ID: 1092302564

View in Genome Browser
Species Human (GRCh38)
Location 12:7265943-7265965
Sequence GCTGACTTCAGAACTGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092302563_1092302564 -2 Left 1092302563 12:7265922-7265944 CCAGAACTCTTTAGCGAAATGGC No data
Right 1092302564 12:7265943-7265965 GCTGACTTCAGAACTGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092302564 Original CRISPR GCTGACTTCAGAACTGTGAC AGG Intergenic
No off target data available for this crispr