ID: 1092301153

View in Genome Browser
Species Human (GRCh38)
Location 12:7251430-7251452
Sequence GCGCCGTTTTTTAAGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092301153_1092301160 11 Left 1092301153 12:7251430-7251452 CCGACCAGCTTAAAAAACGGCGC No data
Right 1092301160 12:7251464-7251486 TATCCCGCACCTGGCTTGGAGGG 0: 145
1: 854
2: 1669
3: 1660
4: 1049
1092301153_1092301159 10 Left 1092301153 12:7251430-7251452 CCGACCAGCTTAAAAAACGGCGC No data
Right 1092301159 12:7251463-7251485 ATATCCCGCACCTGGCTTGGAGG 0: 150
1: 856
2: 1671
3: 1693
4: 1034
1092301153_1092301158 7 Left 1092301153 12:7251430-7251452 CCGACCAGCTTAAAAAACGGCGC No data
Right 1092301158 12:7251460-7251482 ATTATATCCCGCACCTGGCTTGG 0: 636
1: 1265
2: 1149
3: 581
4: 360
1092301153_1092301157 2 Left 1092301153 12:7251430-7251452 CCGACCAGCTTAAAAAACGGCGC No data
Right 1092301157 12:7251455-7251477 ACAAGATTATATCCCGCACCTGG 0: 57
1: 385
2: 1010
3: 2052
4: 1452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092301153 Original CRISPR GCGCCGTTTTTTAAGCTGGT CGG (reversed) Intergenic
No off target data available for this crispr