 3:58984839-58984861 TTGTGAGAGTTAAAGGAACTTGG + Intronic
955485187 3:59427994-59428016 GTGGGAGTGTTGTAGGAGTTGGG + Intergenic
957152951 3:76510024-76510046 GTGTGCTTGTTTAGGGAATCTGG - Intronic
957731014 3:84136118-84136140 ATATGAGGGTTGAAGGAATTTGG + Intergenic
958170781 3:89937450-89937472 GTGTGAATGTTGGAGGAATGTGG - Intergenic
959596558 3:108135409-108135431 GTGGGAGTGTATAAGGATGTAGG - Intergenic
961233063 3:125337678-125337700 GTGTGAGTGTTTAGGGGGTGTGG - Intronic
961781255 3:129321701-129321723 GTGTGAATGTGTAAGAAAGTGGG - Intergenic
963134154 3:141885363-141885385 GTGGGAGTGTTAATGAAATTTGG - Intronic
963608885 3:147440333-147440355 GTCAGAGTGATTAAGGGATTTGG + Intronic
964710934 3:159670889-159670911 GTGTGTGTGTGTAAGTAATCGGG + Intronic
964789033 3:160433492-160433514 ATTTGAGTGTGAAAGGAATTTGG - Intronic
964892703 3:161556060-161556082 CTCTGTGTGTTTAAGGAATCAGG + Intergenic
965496836 3:169408952-169408974 CTGTGAGTGCTTAAGAAATGTGG + Intronic
968342456 3:197967945-197967967 GTGTGACTGCCTAAGGAGTTGGG - Intronic
969435440 4:7186550-7186572 CAGACAGTGTTTAAGGAATTAGG - Intergenic
970662204 4:18298520-18298542 GTGAGAGTGGTTAAGGAAAAAGG + Intergenic
971236738 4:24849213-24849235 GTGTCAGTCTATAAGGAATGAGG - Intronic
971513997 4:27464028-27464050 GGGTGAGTGTTTTAGCAAATAGG + Intergenic
972315311 4:37920707-37920729 ATGTGAGTGTTTTAAGAAGTGGG + Intronic
972720247 4:41689274-41689296 GTGCGTGTGTTTAAGTTATTAGG - Intronic
973126016 4:46585696-46585718 ATATGAGGATTTAAGGAATTTGG + Intergenic
973542164 4:51945587-51945609 GTGGAAGTGTTTCTGGAATTGGG + Intergenic
974485583 4:62500878-62500900 GTTTGGATGTTTTAGGAATTTGG - Intergenic
975913989 4:79300724-79300746 GTGTGTGTTTTTAATGCATTGGG + Intronic
977314677 4:95430968-95430990 GTGTGAGTGGCTAAGGAGGTGGG - Intronic
977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG + Intronic
977984335 4:103364003-103364025 GTGTGTGTGTATAAAGACTTAGG + Intergenic
978278510 4:106980898-106980920 TTGTGAGTTTTTAAAAAATTTGG - Intronic
979084277 4:116386861-116386883 GTGTGACTTTTTATGGAATTGGG + Intergenic
979508400 4:121524372-121524394 GTGAGAGCGTCTAAGGAATATGG + Intergenic
979770457 4:124518236-124518258 GTGTGAGTGTGTCAAGACTTTGG + Intergenic
980533220 4:134081512-134081534 ATTTGAGAGTTTAAGGAATCTGG + Intergenic
980961293 4:139479006-139479028 TTGTGAGTGTGTGAGGAATCAGG - Intergenic
981366464 4:143909809-143909831 CTTTTAGTTTTTAAGGAATTAGG - Intergenic
982618635 4:157675677-157675699 GTGTGTGTATTTCAAGAATTGGG + Intergenic
984565604 4:181326588-181326610 GAGTGAGTGGTCAATGAATTCGG - Intergenic
985139717 4:186827375-186827397 TTGGGAGTGTTTACGGAATCGGG + Intergenic
