ID: 1092302515

View in Genome Browser
Species Human (GRCh38)
Location 12:7265375-7265397
Sequence CCCAAGCGCAGTGTTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092302515_1092302518 4 Left 1092302515 12:7265375-7265397 CCACAAGGAACACTGCGCTTGGG No data
Right 1092302518 12:7265402-7265424 GACTGCCTCAGCATTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092302515 Original CRISPR CCCAAGCGCAGTGTTCCTTG TGG (reversed) Intergenic