985424603 4:189817267-189817289 GTGTGACTTTTTCAGAAATTTGG + Intergenic
986806481 5:11312713-11312735 GTGTGAATGTTTAAGGCTGTGGG - Intronic
987480005 5:18441455-18441477 TTGGGAGGGTTAAAGGAATTTGG - Intergenic
988043120 5:25912726-25912748 GTGGGAGTGGTAAAGGAATGAGG - Intergenic
988494167 5:31730599-31730621 GTGTGTGTGTGTAAGGGAGTTGG + Intronic
989172893 5:38491073-38491095 GCTTCAGTGTTAAAGGAATTAGG + Intronic
989451309 5:41589290-41589312 CTGAGAGAATTTAAGGAATTGGG - Intergenic
989619645 5:43371718-43371740 GTGTCTGTGGATAAGGAATTTGG - Intergenic
990357256 5:54981481-54981503 GTGTGTGTTTTTATGGATTTTGG - Intronic
993625163 5:90215156-90215178 ATATGAGGGTTTAAGGAATTTGG + Intergenic
994865627 5:105265482-105265504 GTGTGTGTGTTTAATTAATGAGG - Intergenic
996443153 5:123513080-123513102 GTTGGAGTGTTTAAGGGGTTGGG + Intronic
996445361 5:123542878-123542900 GTGTGTGTGTTTACCAAATTTGG + Intronic
997224974 5:132203075-132203097 ATTTGAGGGTTTAGGGAATTTGG - Intronic
997229502 5:132232347-132232369 ATATGAGATTTTAAGGAATTTGG - Intronic
998036496 5:138921443-138921465 GTGTCAGTGTCCAAAGAATTTGG + Intronic
998284601 5:140847176-140847198 CCATGAGTGATTAAGGAATTTGG + Intronic
999935149 5:156478503-156478525 GTGTCTGTGTTTAAGCAGTTTGG + Intronic
1000467781 5:161601149-161601171 GTGGGAGTTTTAAAGCAATTGGG + Intronic
1000684621 5:164232856-164232878 TTGTGAGTCTTTAAGGAAAGAGG - Intergenic
1000818876 5:165958755-165958777 GTGTGCGTGTATAACGAATTTGG - Intergenic
1002491101 5:179577965-179577987 TTCTCATTGTTTAAGGAATTTGG + Intronic
1002595557 5:180319900-180319922 GTGTGTGTGTGTAAGAAACTAGG - Intronic
1003307827 6:4945496-4945518 GGGTGAGTGTTTTAGCATTTGGG - Intronic
1004539183 6:16533376-16533398 GTTTGAGTGTTCCAGGAAATCGG + Intronic
1004613825 6:17270822-17270844 GTGTGTGTGTGTAAGGAAAGTGG + Intergenic
1005042917 6:21615484-21615506 GTGTGTGTGTGTAGGGAATGTGG - Intergenic
1005144569 6:22673523-22673545 GTGTGTGTGTTTTAGTAATTGGG - Intergenic
1007542838 6:42665675-42665697 GCTTGTGTGTTTAAGGAATAAGG - Intronic
1007628678 6:43260525-43260547 GTGTGAGTGTGTAAGGACTGAGG - Intronic
1007850147 6:44794794-44794816 GTGTGTGAGTTCAATGAATTGGG + Intergenic
1008732086 6:54494719-54494741 TTATGAGGGTTTAAGGAATTTGG + Intergenic
1010462365 6:76127996-76128018 TTATGAGAATTTAAGGAATTTGG - Intergenic
1011841569 6:91507558-91507580 TTGTGAGTGTTCAAGTACTTAGG + Intergenic
1012720723 6:102739492-102739514 GTTTGACTGTTTAAAGCATTAGG + Intergenic
1015503274 6:133954326-133954348 GTGTGTGTGTGTAAGCAATGTGG + Intronic
1016416414 6:143839180-143839202 TTGTGAGGGTTTAGGGAATTTGG - Intronic
1017362662 6:153594453-153594475 GTGTGTGTGTTTAGGGCAGTAGG - Intergenic
1018186814 6:161272693-161272715 GTGTGTGTGTTTAGGGAAATGGG - Intronic
1018343145 6:162873218-162873240 GTGTGTGTGTTTAGGTAACTGGG + Intronic
1018579177 6:165292964-165292986 GAGTGAGTGTTTAACAAACTTGG + Intronic
1019229075 6:170542582-170542604 ATTTGAGTGTTGAAGGAATTTGG - Intronic
1020288211 7:6702291-6702313 GTGTGTGTGTTTGTGGAGTTTGG - Intronic
1020536846 7:9409313-9409335 GTGTGTGTGTTTTCAGAATTTGG + Intergenic
1020673759 7:11153963-11153985 GTGTGTGTGTTTTAAGAATAAGG + Intronic
1021142855 7:17049303-17049325 GTGTGTGTGTGTATGGTATTGGG - Intergenic
1021892172 7:25196399-25196421 CTAAGAGTGTTTAAGGATTTAGG + Intergenic
1022232181 7:28424772-28424794 GTGTGTGTGTTTATGGGAATGGG - Intronic
1022669573 7:32443125-32443147 ATATGAGGGTTTAAGGAATTTGG - Intergenic
1022839854 7:34153360-34153382 GTGTGTGTGTTTACAGAATCGGG - Exonic
1023721486 7:43099623-43099645 ATTTGAGGGTTTAAGGAATTTGG + Intergenic
1025611535 7:63078876-63078898 ATATGAAGGTTTAAGGAATTTGG + Intergenic
1025708096 7:63885615-63885637 ATATGAGGCTTTAAGGAATTTGG - Intergenic
1027217663 7:76194353-76194375 GAGTGGGTATTTAAGGTATTGGG + Intergenic
1027764980 7:82328188-82328210 GTCTGAGTGGTGAAGGGATTAGG - Intronic
1029221292 7:98992579-98992601 GTGTGTGTGTTTAAGTTATGAGG + Intronic
1029256355 7:99272317-99272339 GTCTGAGAGGTTAAGGAACTGGG + Intergenic
1030061315 7:105623546-105623568 GTGTGTGTGTTGAAGGAAAGAGG - Intronic
1030717180 7:112823111-112823133 GAGTGAGGGATTAAGGTATTAGG - Intronic
1030984427 7:116224249-116224271 GTTTGTGTGTGTCAGGAATTTGG - Intronic
1032596570 7:133246784-133246806 TTCTGAGTGTTTTAGGAAATTGG - Intergenic
1033608778 7:142946094-142946116 GTGTGTGTGATTGGGGAATTGGG - Intronic
1036588341 8:10145832-10145854 GTGTGTGTGTGTAATGATTTTGG + Intronic
1036711355 8:11081278-11081300 ATATGAGTGTTTAATGCATTAGG - Intronic
1037113927 8:15200810-15200832 GTGTGACAGGTTAAGGACTTTGG - Intronic
1037310223 8:17547814-17547836 GTGTGTGTGTTTACAAAATTTGG + Intronic
1037554837 8:20012278-20012300 GTGTGTGGGTTTTGGGAATTGGG + Intergenic
1041276358 8:56163077-56163099 GTGTGAGTGTGGAAGGATCTTGG - Exonic
1041527003 8:58817603-58817625 GTCTGTGTGTTTAAGTAATCTGG + Intronic
1042028163 8:64445865-64445887 GTGTGTGTGTTCATGGAATGGGG + Intergenic
1042282872 8:67073667-67073689 GTGTGTGTGTCTTAAGAATTGGG - Intronic
1043058520 8:75470567-75470589 GTGTGAATGTTAAATGAAATGGG + Intronic
1044436909 8:92175372-92175394 GAGAGGGTGTTTAAGGTATTTGG + Intergenic
1044611281 8:94094788-94094810 GTGTCAGGGTTCAAGGAAATGGG - Intergenic
1046147693 8:110182769-110182791 GTGTGTGTGTTTTAGGGATGAGG + Intergenic
1046201828 8:110937193-110937215 GTGTAAGTGTATATGAAATTAGG - Intergenic
1046532308 8:115462756-115462778 GTGTGGGTATTTAAAGAATAAGG + Intronic
1046681504 8:117175606-117175628 GTGTGAGAGTTTAATAAATTAGG + Intronic
1047037370 8:120954771-120954793 GCGTGAGTGTATCAGGAATCAGG + Intergenic
1047628701 8:126682548-126682570 GTGTGAGGGTTTAAGAGATCTGG - Intergenic
1049424049 8:142530125-142530147 GTGTGAGTGTGTATATAATTGGG + Intronic
1049712183 8:144070048-144070070 ATGTGTGGGTTTAAGGCATTTGG + Intergenic
1051721309 9:20040214-20040236 TTGTTAGTGTTTAAAGATTTTGG + Intergenic
1052062652 9:23979683-23979705 GTGTGACAGGCTAAGGAATTTGG + Intergenic
1052571237 9:30226738-30226760 TTGTGAGTGGGTGAGGAATTGGG - Intergenic
1052571375 9:30228458-30228480 TTGTGAGTGGGTGAGGAATTGGG + Intergenic
1053586632 9:39465411-39465433 ATCTGACTGTTTAAAGAATTAGG + Intergenic
1054579675 9:66899815-66899837 ATCTGACTGTTTAAAGAATTAGG - Intronic
1055598278 9:77888012-77888034 GTGTTAGTGTGAAAGTAATTAGG - Intronic
1055967505 9:81880148-81880170 GTGTTTGTTTTAAAGGAATTTGG + Intergenic
1058877366 9:109256363-109256385 CTGTGTGCGTTTAAGTAATTTGG - Intronic
1059172814 9:112142576-112142598 GTGTGTGTGTGTGAGGAATAGGG - Intronic
1059280735 9:113131465-113131487 GTGTGTGTGTTTAAGGTGTGGGG + Intergenic
1059950588 9:119458285-119458307 GTGTGAGTGCTCAAAGAAGTGGG + Intergenic
1061102661 9:128504024-128504046 ATATGAGGGTTTATGGAATTTGG + Intergenic
1186533154 X:10317803-10317825 GGATCAGGGTTTAAGGAATTTGG - Intergenic
1186706851 X:12149105-12149127 GTCTCATTATTTAAGGAATTTGG + Intronic
1186816183 X:13240260-13240282 ATGTCAGTGCTTAAGGAATAGGG - Intergenic
1187524492 X:20042034-20042056 GTGTGTGTTTTTAAGAAATGGGG - Intronic
1187709521 X:22039640-22039662 ATATGCGGGTTTAAGGAATTTGG + Intronic
1187767648 X:22660932-22660954 GTGTGACTGATTTAGGAATGTGG + Intergenic
1189410571 X:40766924-40766946 GTGTGTGTATTTCAGGAATAGGG - Intergenic
1190149937 X:47936960-47936982 GTAAGAGTTTTTAAGGATTTAGG - Intronic
1195485357 X:105398492-105398514 GTGTGTGTGTGTATGTAATTAGG + Intronic
1195588248 X:106591808-106591830 GTGTGTGTGTTTAACAAAATAGG - Intergenic
1195631388 X:107059195-107059217 ATGTGATGGTTTGAGGAATTGGG - Intergenic
1196164744 X:112526422-112526444 GGGTGAGGGTTTAAGGAAGTGGG + Intergenic
1196263707 X:113616416-113616438 GTGTGAGTGTTCATGGATTAGGG - Intergenic
1196681215 X:118471841-118471863 GTGTGTGTGTTTAAGAGATGGGG - Intergenic
1197824936 X:130579385-130579407 GTGTGGCTGATTAAGGAGTTAGG + Intergenic
1197830148 X:130632956-130632978 GTGTGAGAGTTTAACAGATTGGG + Intronic
1198845485 X:140906003-140906025 GTGTGAGGTTTTAACGAGTTGGG + Intergenic
1199816134 X:151398047-151398069 GGGTGAGTGATTACAGAATTAGG + Intronic
1200782597 Y:7230221-7230243 GTGTGCGTGTTTAACAAATATGG - Intergenic